The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043118	Bordetella holmesii strain I265 chromosome, complete genome	3693267	1095224	1203062	3693267	protease,transposase,tRNA	Ralstonia_virus(16.67%)	99	NA	NA
WP_005011985.1|1095224_1096445_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096532_1097123_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097119_1097422_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097473_1098463_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098583_1099465_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099638_1100493_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100524_1101373_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101500_1102721_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102739_1103306_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103503_1104655_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104793_1105798_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105954_1106926_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107004_1107793_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107864_1108101_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108109_1109021_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109064_1110936_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111096_1111894_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112125_1112500_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112576_1112900_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1112983_1113256_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113270_1113726_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113847_1114684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114680_1116054_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116130_1117087_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117174_1118152_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118276_1119932_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1119980_1120445_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120441_1120903_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_162007604.1|1121128_1122316_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122312_1123617_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123613_1125023_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125216_1126336_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126471_1127491_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127499_1130205_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130344_1130998_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131060_1131423_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1131989_1133450_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133712_1134786_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134870_1136091_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137848_1138969_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138942_1140442_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140455_1141559_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141563_1142814_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142810_1144256_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144252_1144567_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144568_1145687_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145869_1147090_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147189_1148056_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148116_1149097_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149243_1150164_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150172_1151285_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151366_1152188_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152263_1152872_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153009_1154386_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154447_1154891_+	cytochrome c	NA	NA	NA	NA	NA
WP_153567802.1|1154957_1155614_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155656_1156776_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156945_1157227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157937_1158726_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158722_1159829_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160503_1161862_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1161976_1162174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162191_1163312_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163405_1163960_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164547_1165864_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165876_1166890_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167436_1168387_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168466_1168766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153567792.1|1168753_1169515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1169613_1170564_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_153567793.1|1170585_1171179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1171175_1172834_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1172982_1174203_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1174320_1175604_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1175607_1176549_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1176658_1177117_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1177497_1178118_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1178525_1180946_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1181053_1181791_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1181837_1183082_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1183404_1183677_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1184260_1184989_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1185010_1185928_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1185927_1186437_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1186553_1187225_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1187334_1188402_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1188421_1190266_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1190402_1191590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1191890_1192676_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1192699_1193819_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1193923_1195261_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1195370_1196312_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1196367_1197549_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1197707_1197998_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1198044_1198713_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1198709_1198997_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1199373_1200159_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1200191_1200926_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1201841_1203062_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043118	Bordetella holmesii strain I265 chromosome, complete genome	3693267	1207849	1264255	3693267	protease,transposase,tRNA	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1207849_1208800_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1208881_1209361_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1210572_1211772_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1211917_1212295_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1212318_1214100_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1214108_1214846_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1215130_1216690_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1216749_1217508_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1217604_1218261_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1218414_1219179_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1219193_1219373_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1219398_1220433_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1220429_1220843_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1220839_1221424_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1221776_1223135_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1223228_1223807_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1223931_1225052_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1225124_1226381_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1226484_1227690_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1227753_1228203_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1228335_1228581_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1228805_1229120_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1234373_1236479_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1236532_1238842_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1240195_1241863_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1241865_1242531_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1242663_1246470_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1246695_1247841_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1247959_1248889_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1248885_1249962_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1249958_1250765_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1250761_1251493_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1251869_1253108_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1253155_1253494_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012650.1|1253741_1254692_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1255010_1255193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1255258_1256479_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1256572_1257793_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1257852_1258116_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1258237_1259737_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1259784_1260060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1260157_1260355_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1260370_1260730_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1260802_1261825_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1261837_1264255_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043118	Bordetella holmesii strain I265 chromosome, complete genome	3693267	1652626	1693000	3693267	integrase,transposase,tRNA	Leptospira_phage(28.57%)	39	1645068:1645084	1689685:1689701
1645068:1645084	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_101557770.1|1652626_1653746_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654398_1655154_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655330_1656125_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656121_1656559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656670_1656823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657243_1658212_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658368_1659376_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659433_1659892_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1659965_1661312_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661329_1661701_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661700_1663170_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663325_1664051_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664064_1666779_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667030_1668395_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668434_1669493_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669520_1670339_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670376_1670655_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671918_1672218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672787_1674191_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674203_1674854_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1674995_1676216_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676246_1677323_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677469_1678600_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678786_1680412_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680418_1681234_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681248_1682319_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682370_1683030_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683669_1684832_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684873_1685188_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685171_1685558_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685596_1685863_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686255_1686945_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687044_1687206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687356_1687521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687647_1687884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688073_1688322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688435_1689806_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689685:1689701	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689806_1690547_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691047_1693000_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043118	Bordetella holmesii strain I265 chromosome, complete genome	3693267	1711294	1755221	3693267	holin,integrase,transposase,tRNA	Leptospira_phage(33.33%)	37	1753789:1753803	1760265:1760279
WP_005019367.1|1711294_1714156_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714145_1715111_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715867_1717343_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717347_1717623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1717959_1719079_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1718953_1719202_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719380_1720589_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720585_1722868_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722878_1725260_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725523_1727431_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727445_1728336_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728342_1729476_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729475_1730297_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730321_1731512_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731813_1732095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732260_1732581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732620_1733707_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733903_1734164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734656_1735427_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735423_1736434_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_050597667.1|1736492_1737311_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.2e-54
WP_005013673.1|1737773_1738559_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739418_1740538_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741604_1742609_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742684_1743497_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743724_1745896_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1745949_1747269_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747357_1748578_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748796_1749657_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749653_1750877_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751175_1751673_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751711_1752494_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752519_1752738_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752812_1753082_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753301_1753766_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753789:1753803	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753839_1754121_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754237_1755221_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760265:1760279	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043118	Bordetella holmesii strain I265 chromosome, complete genome	3693267	1780497	1821888	3693267	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780497_1781448_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781444_1781960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782317_1782938_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783037_1783289_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783376_1784855_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784851_1788022_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788034_1789231_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789419_1790352_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790420_1791152_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791217_1791853_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791838_1793017_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793177_1793726_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793806_1794166_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794213_1795434_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795509_1796631_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796668_1797382_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797392_1798613_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798695_1799250_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799395_1800346_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800305_1800467_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800507_1801434_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801447_1802320_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802482_1803430_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803768_1804350_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804927_1805878_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805857_1806610_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806622_1807354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807510_1809676_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809765_1810035_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810123_1810330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810328_1810847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810865_1811645_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811812_1812829_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812901_1813393_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813403_1815119_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816282_1817233_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818884_1820126_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820137_1820911_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1820937_1821888_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043118	Bordetella holmesii strain I265 chromosome, complete genome	3693267	2146851	2206974	3693267	protease,transposase,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2146851_2147340_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2147332_2148181_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2148272_2148770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2148907_2149267_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2149263_2149545_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2149544_2150027_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2150028_2151657_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2151653_2151998_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2151999_2154942_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2155387_2156359_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2156348_2157731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2157873_2158824_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2158783_2160025_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2160021_2161143_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2162634_2163102_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2163172_2163823_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2163909_2165049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2165217_2166222_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2166218_2167466_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2167818_2168685_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2168644_2170249_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2170260_2170947_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2170943_2171984_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2172099_2172771_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014227.1|2172767_2173760_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2173756_2174695_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2174691_2175846_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2175854_2177306_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2177336_2177819_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2177820_2178714_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2178710_2179154_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2179166_2179541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2179683_2180082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2180208_2180496_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2180492_2180909_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2181084_2181717_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2181745_2182192_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2182478_2183630_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2183743_2184748_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2185731_2186439_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2186371_2187823_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2187828_2190987_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2190999_2191521_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2191510_2192335_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2192331_2192931_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2193039_2194896_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2195044_2196049_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2196257_2197520_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2197524_2197860_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2197856_2198786_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2198790_2199504_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2199607_2201065_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2201061_2201358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2201482_2202841_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2202941_2203742_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2203921_2205040_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2205112_2205484_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2205490_2206342_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2206362_2206974_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043118	Bordetella holmesii strain I265 chromosome, complete genome	3693267	2302097	2423608	3693267	protease,integrase,transposase,tRNA	Leptospira_phage(15.15%)	106	2333627:2333686	2354934:2355208
WP_101557807.1|2302097_2303260_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2303372_2304341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2304337_2305258_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2305354_2309833_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2310211_2314546_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2315184_2315748_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2315759_2316005_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2316160_2316670_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2316715_2317696_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2317907_2320259_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2320305_2321136_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2321132_2321822_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2321814_2323095_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2323192_2324131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2324112_2325819_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2325896_2327000_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2327052_2327802_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2327808_2329323_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2329335_2329623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2329643_2330531_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2330681_2331188_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2331184_2332141_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2332328_2333675_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2333627:2333686	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2333642_2333873_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2333902_2334466_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2334620_2335391_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2335387_2336398_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2336712_2337159_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2337214_2337409_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2337410_2337752_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2337761_2339624_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2339663_2340170_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2340173_2340497_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2340498_2340903_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2340939_2342151_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2342172_2342721_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2342945_2343437_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2343651_2345682_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_153567796.1|2345756_2346959_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032826331.1|2347501_2348437_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2349470_2349752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2349838_2350012_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2350123_2350468_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2350539_2351208_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2352623_2353667_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2353663_2353765_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2353856_2354976_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2355226_2355880_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2354934:2355208	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2355995_2357216_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2357266_2359696_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2359861_2361160_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2361264_2361918_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2361920_2363231_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2363458_2363998_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2364476_2364743_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2364781_2365147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2365028_2366039_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2366035_2366806_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2366891_2367551_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2367518_2368010_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2368119_2368323_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2368640_2368961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2368944_2369280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2369334_2369547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2369622_2369961_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2369957_2370293_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2370355_2371927_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2372720_2373032_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2373224_2374345_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2374472_2374667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2380749_2381911_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2382296_2383760_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2383892_2385443_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2385439_2385589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2385754_2386875_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2387988_2388846_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2388898_2389396_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2389516_2390932_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2390941_2392126_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2392122_2393721_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2394903_2395149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2395559_2395745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2395900_2396812_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2396933_2397776_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2397978_2399352_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2399661_2401173_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2401325_2402057_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2402163_2403465_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2403472_2404381_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2404377_2404971_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2405014_2405428_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2405424_2405895_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2405901_2406507_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2408308_2410093_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2410089_2411475_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2411460_2412423_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2412492_2413122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2413159_2414368_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2414489_2415059_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2415190_2416744_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2417047_2418268_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2418675_2419578_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2419574_2420444_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2420440_2421292_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2421288_2422113_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2422387_2423608_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043118	Bordetella holmesii strain I265 chromosome, complete genome	3693267	2933067	3010127	3693267	integrase,transposase,tRNA	Ralstonia_virus(21.43%)	56	2935922:2935981	2984509:2985079
WP_005019978.1|2933067_2933847_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2933869_2934817_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2934818_2935019_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2935353_2936473_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2935922:2935981	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2936794_2937511_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2937507_2938401_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2938564_2939785_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2939937_2941020_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2942699_2943683_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2943745_2945158_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2945275_2946118_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2946396_2947005_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2947020_2947641_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2947706_2948414_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2948418_2949141_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2949127_2949418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2949493_2950714_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2951438_2952290_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2952341_2953595_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2953771_2954560_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2954679_2955594_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2955726_2957619_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2957804_2959184_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2959628_2959925_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2963725_2964328_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2964461_2964920_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2964921_2965521_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2965529_2966339_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2966373_2967228_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2967347_2967935_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2967931_2969311_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2969815_2969962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2977633_2978974_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2978987_2979839_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2979850_2981116_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2981177_2983082_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2985057_2985912_-	hypothetical protein	NA	NA	NA	NA	NA
2984509:2985079	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2985904_2986699_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2986914_2987865_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2988467_2989265_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2989304_2989958_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_153567797.1|2989938_2991003_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2991166_2993392_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2993637_2995482_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2995598_2996471_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2996517_2998218_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|2998280_2999480_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|2999490_3000369_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3000475_3001513_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3001593_3001998_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3002009_3003467_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3004109_3004706_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3004866_3005325_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3006102_3007074_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3007195_3007615_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3008906_3010127_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
