The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043106	Bordetella holmesii strain J102 chromosome, complete genome	3694912	180350	240162	3694912	transposase	Ralstonia_virus(27.27%)	53	NA	NA
WP_005011985.1|180350_181571_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005017628.1|181686_182430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005017629.1|182599_183706_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.1	1.4e-32
WP_005017630.1|183716_184556_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_005017631.1|184613_185303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005017632.1|185399_185852_+	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|185855_187076_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005017633.1|187299_188187_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	38.5	2.1e-39
WP_005017636.1|188501_189287_-	cAMP phosphodiesterase	NA	NA	NA	NA	NA
WP_005017639.1|192129_192906_-	DUF4743 domain-containing protein	NA	NA	NA	NA	NA
WP_076879479.1|194286_194556_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_005017649.1|194527_194878_+	cytochrome c	NA	NA	NA	NA	NA
WP_005017650.1|194976_195927_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005017651.1|196028_197645_+	cytochrome c oxidase subunit I	NA	R9VX24	Flavobacterium_phage	38.2	1.5e-08
WP_005017652.1|197710_197935_+	DUF2970 domain-containing protein	NA	NA	NA	NA	NA
WP_005017653.1|197968_198844_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_005017654.1|198896_199097_-	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_005017655.1|199131_199890_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_005017656.1|199802_200489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341295.1|200493_201507_+	heme A synthase	NA	NA	NA	NA	NA
WP_005017660.1|201534_202431_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_005017663.1|202454_203063_+	SCO family protein	NA	NA	NA	NA	NA
WP_005017666.1|203075_203303_-	DUF3717 domain-containing protein	NA	NA	NA	NA	NA
WP_005017669.1|204014_204779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005017671.1|204844_206218_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	35.1	6.7e-29
WP_080601017.1|206316_207609_+	MFS transporter	NA	NA	NA	NA	NA
WP_005017677.1|207700_209023_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.8	1.3e-74
WP_005017679.1|209019_210075_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_005017681.1|210075_210597_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005017701.1|210744_212577_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	48.4	5.0e-157
WP_005017703.1|212743_212941_+	serum resistance protein BrkB	NA	NA	NA	NA	NA
WP_005017706.1|215516_215807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005017709.1|215803_217285_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_005017711.1|217412_218444_-	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005017713.1|218517_219108_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005020339.1|219660_220578_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005017725.1|220721_221756_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005017728.1|221785_222958_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	29.6	1.5e-34
WP_005017731.1|222963_223893_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005017735.1|224117_224957_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005017737.1|224953_226417_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_005017740.1|226430_227201_+	cytochrome b561 / ferric reductase transmembrane	NA	NA	NA	NA	NA
WP_005017743.1|227214_227694_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_005011985.1|228944_230165_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005017765.1|230819_232097_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_005017766.1|232151_232718_-	cysteine dioxygenase type I	NA	NA	NA	NA	NA
WP_005017769.1|232803_233967_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005017772.1|234135_234420_+	acylphosphatase	NA	NA	NA	NA	NA
WP_005017775.1|234443_235082_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005017777.1|235203_236175_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005017780.1|237753_238524_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|238735_239686_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_153566153.1|239520_240162_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	49.0	6.2e-38
>prophage 2
NZ_CP043106	Bordetella holmesii strain J102 chromosome, complete genome	3694912	1095193	1201982	3694912	transposase,tRNA,protease	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095193_1096414_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096501_1097092_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097088_1097391_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097442_1098432_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098552_1099434_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099607_1100462_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100493_1101342_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101469_1102690_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102708_1103275_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103472_1104624_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104762_1105767_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105923_1106895_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1106973_1107762_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107833_1108070_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108078_1108990_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109033_1110905_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111065_1111863_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112094_1112469_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112545_1112869_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1112952_1113225_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113239_1113695_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113816_1114653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114649_1116023_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116099_1117056_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117143_1118121_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118245_1119901_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1119949_1120414_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120410_1120872_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121097_1122285_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122281_1123586_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123582_1124992_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125185_1126305_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126440_1127460_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127468_1130174_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130313_1130967_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131029_1131392_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1131958_1133419_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133681_1134755_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134839_1136060_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137817_1138938_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138911_1140411_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140424_1141528_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141532_1142783_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142779_1144225_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144221_1144536_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144537_1145656_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145838_1147059_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147158_1148025_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148085_1149066_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149212_1150133_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150141_1151254_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151335_1152157_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152232_1152841_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1152978_1154355_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154416_1154860_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1154926_1155583_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557831.1|1155625_1156745_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_005012709.1|1156914_1157196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157906_1158695_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158691_1159798_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160472_1161831_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1161945_1162143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162160_1163281_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163374_1163929_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164516_1165833_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165845_1166859_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167405_1168356_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168435_1168735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170095_1171754_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171902_1173123_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173240_1174524_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174527_1175469_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175578_1176037_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176417_1177038_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177445_1179866_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1179973_1180711_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180757_1182002_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182324_1182597_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183180_1183909_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1183930_1184848_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184847_1185357_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185473_1186145_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186254_1187322_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187341_1189186_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189322_1190510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190810_1191596_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191619_1192739_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192843_1194181_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194290_1195232_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195287_1196469_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196627_1196918_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1196964_1197633_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197629_1197917_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198293_1199079_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199111_1199846_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200761_1201982_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 3
NZ_CP043106	Bordetella holmesii strain J102 chromosome, complete genome	3694912	1206769	1263175	3694912	transposase,tRNA,protease	Ralstonia_virus(23.08%)	44	NA	NA
WP_005012808.1|1206769_1207720_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207801_1208281_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209492_1210692_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210837_1211215_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211238_1213020_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213028_1213766_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214050_1215610_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215669_1216428_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216524_1217181_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217334_1218099_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218113_1218293_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218318_1219353_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219349_1219763_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219759_1220344_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220696_1222055_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222148_1222727_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222851_1223972_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224044_1225301_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225404_1226610_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226673_1227123_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227255_1227501_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227725_1228040_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233293_1235399_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235452_1237762_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239115_1240783_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240785_1241451_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241583_1245390_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245615_1246761_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246879_1247809_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247805_1248882_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248878_1249685_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249681_1250413_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250789_1252028_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252075_1252414_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252661_1253612_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1253930_1254113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254178_1255399_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255492_1256713_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256772_1257036_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257157_1258657_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|1259077_1259275_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259290_1259650_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259722_1260745_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260757_1263175_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP043106	Bordetella holmesii strain J102 chromosome, complete genome	3694912	1586713	1692967	3694912	transposase,integrase,tRNA	Leptospira_phage(14.29%)	100	1643988:1644004	1689654:1689670
WP_005011985.1|1586713_1587934_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588288_1588765_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589023_1589632_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589650_1590322_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590495_1592382_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592409_1593252_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593248_1594592_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594776_1595592_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595657_1597139_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597337_1599410_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599629_1600667_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601853_1602711_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602738_1603515_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604342_1604852_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1605929_1606700_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606696_1607707_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607765_1608846_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609014_1610134_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610135_1610879_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1610883_1611255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611315_1611561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611667_1613167_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613788_1614124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614382_1614514_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614543_1615041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615050_1615425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615515_1616808_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1616924_1617824_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1617975_1618194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618667_1620293_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620528_1622052_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622023_1622719_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623059_1624121_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624166_1624718_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624724_1625645_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625784_1628082_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628137_1629358_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629616_1630222_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630232_1631393_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631414_1632296_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632592_1633291_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633432_1634155_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634273_1635212_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635242_1636022_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636008_1637232_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637236_1638784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638819_1639353_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639596_1640292_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640306_1640438_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640485_1641610_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641615_1643955_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1643951_1644359_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1643988:1644004	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1644620_1644881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645103_1646054_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646152_1647103_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647152_1648361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648582_1649122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649346_1649751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649815_1650571_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650570_1651932_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1651928_1652552_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652595_1653715_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654367_1655123_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655299_1656094_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656090_1656528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656639_1656792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657212_1658181_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658337_1659345_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659402_1659861_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1659934_1661281_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661298_1661670_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661669_1663139_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663294_1664020_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664033_1666748_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1666999_1668364_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668403_1669462_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669489_1670308_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670345_1670624_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671887_1672187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672756_1674160_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674172_1674823_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1674964_1676185_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676215_1677292_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677438_1678569_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678755_1680381_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680387_1681203_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681217_1682288_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682339_1682999_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683638_1684801_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684842_1685157_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685140_1685527_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685565_1685832_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686224_1686914_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687013_1687175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687325_1687490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687616_1687853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688042_1688291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688404_1689775_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689654:1689670	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689775_1690516_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691014_1692967_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 5
NZ_CP043106	Bordetella holmesii strain J102 chromosome, complete genome	3694912	1711261	1755188	3694912	transposase,integrase,tRNA,holin	Leptospira_phage(33.33%)	37	1753756:1753770	1760232:1760246
WP_005019367.1|1711261_1714123_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714112_1715078_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715834_1717310_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717314_1717590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1717926_1719046_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1718920_1719169_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719347_1720556_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720552_1722835_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722845_1725227_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725490_1727398_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727412_1728303_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728309_1729443_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729442_1730264_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730288_1731479_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731780_1732062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732227_1732548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732587_1733674_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733870_1734131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734623_1735394_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735390_1736401_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736435_1737278_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737740_1738526_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739385_1740505_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741571_1742576_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742651_1743464_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743691_1745863_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1745916_1747236_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747324_1748545_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748763_1749624_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749620_1750844_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751142_1751640_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751678_1752461_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752486_1752705_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752779_1753049_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753268_1753733_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753756:1753770	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753806_1754088_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754204_1755188_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760232:1760246	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 6
NZ_CP043106	Bordetella holmesii strain J102 chromosome, complete genome	3694912	1780464	1821854	3694912	transposase	Ralstonia_virus(50.0%)	38	NA	NA
WP_005012067.1|1780464_1781415_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781411_1781927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782284_1782905_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783004_1783256_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783343_1784822_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784818_1787989_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788001_1789198_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789386_1790319_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790387_1791119_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791184_1791820_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791805_1792984_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793144_1793693_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793773_1794133_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794180_1795401_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795476_1796598_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796635_1797349_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797359_1798580_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798662_1799217_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013729.1|1800271_1800433_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800473_1801400_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801413_1802286_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802448_1803396_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803734_1804316_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804893_1805844_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805823_1806576_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806588_1807320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807476_1809642_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809731_1810001_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810089_1810296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810294_1810813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810831_1811611_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811778_1812795_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812867_1813359_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813369_1815085_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816248_1817199_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818850_1820092_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820103_1820877_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1820903_1821854_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP043106	Bordetella holmesii strain J102 chromosome, complete genome	3694912	2149018	2209141	3694912	transposase,tRNA,protease	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2149018_2149507_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2149499_2150348_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2150439_2150937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2151074_2151434_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2151430_2151712_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2151711_2152194_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2152195_2153824_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2153820_2154165_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2154166_2157109_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_153566156.1|2157554_2158526_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014198.1|2158515_2159898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2160040_2160991_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2160950_2162192_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2162188_2163310_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2164801_2165269_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2165339_2165990_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2166076_2167216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2167384_2168389_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2168385_2169633_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2169985_2170852_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2170811_2172416_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2172427_2173114_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2173110_2174151_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2174266_2174938_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019577.1|2174934_2175927_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2175923_2176862_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2176858_2178013_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2178021_2179473_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2179503_2179986_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2179987_2180881_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2180877_2181321_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2181333_2181708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2181850_2182249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2182375_2182663_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2182659_2183076_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2183251_2183884_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2183912_2184359_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2184645_2185797_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2185910_2186915_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2187898_2188606_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2188538_2189990_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2189995_2193154_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2193166_2193688_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_153566157.1|2193677_2194502_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2194498_2195098_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2195206_2197063_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2197211_2198216_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2198424_2199687_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2199691_2200027_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2200023_2200953_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2200957_2201671_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2201774_2203232_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2203228_2203525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2203649_2205008_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2205108_2205909_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2206088_2207207_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2207279_2207651_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2207657_2208509_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2208529_2209141_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 8
NZ_CP043106	Bordetella holmesii strain J102 chromosome, complete genome	3694912	2304270	2425761	3694912	transposase,integrase,tRNA,protease	Leptospira_phage(15.15%)	106	2335800:2335859	2357107:2357381
WP_101557807.1|2304270_2305433_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2305545_2306514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2306510_2307431_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2307527_2312006_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2312384_2316719_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2317357_2317921_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2317932_2318178_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2318333_2318843_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2318888_2319869_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2320080_2322432_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2322478_2323309_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2323305_2323995_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2323987_2325268_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2325365_2326304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2326285_2327992_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2328069_2329173_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2329225_2329975_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2329981_2331496_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2331508_2331796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2331816_2332704_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2332854_2333361_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2333357_2334314_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2334501_2335848_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2335800:2335859	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2335815_2336046_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2336075_2336639_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2336793_2337564_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2337560_2338571_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2338885_2339332_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2339387_2339582_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2339583_2339925_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2339934_2341797_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2341836_2342343_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2342346_2342670_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2342671_2343076_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2343112_2344324_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2344345_2344894_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2345118_2345610_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2345824_2347855_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2347929_2349132_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2349674_2350610_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2351643_2351925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2352011_2352185_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2352296_2352641_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2352712_2353381_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2354796_2355840_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2355836_2355938_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2356029_2357149_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2357399_2358053_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2357107:2357381	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2358168_2359389_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2359439_2361869_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2362034_2363333_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2363437_2364091_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2364093_2365404_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2365631_2366171_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2366649_2366916_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2366954_2367320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2367201_2368212_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2368208_2368979_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2369064_2369724_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2369691_2370183_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2370292_2370496_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2370813_2371134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2371117_2371453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2371507_2371720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2371795_2372134_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_161635843.1|2372109_2372466_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2372528_2374100_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2374893_2375205_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2375397_2376518_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2376645_2376840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2382902_2384064_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2384449_2385913_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2386045_2387596_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2387592_2387742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2387907_2389028_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2390141_2390999_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2391051_2391549_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2391669_2393085_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2393094_2394279_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2394275_2395874_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2397056_2397302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2397712_2397898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2398053_2398965_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2399086_2399929_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2400131_2401505_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2401814_2403326_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2403478_2404210_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2404316_2405618_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2405625_2406534_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2406530_2407124_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2407167_2407581_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2407577_2408048_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2408054_2408660_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2410461_2412246_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2412242_2413628_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2413613_2414576_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2414645_2415275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2415312_2416521_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2416642_2417212_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2417343_2418897_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2419200_2420421_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2420828_2421731_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2421727_2422597_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_153566158.1|2422593_2423445_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005014769.1|2423441_2424266_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2424540_2425761_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 9
NZ_CP043106	Bordetella holmesii strain J102 chromosome, complete genome	3694912	2934729	3011789	3694912	transposase,integrase,tRNA	Ralstonia_virus(21.43%)	56	2937584:2937643	2986171:2986741
WP_005019978.1|2934729_2935509_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2935531_2936479_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2936480_2936681_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2937015_2938135_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2937584:2937643	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2938456_2939173_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2939169_2940063_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2940226_2941447_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2941599_2942682_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2944361_2945345_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2945407_2946820_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2946937_2947780_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2948058_2948667_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2948682_2949303_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2949368_2950076_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2950080_2950803_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2950789_2951080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2951155_2952376_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2953100_2953952_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2954003_2955257_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2955433_2956222_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2956341_2957256_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2957388_2959281_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2959466_2960846_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2961290_2961587_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2965387_2965990_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2966123_2966582_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2966583_2967183_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2967191_2968001_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2968035_2968890_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2969009_2969597_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2969593_2970973_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2971477_2971624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2979295_2980636_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2980649_2981501_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2981512_2982778_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2982839_2984744_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2986719_2987574_-	hypothetical protein	NA	NA	NA	NA	NA
2986171:2986741	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2987566_2988361_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2988576_2989527_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2990129_2990927_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2990966_2991620_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2991600_2992665_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2992828_2995054_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2995299_2997144_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2997260_2998133_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2998179_2999880_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|2999942_3001142_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3001152_3002031_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3002137_3003175_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3003255_3003660_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3003671_3005129_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3005771_3006368_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3006528_3006987_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3007764_3008736_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3008857_3009277_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3010568_3011789_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
