The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043101	Bordetella holmesii strain J168 chromosome, complete genome	3696490	1095208	1201997	3696490	protease,transposase,tRNA	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095208_1096429_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096516_1097107_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097103_1097406_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097457_1098447_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098567_1099449_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099622_1100477_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100508_1101357_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101484_1102705_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102723_1103290_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103487_1104639_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104777_1105782_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105938_1106910_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1106988_1107777_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107848_1108085_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108093_1109005_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109048_1110920_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111080_1111878_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112109_1112484_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112560_1112884_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1112967_1113240_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113254_1113710_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113831_1114668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114664_1116038_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116114_1117071_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117158_1118136_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118260_1119916_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1119964_1120429_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120425_1120887_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121112_1122300_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122296_1123601_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123597_1125007_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125200_1126320_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126455_1127475_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127483_1130189_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130328_1130982_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131044_1131407_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1131973_1133434_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133696_1134770_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134854_1136075_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137832_1138953_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138926_1140426_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140439_1141543_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141547_1142798_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142794_1144240_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144236_1144551_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144552_1145671_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145853_1147074_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147173_1148040_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148100_1149081_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149227_1150148_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150156_1151269_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151350_1152172_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152247_1152856_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1152993_1154370_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154431_1154875_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1154941_1155598_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155640_1156760_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156929_1157211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157921_1158710_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158706_1159813_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160487_1161846_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1161960_1162158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162175_1163296_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163389_1163944_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164531_1165848_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165860_1166874_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167420_1168371_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168450_1168750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170110_1171769_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171917_1173138_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173255_1174539_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174542_1175484_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175593_1176052_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176432_1177053_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177460_1179881_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1179988_1180726_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180772_1182017_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182339_1182612_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183195_1183924_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1183945_1184863_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184862_1185372_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185488_1186160_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186269_1187337_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187356_1189201_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189337_1190525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190825_1191611_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191634_1192754_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192858_1194196_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194305_1195247_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195302_1196484_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196642_1196933_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1196979_1197648_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197644_1197932_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198308_1199094_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199126_1199861_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200776_1201997_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043101	Bordetella holmesii strain J168 chromosome, complete genome	3696490	1206784	1263190	3696490	protease,transposase,tRNA	Ralstonia_virus(23.08%)	45	NA	NA
WP_005012808.1|1206784_1207735_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207816_1208296_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209507_1210707_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210852_1211230_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211253_1213035_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213043_1213781_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214065_1215625_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215684_1216443_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216539_1217196_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217349_1218114_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218128_1218308_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218333_1219368_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219364_1219778_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219774_1220359_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220711_1222070_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222163_1222742_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222866_1223987_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224059_1225316_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225419_1226625_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226688_1227138_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227270_1227516_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227740_1228055_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233308_1235414_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235467_1237777_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239130_1240798_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240800_1241466_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241598_1245405_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245630_1246776_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246894_1247824_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247820_1248897_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248893_1249700_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249696_1250428_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250804_1252043_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252090_1252429_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252676_1253627_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1253945_1254128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254193_1255414_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255507_1256728_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256787_1257051_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257172_1258672_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1258719_1258995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1259092_1259290_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259305_1259665_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259737_1260760_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260772_1263190_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043101	Bordetella holmesii strain J168 chromosome, complete genome	3696490	1586728	1692991	3696490	transposase,tRNA,integrase	Leptospira_phage(14.29%)	100	1644003:1644019	1689669:1689685
WP_005011985.1|1586728_1587949_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588303_1588780_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589038_1589647_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589665_1590337_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590510_1592397_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592424_1593267_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593263_1594607_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594791_1595607_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595672_1597154_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597352_1599425_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599644_1600682_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601868_1602726_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602753_1603530_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604357_1604867_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1605944_1606715_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606711_1607722_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607780_1608861_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609029_1610149_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610150_1610894_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1610898_1611270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611330_1611576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611682_1613182_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613803_1614139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614397_1614529_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614558_1615056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615065_1615440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615530_1616823_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1616939_1617839_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1617990_1618209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618682_1620308_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620543_1622067_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622038_1622734_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623074_1624136_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624181_1624733_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624739_1625660_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625799_1628097_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628152_1629373_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629631_1630237_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630247_1631408_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631429_1632311_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632607_1633306_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633447_1634170_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634288_1635227_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635257_1636037_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636023_1637247_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637251_1638799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638834_1639368_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639611_1640307_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640321_1640453_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640500_1641625_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641630_1643970_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1643966_1644374_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1644003:1644019	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1644635_1644896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645118_1646069_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646167_1647118_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647167_1648376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648597_1649137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649361_1649766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649830_1650586_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650585_1651947_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1651943_1652567_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652610_1653730_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654382_1655138_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655314_1656109_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656105_1656543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656654_1656807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657227_1658196_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658352_1659360_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659417_1659876_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1659949_1661296_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661313_1661685_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661684_1663154_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663309_1664035_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664048_1666763_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667014_1668379_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668418_1669477_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669504_1670323_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670360_1670639_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671902_1672202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672771_1674175_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674187_1674838_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1674979_1676200_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676230_1677307_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677453_1678584_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678770_1680396_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680402_1681218_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681232_1682303_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682354_1683014_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683653_1684816_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684857_1685172_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685155_1685542_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685580_1685847_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686239_1686929_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687028_1687190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687340_1687505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687631_1687868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688057_1688306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688419_1689790_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689669:1689685	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689790_1690531_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691038_1692991_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043101	Bordetella holmesii strain J168 chromosome, complete genome	3696490	1711285	1755212	3696490	transposase,tRNA,integrase,holin	Leptospira_phage(33.33%)	37	1753780:1753794	1760256:1760270
WP_005019367.1|1711285_1714147_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714136_1715102_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715858_1717334_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717338_1717614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1717950_1719070_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1718944_1719193_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719371_1720580_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720576_1722859_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722869_1725251_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725514_1727422_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727436_1728327_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728333_1729467_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729466_1730288_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730312_1731503_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731804_1732086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732251_1732572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732611_1733698_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733894_1734155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734647_1735418_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735414_1736425_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736459_1737302_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737764_1738550_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739409_1740529_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741595_1742600_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742675_1743488_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743715_1745887_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1745940_1747260_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747348_1748569_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748787_1749648_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749644_1750868_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751166_1751664_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751702_1752485_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752510_1752729_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752803_1753073_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753292_1753757_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753780:1753794	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753830_1754112_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754228_1755212_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760256:1760270	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043101	Bordetella holmesii strain J168 chromosome, complete genome	3696490	1780488	1821879	3696490	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1780488_1781439_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781435_1781951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782308_1782929_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783028_1783280_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783367_1784846_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784842_1788013_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788025_1789222_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789410_1790343_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790411_1791143_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791208_1791844_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791829_1793008_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793168_1793717_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793797_1794157_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794204_1795425_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795500_1796622_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796659_1797373_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797383_1798604_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798686_1799241_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799386_1800337_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800296_1800458_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800498_1801425_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801438_1802311_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802473_1803421_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803759_1804341_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804918_1805869_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805848_1806601_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806613_1807345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807501_1809667_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809756_1810026_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810114_1810321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810319_1810838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810856_1811636_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811803_1812820_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812892_1813384_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813394_1815110_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1816273_1817224_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1818875_1820117_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820128_1820902_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1820928_1821879_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043101	Bordetella holmesii strain J168 chromosome, complete genome	3696490	2150092	2210215	3696490	protease,transposase,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150092_2150581_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150573_2151422_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151513_2152011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152148_2152508_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152504_2152786_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152785_2153268_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153269_2154898_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154894_2155239_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155240_2158183_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158628_2159600_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159589_2160972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161114_2162065_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162024_2163266_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163262_2164384_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165875_2166343_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166413_2167064_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167150_2168290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168458_2169463_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169459_2170707_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171059_2171926_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171885_2173490_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173501_2174188_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174184_2175225_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175340_2176012_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019577.1|2176008_2177001_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2176997_2177936_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2177932_2179087_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179095_2180547_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180577_2181060_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181061_2181955_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2181951_2182395_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182407_2182782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2182924_2183323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183449_2183737_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183733_2184150_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184325_2184958_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2184986_2185433_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185719_2186871_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2186984_2187989_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2188972_2189680_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189612_2191064_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191069_2194228_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194240_2194762_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194751_2195576_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195572_2196172_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196280_2198137_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198285_2199290_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199498_2200761_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200765_2201101_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201097_2202027_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202031_2202745_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202848_2204306_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204302_2204599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153567346.1|2204723_2206082_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.2	3.0e-42
WP_005014285.1|2206182_2206983_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207162_2208281_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208353_2208725_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208731_2209583_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209603_2210215_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043101	Bordetella holmesii strain J168 chromosome, complete genome	3696490	2305344	2426850	3696490	protease,transposase,tRNA,integrase	Leptospira_phage(15.62%)	105	2336874:2336933	2358181:2358455
WP_101557807.1|2305344_2306507_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306619_2307588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307584_2308505_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308601_2313080_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313458_2317793_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318431_2318995_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319006_2319252_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319407_2319917_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2319962_2320943_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321154_2323506_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323552_2324383_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324379_2325069_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325061_2326342_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326439_2327378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327359_2329066_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329143_2330247_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330299_2331049_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331055_2332570_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332582_2332870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332890_2333778_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2333928_2334435_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334431_2335388_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335575_2336922_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336874:2336933	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336889_2337120_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337149_2337713_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337867_2338638_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338634_2339645_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2339959_2340406_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340461_2340656_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340657_2340999_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341008_2342871_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2342910_2343417_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343420_2343744_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343745_2344150_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344186_2345398_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345419_2345968_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346192_2346684_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346898_2348929_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349003_2350206_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350748_2351684_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352717_2352999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353085_2353259_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353370_2353715_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353786_2354455_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355870_2356914_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356910_2357012_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357103_2358223_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358473_2359127_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358181:2358455	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359242_2360463_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360513_2362943_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363108_2364407_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364511_2365165_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365167_2366478_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366705_2367245_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367723_2367990_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368028_2368394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032965889.1|2368275_2369286_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_032968029.1|2369282_2370053_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_050427733.1|2370138_2370798_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370765_2371257_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371366_2371570_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371887_2372208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372191_2372527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372581_2372794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372869_2373208_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373204_2373540_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373602_2375174_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2375967_2376279_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376471_2377592_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377719_2377914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005019713.1|2385538_2387002_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387134_2388685_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388681_2388831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2388996_2390117_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391230_2392088_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392140_2392638_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392758_2394174_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394183_2395368_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395364_2396963_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398145_2398391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398801_2398987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399142_2400054_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400175_2401018_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401220_2402594_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2402903_2404415_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404567_2405299_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405405_2406707_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406714_2407623_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407619_2408213_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408256_2408670_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408666_2409137_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409143_2409749_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411550_2413335_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413331_2414717_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414702_2415665_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415734_2416364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416401_2417610_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417731_2418301_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418432_2419986_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420289_2421510_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2421917_2422820_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422816_2423686_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423682_2424534_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424530_2425355_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425629_2426850_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043101	Bordetella holmesii strain J168 chromosome, complete genome	3696490	2936305	3013365	3696490	transposase,tRNA,integrase	Ralstonia_virus(21.43%)	56	2939160:2939219	2987747:2988317
WP_005019978.1|2936305_2937085_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937107_2938055_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938056_2938257_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938591_2939711_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939160:2939219	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940032_2940749_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940745_2941639_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941802_2943023_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943175_2944258_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2945937_2946921_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2946983_2948396_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948513_2949356_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949634_2950243_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950258_2950879_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2950944_2951652_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951656_2952379_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952365_2952656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952731_2953952_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954676_2955528_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955579_2956833_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957009_2957798_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2957917_2958832_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2958964_2960857_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961042_2962422_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962866_2963163_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2966963_2967566_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967699_2968158_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968159_2968759_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968767_2969577_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969611_2970466_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970585_2971173_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971169_2972549_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973053_2973200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980871_2982212_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982225_2983077_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983088_2984354_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984415_2986320_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988295_2989150_-	hypothetical protein	NA	NA	NA	NA	NA
2987747:2988317	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989142_2989937_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990152_2991103_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991705_2992503_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992542_2993196_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993176_2994241_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994404_2996630_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996875_2998720_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998836_2999709_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999755_3001456_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001518_3002718_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002728_3003607_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003713_3004751_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004831_3005236_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005247_3006705_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007347_3007944_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008104_3008563_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009340_3010312_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010433_3010853_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012144_3013365_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
