The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043066	Bordetella holmesii strain J712 chromosome, complete genome	3696492	1095220	1202009	3696492	transposase,protease,tRNA	Ralstonia_virus(16.67%)	96	NA	NA
WP_005011985.1|1095220_1096441_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_017685926.1|1096528_1097119_+	DMT family transporter	NA	NA	NA	NA	NA
WP_161635719.1|1097115_1097418_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012606.1|1097469_1098459_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_005012607.1|1098579_1099461_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005019028.1|1099634_1100489_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005012610.1|1100520_1101369_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_005012613.1|1101496_1102717_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.1e-181
WP_005012619.1|1102735_1103302_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_005012620.1|1103499_1104651_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_005012623.1|1104789_1105794_-	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.9	3.9e-18
WP_005012624.1|1105950_1106922_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012626.1|1107000_1107789_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012627.1|1107860_1108097_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_005012631.1|1108105_1109017_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005012634.1|1109060_1110932_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_005012636.1|1111092_1111890_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_005012637.1|1112121_1112496_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005012639.1|1112572_1112896_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005012641.1|1112979_1113252_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005012642.1|1113266_1113722_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005012643.1|1113843_1114680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012644.1|1114676_1116050_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	57.7	1.1e-132
WP_005019033.1|1116126_1117083_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_005012655.1|1117170_1118148_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_005012656.1|1118272_1119928_-	PhoH family protein	NA	A0A1L2CUJ9	Pectobacterium_phage	33.7	1.2e-69
WP_005012657.1|1119976_1120441_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012658.1|1120437_1120899_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_005012659.1|1121124_1122312_+	alanine transaminase	NA	NA	NA	NA	NA
WP_005019036.1|1122308_1123613_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_005012661.1|1123609_1125019_+	threonine synthase	NA	NA	NA	NA	NA
WP_101557744.1|1125212_1126332_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	5.8e-55
WP_005012662.1|1126467_1127487_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	34.8	3.0e-50
WP_005012663.1|1127495_1130201_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	25.1	6.8e-17
WP_005012664.1|1130340_1130994_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_005019040.1|1131056_1131419_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_005012668.1|1131985_1133446_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_005012669.1|1133708_1134782_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	46.4	7.9e-78
WP_005012670.1|1134866_1136087_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	3.5e-183
WP_101557770.1|1137844_1138965_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005019053.1|1138938_1140438_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_005012673.1|1140451_1141555_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_005012675.1|1141559_1142810_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_005019055.1|1142806_1144252_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_005012678.1|1144248_1144563_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005019066.1|1144564_1145683_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_005012682.1|1145865_1147086_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	5.5e-184
WP_005012685.1|1147185_1148052_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_005012688.1|1148112_1149093_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005012689.1|1149239_1150160_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.8	2.1e-26
WP_005012692.1|1150168_1151281_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_005012695.1|1151362_1152184_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005019071.1|1152259_1152868_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005012700.1|1153005_1154382_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.1	7.2e-108
WP_005012704.1|1154443_1154887_+	cytochrome c	NA	NA	NA	NA	NA
WP_080688213.1|1154953_1155610_-	cytochrome B	NA	NA	NA	NA	NA
WP_101557770.1|1155652_1156772_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012709.1|1156941_1157223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012711.1|1157933_1158722_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_005012713.1|1158718_1159825_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005012715.1|1160499_1161858_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.3	2.1e-19
WP_005012717.1|1161972_1162170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1162187_1163308_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_076879487.1|1163401_1163956_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	43.7	1.3e-31
WP_005012730.1|1164543_1165860_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_005019086.1|1165872_1166886_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|1167432_1168383_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012745.1|1168462_1168762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012747.1|1170122_1171781_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_005012749.1|1171929_1173150_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005012751.1|1173267_1174551_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	68.4	4.6e-157
WP_005012753.1|1174554_1175496_-	AEC family transporter	NA	NA	NA	NA	NA
WP_005012755.1|1175605_1176064_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_026087875.1|1176444_1177065_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_005012761.1|1177472_1179893_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.1	3.9e-64
WP_005012762.1|1180000_1180738_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005019089.1|1180784_1182029_+	cystathionine gamma-synthase family protein	NA	A0A0B5JD48	Pandoravirus	27.1	1.3e-10
WP_005012769.1|1182351_1182624_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	56.2	4.2e-20
WP_005012771.1|1183207_1183936_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_005012772.1|1183957_1184875_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012775.1|1184874_1185384_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012777.1|1185500_1186172_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005012779.1|1186281_1187349_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	2.8e-14
WP_005012781.1|1187368_1189213_+	potassium transporter Kup	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	30.0	5.9e-65
WP_005012784.1|1189349_1190537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012786.1|1190837_1191623_+	acyltransferase	NA	NA	NA	NA	NA
WP_101557770.1|1191646_1192766_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005012789.1|1192870_1194208_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	83.3	4.3e-57
WP_005012790.1|1194317_1195259_-	ornithine carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	26.0	5.8e-16
WP_005012795.1|1195314_1196496_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.4	2.1e-23
WP_005012796.1|1196654_1196945_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_005012797.1|1196991_1197660_-	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	26.8	8.9e-11
WP_005012798.1|1197656_1197944_-	D-isomer specific 2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_005019092.1|1198320_1199106_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_005012801.1|1199138_1199873_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|1200788_1202009_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 2
NZ_CP043066	Bordetella holmesii strain J712 chromosome, complete genome	3696492	1206796	1263202	3696492	transposase,protease,tRNA	Ralstonia_virus(23.08%)	44	NA	NA
WP_005012808.1|1206796_1207747_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012810.1|1207828_1208308_-	sensor protein	NA	NA	NA	NA	NA
WP_005012811.1|1209519_1210719_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	74.9	1.2e-178
WP_005012812.1|1210864_1211242_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_005012813.1|1211265_1213047_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_005012814.1|1213055_1213793_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_005012815.1|1214077_1215637_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005012817.1|1215696_1216455_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_005019095.1|1216551_1217208_-	adenylate kinase	NA	NA	NA	NA	NA
WP_005012820.1|1217361_1218126_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005012822.1|1218140_1218320_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_005012823.1|1218345_1219380_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_005012826.1|1219376_1219790_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_005012827.1|1219786_1220371_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_005012828.1|1220723_1222082_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	33.6	1.0e-29
WP_005012829.1|1222175_1222754_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_101557770.1|1222878_1223999_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_080601032.1|1224071_1225328_+	chloride channel protein	NA	NA	NA	NA	NA
WP_005019101.1|1225431_1226637_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_005012833.1|1226700_1227150_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	6.8e-15
WP_005012834.1|1227282_1227528_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	75.0	6.5e-20
WP_005012835.1|1227752_1228067_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.9	8.4e-12
WP_005012838.1|1233320_1235426_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_005012839.1|1235479_1237789_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	9.1e-164
WP_005012840.1|1239142_1240810_+	MCE family protein	NA	NA	NA	NA	NA
WP_005012841.1|1240812_1241478_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_005012843.1|1241610_1245417_+	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005012844.1|1245642_1246788_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012847.1|1246906_1247836_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005012848.1|1247832_1248909_+	inner-membrane translocator	NA	NA	NA	NA	NA
WP_005012850.1|1248905_1249712_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.2e-15
WP_005012851.1|1249708_1250440_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	2.6e-16
WP_005012853.1|1250816_1252055_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	28.3	6.2e-26
WP_005012854.1|1252102_1252441_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_005012067.1|1252688_1253639_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012855.1|1253957_1254140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005011985.1|1254205_1255426_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005012861.1|1255519_1256740_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.6	4.2e-184
WP_005012863.1|1256799_1257063_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005012866.1|1257184_1258684_+	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_005012868.1|1259104_1259302_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_005012869.1|1259317_1259677_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005012870.1|1259749_1260772_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.8	6.1e-27
WP_005012871.1|1260784_1263202_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP043066	Bordetella holmesii strain J712 chromosome, complete genome	3696492	1586740	1693003	3696492	integrase,transposase,tRNA	Leptospira_phage(14.29%)	100	1644015:1644031	1689681:1689697
WP_005011985.1|1586740_1587961_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013527.1|1588315_1588792_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005013528.1|1589050_1589659_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_005013529.1|1589677_1590349_+	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_005019299.1|1590522_1592409_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.5	6.2e-110
WP_005013531.1|1592436_1593279_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	6.5e-27
WP_005013532.1|1593275_1594619_+	phosphoglucosamine mutase	NA	A0A1X9I671	Streptococcus_phage	27.1	2.7e-06
WP_005013533.1|1594803_1595619_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005013534.1|1595684_1597166_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_005013535.1|1597364_1599437_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_005013536.1|1599656_1600694_+	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	40.2	8.5e-53
WP_005013537.1|1601880_1602738_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_005013538.1|1602765_1603542_+	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	29.7	5.6e-17
WP_005013539.1|1604369_1604879_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005013542.1|1605956_1606727_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1606723_1607734_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_101557920.1|1607792_1608873_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_101557831.1|1609041_1610161_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.2e-55
WP_080601033.1|1610162_1610906_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.2	8.0e-53
WP_005013549.1|1610910_1611282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013550.1|1611342_1611588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013551.1|1611694_1613194_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_005013552.1|1613815_1614151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013553.1|1614409_1614541_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013555.1|1614570_1615068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013556.1|1615077_1615452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013558.1|1615542_1616835_+	aspartate carbamoyltransferase	NA	Q84489	Paramecium_bursaria_Chlorella_virus	37.2	2.2e-42
WP_005013559.1|1616951_1617851_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.5	5.9e-42
WP_005013561.1|1618002_1618221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017685641.1|1618694_1620320_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_005013563.1|1620555_1622079_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	27.3	2.2e-20
WP_005013564.1|1622050_1622746_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013565.1|1623086_1624148_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.0	5.7e-113
WP_005013566.1|1624193_1624745_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005013567.1|1624751_1625672_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013568.1|1625811_1628109_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_005011985.1|1628164_1629385_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013569.1|1629643_1630249_+	DUF2889 domain-containing protein	NA	NA	NA	NA	NA
WP_005013570.1|1630259_1631420_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_005013571.1|1631441_1632323_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.4	1.1e-19
WP_005013572.1|1632619_1633318_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	33.8	8.9e-22
WP_005013573.1|1633459_1634182_+	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	43.8	8.0e-42
WP_005019317.1|1634300_1635239_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_005013577.1|1635269_1636049_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_005013578.1|1636035_1637259_+	heme biosynthesis operon protein HemX	NA	NA	NA	NA	NA
WP_005013579.1|1637263_1638811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013580.1|1638846_1639380_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	55.5	1.8e-51
WP_005013581.1|1639623_1640319_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_005013582.1|1640333_1640465_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_005013583.1|1640512_1641637_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_005013584.1|1641642_1643982_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.3	6.9e-151
WP_005013585.1|1643978_1644386_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
1644015:1644031	attL	CAGGCAGCCATCGGCCA	NA	NA	NA	NA
WP_005013586.1|1644647_1644908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|1645130_1646081_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1646179_1647130_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013587.1|1647179_1648388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013588.1|1648609_1649149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013589.1|1649373_1649778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013590.1|1649842_1650598_+	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_005013591.1|1650597_1651959_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013592.1|1651955_1652579_+	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|1652622_1653742_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005013595.1|1654394_1655150_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_005013596.1|1655326_1656121_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005013597.1|1656117_1656555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153566127.1|1656666_1656819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013598.1|1657239_1658208_-	homoserine kinase	NA	NA	NA	NA	NA
WP_025341429.1|1658364_1659372_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017685693.1|1659429_1659888_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005013601.1|1659961_1661308_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005013602.1|1661325_1661697_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_005013604.1|1661696_1663166_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	36.1	5.8e-47
WP_005013607.1|1663321_1664047_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005019347.1|1664060_1666775_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013609.1|1667026_1668391_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005013610.1|1668430_1669489_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.7	4.9e-80
WP_005013611.1|1669516_1670335_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_005013612.1|1670372_1670651_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005013614.1|1671914_1672214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013615.1|1672783_1674187_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_005013616.1|1674199_1674850_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_005011985.1|1674991_1676212_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013617.1|1676242_1677319_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_005013618.1|1677465_1678596_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_005019351.1|1678782_1680408_+	membrane protein	NA	NA	NA	NA	NA
WP_005019353.1|1680414_1681230_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_110097765.1|1681244_1682315_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_005013621.1|1682366_1683026_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_101557807.1|1683665_1684828_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_157933264.1|1684869_1685184_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	50.5	1.5e-24
WP_080687433.1|1685167_1685554_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_101557809.1|1685592_1685859_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005013625.1|1686251_1686941_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005013626.1|1687040_1687202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017685992.1|1687352_1687517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013627.1|1687643_1687880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013628.1|1688069_1688318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013629.1|1688431_1689802_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1689681:1689697	attR	TGGCCGATGGCTGCCTG	NA	NA	NA	NA
WP_005013631.1|1689802_1690543_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005013632.1|1691050_1693003_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	35.9	7.1e-125
>prophage 4
NZ_CP043066	Bordetella holmesii strain J712 chromosome, complete genome	3696492	1711297	1755224	3696492	integrase,transposase,holin,tRNA	Leptospira_phage(33.33%)	37	1753792:1753806	1760268:1760282
WP_005019367.1|1711297_1714159_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.4	1.0e-71
WP_005013657.1|1714148_1715114_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_005019369.1|1715870_1717346_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_005013659.1|1717350_1717626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|1717962_1719082_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_161992024.1|1718956_1719205_+|transposase	transposase	transposase	A4PE56	Ralstonia_virus	94.1	1.9e-11
WP_005013660.1|1719383_1720592_+	stearoyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005013661.1|1720588_1722871_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	36.2	2.5e-105
WP_005013662.1|1722881_1725263_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_005013663.1|1725526_1727434_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.9	4.3e-66
WP_005013664.1|1727448_1728339_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005013665.1|1728345_1729479_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005013666.1|1729478_1730300_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_005013667.1|1730324_1731515_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_005013668.1|1731816_1732098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013669.1|1732263_1732584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101557814.1|1732623_1733710_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.5	2.0e-44
WP_005013671.1|1733906_1734167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013542.1|1734659_1735430_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_025341421.1|1735426_1736437_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013672.1|1736471_1737314_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.0	1.3e-54
WP_005013673.1|1737776_1738562_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_101557815.1|1739421_1740541_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.6	7.5e-55
WP_005012353.1|1741607_1742612_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005013675.1|1742687_1743500_+	type I phosphodiesterase/nucleotide pyrophosphatase 1	NA	NA	NA	NA	NA
WP_005013676.1|1743727_1745899_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_005013677.1|1745952_1747272_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005011985.1|1747360_1748581_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013678.1|1748799_1749660_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013679.1|1749656_1750880_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013680.1|1751178_1751676_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_005013681.1|1751714_1752497_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
WP_005013682.1|1752522_1752741_-	SlyX family protein	NA	NA	NA	NA	NA
WP_005019379.1|1752815_1753085_+	YunC family protein	NA	NA	NA	NA	NA
WP_005013684.1|1753304_1753769_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
1753792:1753806	attL	GCCGATGGCATCGGC	NA	NA	NA	NA
WP_005013685.1|1753842_1754124_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005013686.1|1754240_1755224_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1760268:1760282	attR	GCCGATGCCATCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP043066	Bordetella holmesii strain J712 chromosome, complete genome	3696492	1780500	1821892	3696492	transposase	Ralstonia_virus(50.0%)	38	NA	NA
WP_005012067.1|1780500_1781451_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013708.1|1781447_1781963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013710.1|1782320_1782941_+	SCO family protein	NA	NA	NA	NA	NA
WP_005013711.1|1783040_1783292_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_005013712.1|1783379_1784858_-	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_005013714.1|1784854_1788025_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005013715.1|1788037_1789234_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005013717.1|1789422_1790355_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013718.1|1790423_1791155_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005013719.1|1791220_1791856_+	chorismate lyase	NA	NA	NA	NA	NA
WP_005013720.1|1791841_1793020_-	MFS transporter	NA	NA	NA	NA	NA
WP_005013721.1|1793180_1793729_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_005013722.1|1793809_1794169_+	LysE family transporter	NA	NA	NA	NA	NA
WP_005011985.1|1794216_1795437_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005013723.1|1795512_1796634_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005013724.1|1796671_1797385_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	1.7e-12
WP_005013725.1|1797395_1798616_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	4.6e-183
WP_005013726.1|1798698_1799253_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005013727.1|1799398_1800349_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013729.1|1800308_1800470_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_005013730.1|1800510_1801437_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013731.1|1801450_1802323_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005013732.1|1802485_1803433_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026087954.1|1803771_1804353_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|1804930_1805881_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013735.1|1805860_1806613_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_005019399.1|1806625_1807357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013736.1|1807513_1809679_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005013738.1|1809768_1810038_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005019401.1|1810126_1810333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013740.1|1810331_1810850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003814004.1|1810868_1811648_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005013742.1|1811815_1812832_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005013744.1|1812904_1813396_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003814007.1|1813406_1815122_-	acetolactate synthase 3 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	30.3	3.1e-60
WP_003814009.1|1818888_1820130_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|1820141_1820915_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005013747.1|1820941_1821892_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP043066	Bordetella holmesii strain J712 chromosome, complete genome	3696492	2150104	2210227	3696492	transposase,protease,tRNA	Ralstonia_virus(23.08%)	59	NA	NA
WP_005014173.1|2150104_2150593_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	39.1	1.3e-06
WP_005014175.1|2150585_2151434_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_005014177.1|2151525_2152023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014180.1|2152160_2152520_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_005014182.1|2152516_2152798_-	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_005014183.1|2152797_2153280_-	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_005014185.1|2153281_2154910_-	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_005014186.1|2154906_2155251_-	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_005019567.1|2155252_2158195_-	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_005014197.1|2158640_2159612_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_005014198.1|2159601_2160984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2161126_2162077_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005014200.1|2162036_2163278_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005014202.1|2163274_2164396_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_005014203.1|2165887_2166355_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014210.1|2166425_2167076_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
WP_005014211.1|2167162_2168302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012353.1|2168470_2169475_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014212.1|2169471_2170719_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_005014213.1|2171071_2171938_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	5.9e-23
WP_005014215.1|2171897_2173502_+	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_005014221.1|2173513_2174200_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005014223.1|2174196_2175237_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005014226.1|2175352_2176024_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005019577.1|2176020_2177013_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014228.1|2177009_2177948_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.4	8.6e-20
WP_005014229.1|2177944_2179099_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005014231.1|2179107_2180559_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014235.1|2180589_2181072_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_005014237.1|2181073_2181967_+	NRDE family protein	NA	Q9J5E1	Fowlpox_virus	34.8	6.5e-25
WP_005014239.1|2181963_2182407_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_005014241.1|2182419_2182794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014242.1|2182936_2183335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076879494.1|2183461_2183749_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005014247.1|2183745_2184162_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_005014248.1|2184337_2184970_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_005014250.1|2184998_2185445_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_005014253.1|2185731_2186883_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_005012353.1|2186996_2188001_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014256.1|2188984_2189692_+	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_032954285.1|2189624_2191076_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_005014260.1|2191081_2194240_+	error-prone DNA polymerase	NA	M9MUV5	Rhodococcus_phage	29.0	1.2e-52
WP_005014263.1|2194252_2194774_-	DNA-deoxyinosine glycosylase	NA	NA	NA	NA	NA
WP_005014265.1|2194763_2195588_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_005014267.1|2195584_2196184_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.9	7.0e-07
WP_005014269.1|2196292_2198149_-	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_005012353.1|2198297_2199302_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	60.8	4.4e-139
WP_005014271.1|2199510_2200773_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_005014274.1|2200777_2201113_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_005014275.1|2201109_2202039_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014277.1|2202043_2202757_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_005014278.1|2202860_2204318_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.6	1.0e-11
WP_005014281.1|2204314_2204611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153567346.1|2204735_2206094_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.2	3.0e-42
WP_005014285.1|2206194_2206995_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_005014286.1|2207174_2208293_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	46.5	3.4e-79
WP_005014289.1|2208365_2208737_+	lipoprotein	NA	NA	NA	NA	NA
WP_005014290.1|2208743_2209595_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.9	4.0e-16
WP_005014292.1|2209615_2210227_-|protease	ATP-dependent protease La (LON) domain-containing protein	protease	NA	NA	NA	NA
>prophage 7
NZ_CP043066	Bordetella holmesii strain J712 chromosome, complete genome	3696492	2305356	2426867	3696492	integrase,transposase,protease,tRNA	Leptospira_phage(15.15%)	106	2336886:2336945	2358193:2358467
WP_101557807.1|2305356_2306519_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019669.1|2306631_2307600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014478.1|2307596_2308517_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025341469.1|2308613_2313092_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005019672.1|2313470_2317805_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_005014481.1|2318443_2319007_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_005014483.1|2319018_2319264_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_005014492.1|2319419_2319929_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014495.1|2319974_2320955_+	DUF4880 domain-containing protein	NA	NA	NA	NA	NA
WP_005014496.1|2321166_2323518_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_005014497.1|2323564_2324395_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005019676.1|2324391_2325081_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	4.1e-35
WP_005014501.1|2325073_2326354_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005014502.1|2326451_2327390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014504.1|2327371_2329078_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.1	2.2e-50
WP_100225795.1|2329155_2330259_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	38.7	1.3e-06
WP_005014509.1|2330311_2331061_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_005014511.1|2331067_2332582_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	8.8e-83
WP_005019680.1|2332594_2332882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014514.1|2332902_2333790_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_005014516.1|2333940_2334447_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005014518.1|2334443_2335400_+	FecR family protein	NA	NA	NA	NA	NA
WP_005019683.1|2335587_2336934_+	TonB-dependent receptor	NA	NA	NA	NA	NA
2336886:2336945	attL	TGACCTGCCCCCAGATTTAGTACGGCACCGACATAGAGCCCAGGGGTAAAAGACCTTCTT	NA	NA	NA	NA
WP_025341181.1|2336901_2337132_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	56.9	2.2e-14
WP_101558036.1|2337161_2337725_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032968029.1|2337879_2338650_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	3.7e-77
WP_025341421.1|2338646_2339657_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_076879495.1|2339971_2340418_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005014534.1|2340473_2340668_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005014536.1|2340669_2341011_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005014539.1|2341020_2342883_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	38.7	1.4e-98
WP_005014543.1|2342922_2343429_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005014544.1|2343432_2343756_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	6.8e-25
WP_005014545.1|2343757_2344162_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.9e-53
WP_005014546.1|2344198_2345410_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_005014547.1|2345431_2345980_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_005014551.1|2346204_2346696_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017685984.1|2346910_2348941_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_005014553.1|2349015_2350218_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_032826331.1|2350760_2351696_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_005014556.1|2352729_2353011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014560.1|2353097_2353271_+	OsmC family protein	NA	NA	NA	NA	NA
WP_005014564.1|2353382_2353727_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_005014566.1|2353798_2354467_+	anti-ECF sigma factor ChrR	NA	NA	NA	NA	NA
WP_005014572.1|2355882_2356926_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	29.2	1.4e-31
WP_076879527.1|2356922_2357024_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_101557770.1|2357115_2358235_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014574.1|2358485_2359139_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	1.9e-10
2358193:2358467	attR	AAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAACCACACCTTGGATGTGCCAATCCTGAGTATCTGACGATGGCTTTGCGCGAATCGACCGCAAACCAGGGGCCAGCCATGACCGCGTAGCGTCCCCTGCTTGCGGTAGTCGCTAGAAACGGGAGTATCGCCCTGGCATCGCTTGCATTTTTCAGCTGTGTCCCCCAGAATCACGCTGTATATACATACAGTCCGTGGTTCACACAAGCCCCGGGCC	NA	NA	NA	NA
WP_032974133.1|2359254_2360475_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	7.9e-183
WP_005014581.1|2360525_2362955_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.4	3.6e-219
WP_005014587.1|2363120_2364419_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.3	3.1e-129
WP_005014589.1|2364523_2365177_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.9	2.0e-55
WP_005014590.1|2365179_2366490_-	trigger factor	NA	NA	NA	NA	NA
WP_005014595.1|2366717_2367257_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	35.8	4.3e-24
WP_101557809.1|2367735_2368002_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_135238891.1|2368040_2368406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025341473.1|2368287_2369298_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	4.4e-78
WP_005013542.1|2369294_2370065_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	56.6	2.8e-77
WP_050427733.1|2370150_2370810_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	46.5	6.2e-49
WP_005014598.1|2370777_2371269_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_005014599.1|2371378_2371582_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	66.7	6.6e-18
WP_005014600.1|2371899_2372220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014605.1|2372203_2372539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014607.1|2372593_2372806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014610.1|2372881_2373220_+	IS66 family insertion sequence hypothetical protein	NA	A0A218MNG9	uncultured_virus	50.0	3.7e-05
WP_005014613.1|2373216_2373552_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005014618.1|2373614_2375186_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	47.5	2.0e-125
WP_005014621.1|2375979_2376291_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_101557770.1|2376483_2377604_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005011899.1|2377731_2377926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557807.1|2384008_2385170_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.3	8.3e-97
WP_005019713.1|2385555_2387019_+	ribonuclease G	NA	NA	NA	NA	NA
WP_005014698.1|2387151_2388702_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	4.1e-19
WP_017685964.1|2388698_2388848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101557770.1|2389013_2390134_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
WP_005014703.1|2391247_2392105_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014704.1|2392157_2392655_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014705.1|2392775_2394191_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_005014706.1|2394200_2395385_+	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005014709.1|2395381_2396980_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_005014714.1|2398162_2398408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014716.1|2398818_2399004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005014720.1|2399159_2400071_+	DMT family transporter	NA	NA	NA	NA	NA
WP_005014721.1|2400192_2401035_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_005014723.1|2401237_2402611_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_005014726.1|2402920_2404432_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.9	2.5e-77
WP_005014728.1|2404584_2405316_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_005014730.1|2405422_2406724_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005014740.1|2406731_2407640_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_005014741.1|2407636_2408230_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_005014744.1|2408273_2408687_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_005014747.1|2408683_2409154_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_005014748.1|2409160_2409766_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_005014750.1|2411567_2413352_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_005014753.1|2413348_2414734_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005014754.1|2414719_2415682_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_005014755.1|2415751_2416381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005014759.1|2416418_2417627_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_005014760.1|2417748_2418318_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005014763.1|2418449_2420003_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005011985.1|2420306_2421527_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005014765.1|2421934_2422837_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005014766.1|2422833_2423703_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	1.5e-10
WP_005014767.1|2423699_2424551_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005014769.1|2424547_2425372_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005011985.1|2425646_2426867_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
>prophage 8
NZ_CP043066	Bordetella holmesii strain J712 chromosome, complete genome	3696492	2936309	3013369	3696492	integrase,transposase,tRNA	Ralstonia_virus(21.43%)	56	2939164:2939223	2987751:2988321
WP_005019978.1|2936309_2937089_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_005015711.1|2937111_2938059_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_005015713.1|2938060_2938261_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_101557770.1|2938595_2939715_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	1.5e-55
2939164:2939223	attL	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTT	NA	NA	NA	NA
WP_005015714.1|2940036_2940753_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_005015715.1|2940749_2941643_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005011985.1|2941806_2943027_-|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005015716.1|2943179_2944262_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.5e-31
WP_005015717.1|2945941_2946925_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_005015719.1|2946987_2948400_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_005015721.1|2948517_2949360_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_005015735.1|2949638_2950247_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	46.8	1.0e-05
WP_005015738.1|2950262_2950883_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_005015741.1|2950948_2951656_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-13
WP_005015743.1|2951660_2952383_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	1.9e-11
WP_005015745.1|2952369_2952660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005020013.1|2952735_2953956_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	5.5e-184
WP_025341216.1|2954680_2955532_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_005015753.1|2955583_2956837_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015755.1|2957013_2957802_-	putative hydro-lyase	NA	NA	NA	NA	NA
WP_005015757.1|2957921_2958836_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015758.1|2958968_2960861_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.9	4.6e-121
WP_017685928.1|2961046_2962426_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.7	4.1e-26
WP_076879504.1|2962870_2963167_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_005015774.1|2966967_2967570_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_005015778.1|2967703_2968162_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_005015780.1|2968163_2968763_-	iron transport sensor protein	NA	NA	NA	NA	NA
WP_005015783.1|2968771_2969581_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005015786.1|2969615_2970470_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005015790.1|2970589_2971177_+	HutD family protein	NA	NA	NA	NA	NA
WP_005015791.1|2971173_2972553_+	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_153566140.1|2973057_2973204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005015794.1|2980875_2982216_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	32.3	2.9e-45
WP_005015796.1|2982229_2983081_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.4e-47
WP_005015799.1|2983092_2984358_-	capsular biosynthesis protein	NA	NA	NA	NA	NA
WP_005015801.1|2984419_2986324_-	capsular polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005015804.1|2988299_2989154_-	hypothetical protein	NA	NA	NA	NA	NA
2987751:2988321	attR	GACCGAGCGCGTGGTTCGCCCAGCGGCAATCGCGCCGAATCAGAGTTGGTCAATGGACTTTGTGGCCGACGGCCTAGCCTATGGCCGCCGATTCCGCTGTTTGACTATCGTCGATGACTACACTCGCGAATGCCTGGCCATCGAGGTCGATACGTCGTTGCCGGGACTGCGTGTTGCCATGGTGCTGCAACGGCTGGCGGAGATGCGTGGCCTGCCGCGATCTATTACCGTGGACAACGGGCCAGAGTTCGCCGGAAGAGCCTTGGACGCCTGGGCCTACCAAGCAGGCGTAAAGCTGTCGTTTATTCGGCCGGGTAAGCCGGTGGAGAACGCTTATATCGAAAGTTTCAACGGCAAGTTCCGCGACGAATGCCTTAACGAGCACTGGTTCTTGTCCCTGCGACAGGCTAAAAGCTTGATCGAAAACTGGCGAGTCGAGTACAACACCGATCGGCCTCACAGCGCGCTCGGATATTTAACGCCGGCGCAATTCGTGCAGGCTCATCAGAAAGAAGGTCTTTTACCCCTGGGCTCTATGTCGGTGCCGTACTAAATCTGGGGGCAGGTCAGC	NA	NA	NA	NA
WP_005015806.1|2989146_2989941_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005015810.1|2990156_2991107_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005020039.1|2991709_2992507_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015813.1|2992546_2993200_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005015815.1|2993180_2994245_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	37.3	6.5e-32
WP_005015817.1|2994408_2996634_-	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_005015818.1|2996879_2998724_-|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_005015820.1|2998840_2999713_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_005015825.1|2999759_3001460_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.5	1.0e-31
WP_005015826.1|3001522_3002722_+	amidohydrolase	NA	NA	NA	NA	NA
WP_005015829.1|3002732_3003611_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015832.1|3003717_3004755_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_025341225.1|3004835_3005240_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_005015836.1|3005251_3006709_+	magnesium transporter	NA	NA	NA	NA	NA
WP_005015841.1|3007351_3007948_-	cation transport-associated protein	NA	NA	NA	NA	NA
WP_005015844.1|3008108_3008567_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005015847.1|3009344_3010316_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015849.1|3010437_3010857_+	DUF1993 domain-containing protein	NA	NA	NA	NA	NA
WP_005016668.1|3012148_3013369_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.1	1.0e-182
>prophage 9
NZ_CP043066	Bordetella holmesii strain J712 chromosome, complete genome	3696492	3548608	3585824	3696492	transposase,holin,protease,tRNA	Ralstonia_virus(11.11%)	38	NA	NA
WP_005011985.1|3548608_3549829_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	75.4	1.6e-183
WP_005016909.1|3549890_3551069_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005016911.1|3551087_3552182_-|tRNA	tRNA CCA-pyrophosphorylase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	49.5	1.2e-49
WP_005016914.1|3552178_3554218_-	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	38.7	3.4e-13
WP_005016917.1|3554338_3555016_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_005016919.1|3556678_3557611_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_005016921.1|3557624_3558428_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_005016923.1|3558460_3559324_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_005016926.1|3559422_3560373_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005016929.1|3560369_3560849_-	DoxX family protein	NA	NA	NA	NA	NA
WP_005016932.1|3560811_3561084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076879514.1|3561047_3561812_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_005016938.1|3561847_3562105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005016939.1|3562381_3563371_+	extra-cytoplasmic solute receptor family protein 175	NA	NA	NA	NA	NA
WP_005016941.1|3563424_3564267_-	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_005016943.1|3564266_3564602_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_005016945.1|3564664_3566086_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	29.0	1.8e-37
WP_005016947.1|3566346_3567390_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_005016949.1|3567457_3567679_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_005016951.1|3567905_3568118_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_005016952.1|3568114_3568879_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_005016955.1|3568933_3570097_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	60.9	3.4e-127
WP_005020237.1|3570114_3571230_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_005016962.1|3571226_3572120_+	lysophospholipid acyltransferase family protein	NA	A0A1W6JP29	Morganella_phage	31.2	5.5e-32
WP_005016964.1|3572142_3573039_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_005016967.1|3573063_3573732_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_005016969.1|3573738_3574707_+	tyrosine recombinase XerC	NA	A0A166YH27	Gordonia_phage	29.9	3.3e-14
WP_005020238.1|3574712_3576758_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005016972.1|3576844_3577786_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_005016975.1|3577782_3578448_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_005020243.1|3578408_3579410_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005016979.1|3579412_3580288_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_005016985.1|3580284_3581040_-	metal ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.5	5.5e-09
WP_017685723.1|3581215_3581716_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_005016990.1|3582075_3583185_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_005016992.1|3583306_3583771_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_005016994.1|3583923_3584478_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017685724.1|3584489_3585824_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.6	9.3e-44
