The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043080	Bordetella holmesii strain J312 chromosome, complete genome	3695202	1095226	1202015	3695202	tRNA,transposase,protease	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095226_1096447_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096534_1097125_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097121_1097424_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097475_1098465_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098585_1099467_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099640_1100495_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100526_1101375_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101502_1102723_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102741_1103308_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103505_1104657_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104795_1105800_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105956_1106928_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107006_1107795_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107866_1108103_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108111_1109023_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109066_1110938_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111098_1111896_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112127_1112502_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112578_1112902_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1112985_1113258_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113272_1113728_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113849_1114686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114682_1116056_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116132_1117089_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117176_1118154_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118278_1119934_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1119982_1120447_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120443_1120905_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121130_1122318_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122314_1123619_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123615_1125025_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125218_1126338_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126473_1127493_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127501_1130207_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130346_1131000_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131062_1131425_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1131991_1133452_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133714_1134788_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134872_1136093_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137850_1138971_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138944_1140444_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140457_1141561_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141565_1142816_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142812_1144258_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144254_1144569_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144570_1145689_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145871_1147092_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147191_1148058_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148118_1149099_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149245_1150166_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150174_1151287_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151368_1152190_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152265_1152874_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153011_1154388_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154449_1154893_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1154959_1155616_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155658_1156778_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156947_1157229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157939_1158728_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158724_1159831_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160505_1161864_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1161978_1162176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162193_1163314_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163407_1163962_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164549_1165866_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165878_1166892_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167438_1168389_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168468_1168768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170128_1171787_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171935_1173156_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173273_1174557_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174560_1175502_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175611_1176070_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176450_1177071_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177478_1179899_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180006_1180744_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180790_1182035_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182357_1182630_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183213_1183942_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1183963_1184881_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184880_1185390_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185506_1186178_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186287_1187355_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187374_1189219_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189355_1190543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190843_1191629_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191652_1192772_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192876_1194214_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194323_1195265_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195320_1196502_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196660_1196951_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1196997_1197666_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197662_1197950_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198326_1199112_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199144_1199879_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153566146.1|1200794_1202015_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.8e-182
>prophage 2
NZ_CP043080	Bordetella holmesii strain J312 chromosome, complete genome	3695202	1206802	1261894	3695202	tRNA,transposase,protease	Ralstonia_virus(16.67%)	44	NA	NA
WP_005012808.1|1206802_1207753_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207834_1208314_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209525_1210725_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210870_1211248_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211271_1213053_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213061_1213799_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214083_1215643_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215702_1216461_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216557_1217214_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217367_1218132_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218146_1218326_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218351_1219386_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219382_1219796_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219792_1220377_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220729_1222088_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222181_1222760_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222884_1224005_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224077_1225334_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225437_1226643_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226706_1227156_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227288_1227534_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227758_1228073_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233326_1235432_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235485_1237795_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239148_1240816_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240818_1241484_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241616_1245423_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245648_1246794_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246912_1247842_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247838_1248915_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248911_1249718_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249714_1250446_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250822_1252061_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252108_1252447_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252694_1253645_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1253963_1254146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012861.1|1254211_1255432_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1255491_1255755_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1255876_1257376_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_131285595.1|1257423_1257699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012868.1|1257796_1257994_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1258009_1258369_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1258441_1259464_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1259476_1261894_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043080	Bordetella holmesii strain J312 chromosome, complete genome	3695202	1585432	1691694	3695202	tRNA,transposase,integrase	Leptospira_phage(14.29%)	100	1642707:1642723	1688373:1688389
WP_005011985.1|1585432_1586653_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1587007_1587484_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1587742_1588351_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1588369_1589041_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1589214_1591101_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1591128_1591971_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1591967_1593311_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1593495_1594311_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1594376_1595858_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1596056_1598129_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1598348_1599386_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1600572_1601430_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1601457_1602234_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1603061_1603571_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1604648_1605419_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1605415_1606426_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1606484_1607565_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1607733_1608853_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1608854_1609598_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1609602_1609974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1610034_1610280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1610386_1611886_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1612507_1612843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1613101_1613233_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1613262_1613760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1613769_1614144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1614234_1615527_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1615643_1616543_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1616694_1616913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1617386_1619012_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1619247_1620771_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1620742_1621438_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1621778_1622840_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1622885_1623437_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1623443_1624364_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1624503_1626801_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1626856_1628077_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1628335_1628941_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1628951_1630112_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1630133_1631015_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1631311_1632010_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1632151_1632874_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1632992_1633931_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1633961_1634741_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1634727_1635951_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1635955_1637503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1637538_1638072_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1638315_1639011_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1639025_1639157_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1639204_1640329_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1640334_1642674_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1642670_1643078_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1642707:1642723	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1643339_1643600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1643822_1644773_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1644871_1645822_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1645871_1647080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1647301_1647841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1648065_1648470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1648534_1649290_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1649289_1650651_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1650647_1651271_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1651314_1652434_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1653086_1653842_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1654018_1654813_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1654809_1655247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1655358_1655511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1655931_1656900_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1657056_1658064_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1658121_1658580_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1658653_1660000_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1660017_1660389_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1660388_1661858_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1662013_1662739_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1662752_1665467_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1665718_1667083_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1667122_1668181_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1668208_1669027_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1669064_1669343_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1670606_1670906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1671475_1672879_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1672891_1673542_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1673683_1674904_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1674934_1676011_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1676157_1677288_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1677474_1679100_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1679106_1679922_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1679936_1681007_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1681058_1681718_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1682357_1683520_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1683561_1683876_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1683859_1684246_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1684284_1684551_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1684943_1685633_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1685732_1685894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1686044_1686209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1686335_1686572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1686761_1687010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1687123_1688494_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1688373:1688389	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1688494_1689235_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1689741_1691694_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043080	Bordetella holmesii strain J312 chromosome, complete genome	3695202	1709988	1753915	3695202	tRNA,holin,transposase,integrase	Leptospira_phage(33.33%)	37	1752483:1752497	1758959:1758973
WP_005019367.1|1709988_1712850_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1712839_1713805_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1714561_1716037_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1716041_1716317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1716653_1717773_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1717647_1717896_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1718074_1719283_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1719279_1721562_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1721572_1723954_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1724217_1726125_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1726139_1727030_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1727036_1728170_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1728169_1728991_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1729015_1730206_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1730507_1730789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1730954_1731275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1731314_1732401_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1732597_1732858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1733350_1734121_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1734117_1735128_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1735162_1736005_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1736467_1737253_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1738112_1739232_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1740298_1741303_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1741378_1742191_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1742418_1744590_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1744643_1745963_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1746051_1747272_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1747490_1748351_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1748347_1749571_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1749869_1750367_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1750405_1751188_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1751213_1751432_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1751506_1751776_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1751995_1752460_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1752483:1752497	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1752533_1752815_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1752931_1753915_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1758959:1758973	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043080	Bordetella holmesii strain J312 chromosome, complete genome	3695202	1779191	1820583	3695202	transposase	Ralstonia_virus(50.0%)	39	NA	NA
WP_005012067.1|1779191_1780142_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1780138_1780654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1781011_1781632_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1781731_1781983_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1782070_1783549_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1783545_1786716_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1786728_1787925_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1788113_1789046_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1789114_1789846_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1789911_1790547_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1790532_1791711_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1791871_1792420_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1792500_1792860_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1792908_1794129_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1794204_1795326_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1795363_1796077_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1796087_1797308_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1797390_1797945_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1798090_1799041_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1799000_1799162_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1799202_1800129_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1800142_1801015_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1801177_1802125_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1802463_1803045_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1803622_1804573_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1804552_1805305_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1805317_1806049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1806205_1808371_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1808460_1808730_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1808818_1809025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1809023_1809542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1809560_1810340_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1810507_1811524_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1811596_1812088_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1812098_1813814_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_005012808.1|1814977_1815928_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814009.1|1817579_1818821_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1818832_1819606_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1819632_1820583_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043080	Bordetella holmesii strain J312 chromosome, complete genome	3695202	2148795	2208918	3695202	tRNA,transposase,protease	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2148795_2149284_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2149276_2150125_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2150216_2150714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2150851_2151211_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2151207_2151489_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2151488_2151971_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2151972_2153601_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2153597_2153942_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2153943_2156886_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2157331_2158303_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2158292_2159675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2159817_2160768_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2160727_2161969_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2161965_2163087_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2164578_2165046_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2165116_2165767_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2165853_2166993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2167161_2168166_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2168162_2169410_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2169762_2170629_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2170588_2172193_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2172204_2172891_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2172887_2173928_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2174043_2174715_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019577.1|2174711_2175704_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2175700_2176639_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2176635_2177790_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2177798_2179250_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2179280_2179763_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2179764_2180658_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2180654_2181098_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2181110_2181485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2181627_2182026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2182152_2182440_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2182436_2182853_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2183028_2183661_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2183689_2184136_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2184422_2185574_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2185687_2186692_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2187675_2188383_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2188315_2189767_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2189772_2192931_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2192943_2193465_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2193454_2194279_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2194275_2194875_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2194983_2196840_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2196988_2197993_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2198201_2199464_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2199468_2199804_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2199800_2200730_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2200734_2201448_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2201551_2203009_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2203005_2203302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014283.1|2203426_2204785_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.4e-42
WP_005014285.1|2204885_2205686_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2205865_2206984_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2207056_2207428_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2207434_2208286_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2208306_2208918_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043080	Bordetella holmesii strain J312 chromosome, complete genome	3695202	2304052	2425563	3695202	tRNA,transposase,protease,integrase	Leptospira_phage(15.15%)	106	2335582:2335641	2356889:2357163
WP_101557807.1|2304052_2305215_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2305327_2306296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2306292_2307213_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2307309_2311788_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2312166_2316501_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2317139_2317703_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2317714_2317960_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2318115_2318625_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2318670_2319651_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2319862_2322214_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2322260_2323091_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2323087_2323777_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2323769_2325050_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2325147_2326086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2326067_2327774_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2327851_2328955_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2329007_2329757_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2329763_2331278_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2331290_2331578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2331598_2332486_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2332636_2333143_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2333139_2334096_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2334283_2335630_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2335582:2335641	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2335597_2335828_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2335857_2336421_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_005013542.1|2336575_2337346_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|2337342_2338353_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2338667_2339114_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2339169_2339364_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2339365_2339707_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2339716_2341579_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2341618_2342125_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2342128_2342452_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2342453_2342858_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2342894_2344106_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2344127_2344676_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2344900_2345392_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2345606_2347637_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2347711_2348914_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2349456_2350392_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2351425_2351707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2351793_2351967_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2352078_2352423_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2352494_2353163_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2354578_2355622_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2355618_2355720_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2355811_2356931_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2357181_2357835_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2356889:2357163	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2357950_2359171_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2359221_2361651_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2361816_2363115_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2363219_2363873_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2363875_2365186_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2365413_2365953_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2366431_2366698_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2366736_2367102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2366983_2367994_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2367990_2368761_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2368846_2369506_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2369473_2369965_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2370074_2370278_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2370595_2370916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2370899_2371235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2371289_2371502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2371577_2371916_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2371912_2372248_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2372310_2373882_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2374675_2374987_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2375179_2376300_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2376427_2376622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2382704_2383866_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2384251_2385715_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2385847_2387398_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2387394_2387544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2387709_2388830_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2389943_2390801_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2390853_2391351_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2391471_2392887_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2392896_2394081_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2394077_2395676_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2396858_2397104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2397514_2397700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2397855_2398767_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2398888_2399731_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2399933_2401307_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2401616_2403128_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2403280_2404012_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2404118_2405420_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2405427_2406336_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2406332_2406926_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2406969_2407383_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2407379_2407850_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2407856_2408462_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2410263_2412048_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2412044_2413430_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2413415_2414378_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2414447_2415077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2415114_2416323_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2416444_2417014_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2417145_2418699_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2419002_2420223_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2420630_2421533_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2421529_2422399_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2422395_2423247_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2423243_2424068_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2424342_2425563_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043080	Bordetella holmesii strain J312 chromosome, complete genome	3695202	2935018	3012078	3695202	tRNA,transposase,integrase	Ralstonia_virus(21.43%)	56	2937873:2937932	2986460:2987030
WP_005019978.1|2935018_2935798_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2935820_2936768_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2936769_2936970_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2937304_2938424_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2937873:2937932	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2938745_2939462_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2939458_2940352_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2940515_2941736_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2941888_2942971_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2944650_2945634_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2945696_2947109_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2947226_2948069_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2948347_2948956_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2948971_2949592_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2949657_2950365_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2950369_2951092_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2951078_2951369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2951444_2952665_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2953389_2954241_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2954292_2955546_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2955722_2956511_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2956630_2957545_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2957677_2959570_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2959755_2961135_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2961579_2961876_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2965676_2966279_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2966412_2966871_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2966872_2967472_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2967480_2968290_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2968324_2969179_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2969298_2969886_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2969882_2971262_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2971766_2971913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2979584_2980925_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2980938_2981790_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2981801_2983067_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2983128_2985033_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2987008_2987863_-	hypothetical protein	NA	NA	NA	NA	NA
2986460:2987030	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2987855_2988650_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2988865_2989816_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2990418_2991216_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2991255_2991909_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2991889_2992954_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2993117_2995343_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2995588_2997433_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2997549_2998422_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2998468_3000169_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3000231_3001431_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3001441_3002320_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3002426_3003464_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3003544_3003949_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3003960_3005418_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3006060_3006657_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3006817_3007276_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3008053_3009025_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3009146_3009566_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3010857_3012078_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
