The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043122	Bordetella holmesii strain I100 chromosome, complete genome	3696624	1096346	1203135	3696624	protease,tRNA,transposase	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1096346_1097567_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1097654_1098245_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1098241_1098544_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1098595_1099585_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1099705_1100587_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1100760_1101615_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1101646_1102495_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1102622_1103843_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1103861_1104428_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1104625_1105777_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1105915_1106920_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1107076_1108048_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1108126_1108915_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1108986_1109223_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1109231_1110143_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1110186_1112058_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1112218_1113016_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1113247_1113622_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1113698_1114022_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1114105_1114378_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1114392_1114848_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1114969_1115806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1115802_1117176_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1117252_1118209_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1118296_1119274_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1119398_1121054_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1121102_1121567_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1121563_1122025_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1122250_1123438_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1123434_1124739_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1124735_1126145_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1126338_1127458_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1127593_1128613_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1128621_1131327_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1131466_1132120_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1132182_1132545_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1133111_1134572_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1134834_1135908_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1135992_1137213_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1138970_1140091_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1140064_1141564_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1141577_1142681_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1142685_1143936_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1143932_1145378_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1145374_1145689_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1145690_1146809_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1146991_1148212_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1148311_1149178_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1149238_1150219_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1150365_1151286_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1151294_1152407_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1152488_1153310_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1153385_1153994_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1154131_1155508_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1155569_1156013_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1156079_1156736_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1156778_1157898_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1158067_1158349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1159059_1159848_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1159844_1160951_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1161625_1162984_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1163098_1163296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557831.1|1163313_1164434_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_076879487.1|1164527_1165082_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1165669_1166986_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1166998_1168012_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1168558_1169509_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1169588_1169888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1171248_1172907_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1173055_1174276_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1174393_1175677_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1175680_1176622_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1176731_1177190_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1177570_1178191_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_162007582.1|1178598_1181019_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	1.7e-64
WP_005012762.1|1181126_1181864_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1181910_1183155_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1183477_1183750_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1184333_1185062_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1185083_1186001_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1186000_1186510_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1186626_1187298_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1187407_1188475_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1188494_1190339_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1190475_1191663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1191963_1192749_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1192772_1193892_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1193996_1195334_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1195443_1196385_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1196440_1197622_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1197780_1198071_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1198117_1198786_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1198782_1199070_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1199446_1200232_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1200264_1200999_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1201914_1203135_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043122	Bordetella holmesii strain I100 chromosome, complete genome	3696624	1207922	1264328	3696624	protease,tRNA,transposase	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1207922_1208873_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1208954_1209434_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1210645_1211845_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1211990_1212368_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1212391_1214173_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1214181_1214919_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1215203_1216763_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1216822_1217581_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1217677_1218334_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1218487_1219252_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1219266_1219446_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1219471_1220506_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1220502_1220916_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1220912_1221497_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1221849_1223208_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1223301_1223880_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1224004_1225125_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1225197_1226454_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1226557_1227763_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1227826_1228276_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1228408_1228654_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1228878_1229193_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1234446_1236552_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1236605_1238915_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1240268_1241936_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1241938_1242604_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1242736_1246543_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1246768_1247914_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1248032_1248962_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1248958_1250035_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1250031_1250838_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1250834_1251566_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1251942_1253181_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1253228_1253567_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1253814_1254765_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1255083_1255266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1255331_1256552_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1256645_1257866_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1257925_1258189_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_153570614.1|1258310_1259810_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1259857_1260133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1260230_1260428_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1260443_1260803_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1260875_1261898_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1261910_1264328_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043122	Bordetella holmesii strain I100 chromosome, complete genome	3696624	1587866	1694158	3696624	integrase,tRNA,transposase	Leptospira_phage(14.29%)	100	1645178:1645194	1690844:1690860
WP_005011985.1|1587866_1589087_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1589441_1589918_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1590176_1590785_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1590803_1591475_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1591648_1593535_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1593562_1594405_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1594401_1595745_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1595929_1596745_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1596810_1598292_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1598490_1600563_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1600782_1601820_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1603043_1603901_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1603928_1604705_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1605532_1606042_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1607119_1607890_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1607886_1608897_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1608955_1610036_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1610204_1611324_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1611325_1612069_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1612073_1612445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1612505_1612751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1612857_1614357_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1614978_1615314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1615572_1615704_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1615733_1616231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1616240_1616615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1616705_1617998_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1618114_1619014_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1619165_1619384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1619857_1621483_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1621718_1623242_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1623213_1623909_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1624249_1625311_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1625356_1625908_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1625914_1626835_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1626974_1629272_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1629327_1630548_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1630806_1631412_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1631422_1632583_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1632604_1633486_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1633782_1634481_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1634622_1635345_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1635463_1636402_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1636432_1637212_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1637198_1638422_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1638426_1639974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1640009_1640543_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1640786_1641482_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1641496_1641628_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1641675_1642800_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1642805_1645145_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1645141_1645549_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1645178:1645194	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1645810_1646071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1646293_1647244_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1647342_1648293_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1648342_1649551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1649772_1650312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1650536_1650941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1651005_1651761_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1651760_1653122_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1653118_1653742_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1653785_1654905_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1655557_1656313_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1656489_1657284_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1657280_1657718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1657829_1657982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1658402_1659371_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1659527_1660535_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1660592_1661051_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1661124_1662471_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1662488_1662860_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1662859_1664329_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1664484_1665210_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_153570615.1|1665223_1667938_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1668189_1669554_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1669593_1670652_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1670679_1671498_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1671535_1671814_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1673077_1673377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1673946_1675350_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1675362_1676013_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1676154_1677375_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1677405_1678482_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1678628_1679759_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1679945_1681571_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1681577_1682393_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1682407_1683478_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1683529_1684189_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1684828_1685991_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1686032_1686347_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1686330_1686717_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1686755_1687022_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1687414_1688104_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1688203_1688365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1688515_1688680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1688806_1689043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1689232_1689481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1689594_1690965_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1690844:1690860	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1690965_1691706_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1692205_1694158_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043122	Bordetella holmesii strain I100 chromosome, complete genome	3696624	1712452	1756379	3696624	transposase,integrase,holin,tRNA	Leptospira_phage(33.33%)	37	1754947:1754961	1761423:1761437
WP_005019367.1|1712452_1715314_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1715303_1716269_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1717025_1718501_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1718505_1718781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1719117_1720237_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1720111_1720360_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1720538_1721747_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1721743_1724026_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1724036_1726418_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1726681_1728589_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1728603_1729494_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1729500_1730634_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1730633_1731455_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1731479_1732670_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1732971_1733253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1733418_1733739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1733778_1734865_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1735061_1735322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1735814_1736585_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1736581_1737592_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1737626_1738469_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1738931_1739717_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1740576_1741696_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1742762_1743767_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1743842_1744655_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1744882_1747054_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1747107_1748427_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1748515_1749736_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1749954_1750815_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1750811_1752035_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1752333_1752831_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1752869_1753652_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1753677_1753896_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1753970_1754240_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1754459_1754924_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1754947:1754961	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1754997_1755279_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1755395_1756379_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1761423:1761437	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043122	Bordetella holmesii strain I100 chromosome, complete genome	3696624	1781655	1823047	3696624	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1781655_1782606_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1782602_1783118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1783475_1784096_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1784195_1784447_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1784534_1786013_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1786009_1789180_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1789192_1790389_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1790577_1791510_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1791578_1792310_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1792375_1793011_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1792996_1794175_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1794335_1794884_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1794964_1795324_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1795372_1796593_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1796668_1797790_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1797827_1798541_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1798551_1799772_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1799854_1800409_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1800554_1801505_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1801464_1801626_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1801666_1802593_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1802606_1803479_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1803641_1804589_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1804927_1805509_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1806086_1807037_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1807016_1807769_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1807781_1808513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1808669_1810835_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1810924_1811194_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1811282_1811489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1811487_1812006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1812024_1812804_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1812971_1813988_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1814060_1814552_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1814562_1816278_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1817441_1818392_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1820043_1821285_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1821296_1822070_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1822096_1823047_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043122	Bordetella holmesii strain I100 chromosome, complete genome	3696624	2150211	2210334	3696624	protease,transposase,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150211_2150700_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150692_2151541_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151632_2152130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152267_2152627_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152623_2152905_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152904_2153387_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153388_2155017_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2155013_2155358_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155359_2158302_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158747_2159719_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159708_2161091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161233_2162184_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162143_2163385_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163381_2164503_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165994_2166462_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166532_2167183_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167269_2168409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168577_2169582_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169578_2170826_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171178_2172045_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2172004_2173609_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173620_2174307_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174303_2175344_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175459_2176131_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019577.1|2176127_2177120_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177116_2178055_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2178051_2179206_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179214_2180666_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180696_2181179_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181180_2182074_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2182070_2182514_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182526_2182901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2183043_2183442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183568_2183856_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183852_2184269_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184444_2185077_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2185105_2185552_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185838_2186990_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2187103_2188108_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2189091_2189799_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189731_2191183_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191188_2194347_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194359_2194881_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194870_2195695_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195691_2196291_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196399_2198256_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198404_2199409_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199617_2200880_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200884_2201220_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201216_2202146_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202150_2202864_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202967_2204425_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204421_2204718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2204842_2206201_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2206301_2207102_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207281_2208400_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208472_2208844_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208850_2209702_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209722_2210334_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043122	Bordetella holmesii strain I100 chromosome, complete genome	3696624	2305463	2426973	3696624	protease,integrase,tRNA,transposase	Leptospira_phage(15.15%)	106	2336993:2337052	2358300:2358574
WP_101557807.1|2305463_2306626_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306738_2307707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307703_2308624_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308720_2313199_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313577_2317912_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318550_2319114_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319125_2319371_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319526_2320036_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2320081_2321062_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321273_2323625_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323671_2324502_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324498_2325188_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325180_2326461_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326558_2327497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327478_2329185_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329262_2330366_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330418_2331168_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331174_2332689_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332701_2332989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2333009_2333897_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2334047_2334554_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334550_2335507_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335694_2337041_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336993:2337052	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2337008_2337239_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337268_2337832_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337986_2338757_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338753_2339764_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2340078_2340525_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340580_2340775_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340776_2341118_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341127_2342990_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2343029_2343536_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343539_2343863_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343864_2344269_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344305_2345517_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345538_2346087_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346311_2346803_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2347017_2349048_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349122_2350325_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350867_2351803_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352836_2353118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353204_2353378_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353489_2353834_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353905_2354574_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355989_2357033_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2357029_2357131_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357222_2358342_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358592_2359246_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358300:2358574	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359361_2360582_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360632_2363062_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363227_2364526_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364630_2365284_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365286_2366597_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366824_2367364_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367842_2368109_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368147_2368513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368394_2369405_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369401_2370172_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370257_2370917_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370884_2371376_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371485_2371689_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2372006_2372327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372310_2372646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372700_2372913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372988_2373327_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373323_2373659_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373721_2375293_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2376086_2376398_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376590_2377711_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377838_2378033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384114_2385276_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385661_2387125_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387257_2388808_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388804_2388954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389119_2390240_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391353_2392211_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392263_2392761_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392881_2394297_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394306_2395491_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395487_2397086_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398268_2398514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398924_2399110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399265_2400177_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400298_2401141_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401343_2402717_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2403026_2404538_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404690_2405422_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405528_2406830_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406837_2407746_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407742_2408336_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408379_2408793_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408789_2409260_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409266_2409872_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411673_2413458_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413454_2414840_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414825_2415788_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415857_2416487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416524_2417733_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417854_2418424_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418555_2420109_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420412_2421633_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2422040_2422943_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422939_2423809_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423805_2424657_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424653_2425478_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425752_2426973_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043122	Bordetella holmesii strain I100 chromosome, complete genome	3696624	2936430	3013490	3696624	transposase,integrase,tRNA	Ralstonia_virus(21.43%)	56	2939285:2939344	2987872:2988442
WP_005019978.1|2936430_2937210_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937232_2938180_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938181_2938382_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938716_2939836_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939285:2939344	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940157_2940874_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940870_2941764_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941927_2943148_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943300_2944383_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2946062_2947046_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2947108_2948521_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948638_2949481_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949759_2950368_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950383_2951004_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2951069_2951777_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951781_2952504_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952490_2952781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952856_2954077_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954801_2955653_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955704_2956958_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957134_2957923_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2958042_2958957_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2959089_2960982_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961167_2962547_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962991_2963288_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2967088_2967691_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967824_2968283_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968284_2968884_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968892_2969702_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969736_2970591_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970710_2971298_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971294_2972674_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973178_2973325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980996_2982337_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982350_2983202_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983213_2984479_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984540_2986445_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988420_2989275_-	hypothetical protein	NA	NA	NA	NA	NA
2987872:2988442	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989267_2990062_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990277_2991228_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991830_2992628_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992667_2993321_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993301_2994366_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994529_2996755_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2997000_2998845_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998961_2999834_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999880_3001581_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001643_3002843_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002853_3003732_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003838_3004876_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004956_3005361_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005372_3006830_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007472_3008069_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008229_3008688_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009465_3010437_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010558_3010978_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012269_3013490_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
>prophage 9
NZ_CP043122	Bordetella holmesii strain I100 chromosome, complete genome	3696624	3548740	3585956	3696624	protease,holin,tRNA,transposase	Ralstonia_virus(11.11%)	38	NA	NA
WP_005011985.1|3548740_3549961_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005016909.1|3550022_3551201_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005016911.1|3551219_3552314_-|tRNA	tRNA CCA-pyrophosphorylase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.2e-49
WP_005016914.1|3552310_3554350_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	38.7	3.4e-13
WP_005016917.1|3554470_3555148_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_005016919.1|3556810_3557743_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_005016921.1|3557756_3558560_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_005016923.1|3558592_3559456_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_005016926.1|3559554_3560505_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005016929.1|3560501_3560981_-	DoxX family protein	NA	NA	NA	NA	NA
WP_005016932.1|3560943_3561216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076879514.1|3561179_3561944_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_005016938.1|3561979_3562237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005016939.1|3562513_3563503_+	extra-cytoplasmic solute receptor family protein 175	NA	NA	NA	NA	NA
WP_005016941.1|3563556_3564399_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_005016943.1|3564398_3564734_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_005016945.1|3564796_3566218_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	29.0	1.8e-37
WP_005016947.1|3566478_3567522_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_005016949.1|3567589_3567811_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_005016951.1|3568037_3568250_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_005016952.1|3568246_3569011_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_005016955.1|3569065_3570229_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	60.9	3.4e-127
WP_005020237.1|3570246_3571362_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_005016962.1|3571358_3572252_+	lysophospholipid acyltransferase family protein	NA	A0A1W6JP29	Morganella_phage	31.2	5.5e-32
WP_005016964.1|3572274_3573171_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_005016967.1|3573195_3573864_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_005016969.1|3573870_3574839_+	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	29.9	3.3e-14
WP_005020238.1|3574844_3576890_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005016972.1|3576976_3577918_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_005016975.1|3577914_3578580_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_005020243.1|3578540_3579542_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005016979.1|3579544_3580420_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005016985.1|3580416_3581172_-	metal ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.5	5.5e-09
WP_017685723.1|3581347_3581848_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_005016990.1|3582207_3583317_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_005016992.1|3583438_3583903_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_005016994.1|3584055_3584610_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017685724.1|3584621_3585956_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.6	9.3e-44
