The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP021929	Lactobacillus plantarum strain TMW 1.1308 chromosome, complete genome	3221805	321421	361905	3221805	protease,bacteriocin,transposase	Lactobacillus_phage(66.67%)	37	NA	NA
WP_153629564.1|321421_321985_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_024002428.1|322178_322847_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_013355172.1|323004_324510_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003643763.1|324744_325113_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_003641932.1|325217_325727_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_013355174.1|325757_326954_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003646440.1|327063_327534_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641935.1|327552_328008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643766.1|328111_328684_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003646441.1|328849_329770_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_153629565.1|329906_330818_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_153629566.1|331708_332155_-	ribonuclease H	NA	NA	NA	NA	NA
WP_063731278.1|332392_333919_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_153629567.1|333919_334891_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_021356773.1|334968_336300_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_153629568.1|336765_338283_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_027821514.1|338297_340127_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_153629569.1|340141_340864_+	MIP family channel protein	NA	NA	NA	NA	NA
WP_153629570.1|341058_343407_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_153629571.1|343408_345124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011100983.1|345138_345558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011100984.1|345606_345870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641960.1|345981_346257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015379760.1|346638_347256_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_016511579.1|347259_348414_-	MFS transporter	NA	NA	NA	NA	NA
WP_015825116.1|348417_349209_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_153629572.1|349279_350152_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153629573.1|350311_351127_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_060677623.1|351652_353029_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_015825118.1|353073_354258_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_027821506.1|354821_355001_+|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_153629574.1|355945_356614_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_153302738.1|357202_357370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153629575.1|357387_358728_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_002816285.1|359071_359323_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_153629576.1|359376_360219_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	1.8e-157
WP_015825123.1|361131_361905_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP021929	Lactobacillus plantarum strain TMW 1.1308 chromosome, complete genome	3221805	429780	547291	3221805	tail,integrase,terminase,lysis,portal,protease,tRNA,transposase,capsid	Lactobacillus_phage(69.7%)	109	504799:504814	510141:510156
WP_011101040.1|429780_430680_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_003646517.1|430749_431529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033615816.1|431750_433139_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_003642058.1|433393_434980_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	1.0e-73
WP_076634728.1|435183_435399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642061.1|436092_436455_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003642062.1|436454_437582_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.6	2.5e-29
WP_003637688.1|437990_438383_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	36.0	5.7e-10
WP_024002654.1|438674_440654_+	potassium uptake protein	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	35.6	2.8e-68
WP_070083712.1|441350_442403_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_013355197.1|442423_443437_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_003642066.1|443452_444223_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	9.8e-30
WP_070083715.1|444369_447432_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_153629583.1|447424_448492_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_015379826.1|448760_449786_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_074029737.1|449816_451025_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_003642071.1|451040_451787_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_080481122.1|451783_452953_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.6	1.7e-17
WP_021356429.1|452945_453968_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_003642074.1|454076_454583_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	32.1	2.9e-06
WP_153629584.1|454772_455618_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	31.8	7.7e-20
WP_003643849.1|455829_456468_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003642077.1|456622_458017_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_003642078.1|458235_459198_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_021356688.1|459529_460087_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_072539686.1|460106_463634_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_070083259.1|463808_465413_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_003642082.1|465409_465697_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_003642083.1|465817_466216_+	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_003642084.1|466340_466880_+	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_070083260.1|467162_468509_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	26.7	1.8e-10
WP_003642086.1|468528_469071_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	26.0	1.5e-08
WP_003643854.1|469150_471388_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	47.8	6.0e-104
WP_003642088.1|471536_472424_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_003642089.1|472423_473431_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003642090.1|473534_475034_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.5	1.6e-89
WP_015825156.1|475197_476868_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	4.7e-93
WP_003643855.1|483344_484817_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.3	2.1e-68
WP_003640888.1|484871_485714_+	phosphoesterase	NA	NA	NA	NA	NA
WP_024971775.1|486895_487420_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003640891.1|487450_487786_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_013355212.1|487820_488663_+	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_153629585.1|488821_489928_-	anion permease	NA	NA	NA	NA	NA
WP_003640894.1|490120_490942_-	nicotinamide mononucleotide transporter	NA	A0A2K9VCL6	Lactobacillus_phage	42.2	3.3e-52
WP_153629586.1|491302_492094_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	36.1	2.7e-30
WP_153629587.1|492172_493309_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003640897.1|493332_494034_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003640898.1|494203_494941_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_003640899.1|495097_496576_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.1	2.5e-106
WP_003640900.1|496575_497403_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.0	6.5e-72
WP_016511751.1|497858_500513_+	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	28.9	8.8e-70
WP_003640902.1|500567_501002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153629588.1|501026_502688_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	4.6e-93
WP_053566457.1|503059_505231_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
504799:504814	attL	ATTGAAGACGACGGAC	NA	NA	NA	NA
WP_003644992.1|505230_505677_+	SprT family protein	NA	NA	NA	NA	NA
WP_003640905.1|505742_507029_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003640906.1|507037_507913_+	homoserine kinase	NA	NA	NA	NA	NA
WP_063486787.1|508203_509361_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	98.7	2.5e-218
WP_153629589.1|509547_511023_-	transcriptional regulator	NA	NA	NA	NA	NA
510141:510156	attR	GTCCGTCGTCTTCAAT	NA	NA	NA	NA
WP_063845578.1|511153_511642_-	cupin domain-containing protein	NA	A0A291ATU0	Pandoravirus	36.3	2.0e-12
WP_063845594.1|511718_512081_-	hypothetical protein	NA	E9LUS2	Lactobacillus_phage	90.8	3.7e-56
WP_063845579.1|512499_513123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643876.1|513215_513647_-	hypothetical protein	NA	A0A2P0ZLA0	Lactobacillus_phage	100.0	7.6e-80
WP_063845580.1|513656_514046_-	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	96.8	1.5e-66
WP_153629590.1|514352_514562_+	XRE family transcriptional regulator	NA	A0A2P0ZL97	Lactobacillus_phage	97.1	3.5e-30
WP_054397032.1|514565_514769_+	hypothetical protein	NA	A0A2P0ZLA4	Lactobacillus_phage	100.0	4.0e-31
WP_063207861.1|514768_515041_+	hypothetical protein	NA	A0A2P0ZLA9	Lactobacillus_phage	98.9	3.6e-43
WP_062688194.1|515179_515623_+	hypothetical protein	NA	A0A2P0ZLA2	Lactobacillus_phage	91.8	6.0e-72
WP_015825166.1|515784_515970_+	hypothetical protein	NA	A0A2P0ZLA3	Lactobacillus_phage	91.8	2.4e-27
WP_153629591.1|515941_516112_+	hypothetical protein	NA	A0A2P0ZLA6	Lactobacillus_phage	100.0	6.5e-27
WP_063845581.1|516214_516694_+	siphovirus Gp157 family protein	NA	A0A2P0ZLB3	Lactobacillus_phage	95.0	3.8e-80
WP_153629592.1|516693_518070_+	ATP-dependent helicase	NA	A0A2P0ZLA5	Lactobacillus_phage	98.4	1.1e-238
WP_063845583.1|518066_518783_+	AAA family ATPase	NA	A0A2P0ZLB2	Lactobacillus_phage	98.1	5.1e-113
WP_063845584.1|518785_519409_+	hypothetical protein	NA	A0A2P0ZLB9	Lactobacillus_phage	98.9	5.4e-103
WP_063964024.1|519479_520274_+	DNA primase	NA	A0A2P0ZLB0	Lactobacillus_phage	92.8	5.9e-139
WP_063207841.1|520270_521545_+	helicase	NA	A0A2P0ZLC4	Lactobacillus_phage	97.9	7.3e-240
WP_063964026.1|521802_522138_+	VRR-NUC domain-containing protein	NA	A0A2P0ZLB6	Lactobacillus_phage	88.2	1.0e-52
WP_153629593.1|522147_522399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129637387.1|522391_522550_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	96.2	7.9e-19
WP_153629594.1|522552_522699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063964030.1|522691_523033_+	hypothetical protein	NA	O03921	Lactobacillus_phage	92.0	8.7e-55
WP_128703137.1|523105_523417_+	hypothetical protein	NA	A0A2K9VC43	Lactobacillus_phage	44.1	1.0e-17
WP_063964032.1|523463_524198_-	DUF4145 domain-containing protein	NA	A0A1L2JZ52	Aeribacillus_phage	25.9	2.2e-10
WP_063964033.1|524262_524676_+	DUF1492 domain-containing protein	NA	A0A2P0ZLC0	Lactobacillus_phage	59.9	2.8e-39
WP_077143432.1|524950_525151_+	hypothetical protein	NA	A0A2P0ZLC2	Lactobacillus_phage	88.6	1.8e-15
WP_080472332.1|525134_525473_+	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	93.8	5.2e-60
WP_063964035.1|525472_525715_+	hypothetical protein	NA	A0A2P0ZLD3	Lactobacillus_phage	81.2	1.6e-31
WP_063964036.1|525732_525984_+	hypothetical protein	NA	A0A2P0ZLD2	Lactobacillus_phage	88.0	3.6e-34
WP_063845558.1|526091_526379_+	hypothetical protein	NA	A0A2P0ZLC8	Lactobacillus_phage	68.4	2.0e-28
WP_063845551.1|526375_528055_+|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	69.5	4.5e-229
WP_153629595.1|528073_529216_+|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	98.7	1.3e-214
WP_003643904.1|529202_529955_+|protease	Clp protease ClpP	protease	A0A2P0ZLE3	Lactobacillus_phage	98.8	6.0e-133
WP_063845549.1|529975_531154_+|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	98.5	2.8e-217
WP_003643906.1|531292_531598_+	hypothetical protein	NA	A0A2P0ZLD5	Lactobacillus_phage	91.1	1.6e-44
WP_003643907.1|531578_531968_+	hypothetical protein	NA	A0A2P0ZLD1	Lactobacillus_phage	89.1	3.4e-63
WP_003643908.1|531964_532372_+	hypothetical protein	NA	A0A2P0ZLD7	Lactobacillus_phage	97.8	3.3e-69
WP_003643909.1|532368_532791_+	hypothetical protein	NA	A0A2P0ZLE4	Lactobacillus_phage	98.6	7.4e-72
WP_003643910.1|532805_533417_+|tail	tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	97.0	1.1e-105
WP_003643911.1|533508_533823_+	hypothetical protein	NA	A0A2P0ZLF3	Lactobacillus_phage	90.4	4.2e-48
WP_003643912.1|533846_534068_+	hypothetical protein	NA	A0A2P0ZLD9	Lactobacillus_phage	98.6	3.9e-32
WP_063845548.1|534086_538631_+|tail	phage tail tape measure protein	tail	A0A2P0ZLF1	Lactobacillus_phage	96.0	0.0e+00
WP_153629596.1|538634_539456_+|tail	phage tail protein	tail	A0A2P0ZLE2	Lactobacillus_phage	95.6	1.3e-149
WP_153629954.1|541425_544452_+	hypothetical protein	NA	A0A2P0ZLE1	Lactobacillus_phage	68.3	7.4e-222
WP_063845557.1|544477_544960_+	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	99.4	3.8e-80
WP_003643917.1|544961_545396_+	hypothetical protein	NA	A0A2P0ZLE9	Lactobacillus_phage	100.0	1.2e-72
WP_003643918.1|545425_545803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063722933.1|545802_546075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063845546.1|546074_546359_+|lysis	lysis protein	lysis	A0A2P0ZLE8	Lactobacillus_phage	97.9	5.4e-42
WP_063845545.1|546358_547291_+	lysin	NA	A0A2P0ZLG2	Lactobacillus_phage	95.8	3.2e-176
>prophage 3
NZ_CP021929	Lactobacillus plantarum strain TMW 1.1308 chromosome, complete genome	3221805	1241734	1251572	3221805		Lactobacillus_phage(87.5%)	9	NA	NA
WP_153629659.1|1241734_1242964_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	96.9	1.5e-213
WP_099739230.1|1243054_1244026_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	98.8	3.5e-181
WP_027822909.1|1244211_1245159_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	99.7	1.0e-177
WP_003643097.1|1245502_1246117_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_021356348.1|1246119_1248558_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.4	0.0e+00
WP_153629660.1|1248645_1249206_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	99.5	1.0e-100
WP_011101401.1|1249276_1249717_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	3.0e-76
WP_015380221.1|1249812_1249950_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003645220.1|1250576_1251572_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
>prophage 4
NZ_CP021929	Lactobacillus plantarum strain TMW 1.1308 chromosome, complete genome	3221805	1257285	1265988	3221805	transposase	Staphylococcus_phage(66.67%)	10	NA	NA
WP_102115484.1|1257285_1258353_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	32.8	9.4e-39
WP_003640236.1|1258353_1258956_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.9	1.8e-23
WP_011101406.1|1258957_1260172_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.4	2.0e-85
WP_011101407.1|1260168_1260648_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.6e-33
WP_153629661.1|1260678_1261188_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003561810.1|1261228_1262158_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_003640240.1|1262462_1263026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101408.1|1263114_1263756_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_153629662.1|1263891_1264518_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063485392.1|1264671_1265988_+	NADH peroxidase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.0	1.5e-09
>prophage 5
NZ_CP021929	Lactobacillus plantarum strain TMW 1.1308 chromosome, complete genome	3221805	1805202	1862681	3221805	protease,tRNA,integrase,transposase	Lactobacillus_phage(20.0%)	60	1794860:1794879	1869513:1869532
1794860:1794879	attL	GTCTTCCCATGGTCAACGTG	NA	NA	NA	NA
WP_003640733.1|1805202_1806480_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003640734.1|1806517_1807303_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003640735.1|1807318_1808098_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.1	1.1e-23
WP_003640736.1|1808217_1808781_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003640737.1|1808782_1809505_-	UMP kinase	NA	NA	NA	NA	NA
WP_003644498.1|1809704_1810583_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_003640739.1|1810685_1811489_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_003640740.1|1811713_1812436_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003640741.1|1812724_1813723_-	D-2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	34.9	2.3e-47
WP_057716935.1|1813807_1814113_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_108909949.1|1814096_1814855_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_025015626.1|1814966_1815602_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003640745.1|1815658_1815895_-	YneF family protein	NA	NA	NA	NA	NA
WP_003644501.1|1815992_1816232_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003640747.1|1816383_1817016_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.2	2.3e-16
WP_089178220.1|1817105_1817336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003645631.1|1817639_1818269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153629737.1|1818318_1819488_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003640750.1|1819523_1819916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003644503.1|1820079_1820472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076656427.1|1820917_1821859_+	glycosyltransferase family 2 protein	NA	V9QJB1	Oenococcus_phage	48.7	3.1e-78
WP_024002729.1|1822617_1822869_+	DUF4428 domain-containing protein	NA	NA	NA	NA	NA
WP_003640755.1|1823090_1823474_+	hypothetical protein	NA	O48432	Lactobacillus_phage	27.4	4.7e-09
WP_153629738.1|1823618_1824962_+	DUF4428 domain-containing protein	NA	O48432	Lactobacillus_phage	25.7	8.3e-16
WP_050495869.1|1824978_1825581_+	DUF4428 domain-containing protein	NA	NA	NA	NA	NA
WP_099686937.1|1825975_1826224_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.0	1.2e-10
WP_015825666.1|1826364_1826781_-|transposase	IS3 family transposase	transposase	A0A0C5AC89	Paenibacillus_phage	35.0	9.1e-06
WP_033608763.1|1826840_1827308_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153629739.1|1827555_1827945_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015825668.1|1828311_1829475_+|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	38.4	8.6e-62
WP_003640763.1|1829896_1830103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153629740.1|1830277_1831039_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003640765.1|1831150_1831498_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003640766.1|1831594_1832806_-	MFS transporter	NA	NA	NA	NA	NA
WP_013355655.1|1832921_1833506_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003640768.1|1833648_1834167_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.1	9.5e-29
WP_153629741.1|1834185_1836522_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	31.4	2.3e-74
WP_003644563.1|1836543_1836894_-	LapA family protein	NA	NA	NA	NA	NA
WP_003640771.1|1836906_1837698_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_153629742.1|1837707_1838643_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_003644565.1|1839075_1839360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153629743.1|1839506_1840802_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003644567.1|1841049_1841805_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.8	1.6e-21
WP_063722536.1|1841801_1842719_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_003640777.1|1842740_1844708_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_003645646.1|1844847_1846170_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_153629744.1|1847808_1848777_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_153629745.1|1848761_1850036_-	polysaccharide polymerase	NA	NA	NA	NA	NA
WP_015825680.1|1850032_1851061_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_027822101.1|1851076_1852168_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_053338959.1|1852167_1852833_-	sugar transferase	NA	NA	NA	NA	NA
WP_153629746.1|1852819_1853761_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	35.2	1.6e-37
WP_015380521.1|1853776_1854571_-	polysaccharide biosynthesis protein; phosphatase	NA	NA	NA	NA	NA
WP_003640787.1|1854536_1855244_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_003640788.1|1855261_1856020_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_153629747.1|1856442_1858257_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003640790.1|1858439_1859180_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	2.2e-31
WP_003640791.1|1859172_1860648_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_003640792.1|1860853_1861024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153629748.1|1860974_1862681_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	4.8e-93
1869513:1869532	attR	GTCTTCCCATGGTCAACGTG	NA	NA	NA	NA
>prophage 6
NZ_CP021929	Lactobacillus plantarum strain TMW 1.1308 chromosome, complete genome	3221805	2122359	2163230	3221805	tail,terminase,portal,holin,protease,transposase	Oenococcus_phage(39.39%)	51	NA	NA
WP_003561810.1|2122359_2123289_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_153629775.1|2124354_2124732_-|holin	holin	holin	A0A2P0ZLG6	Lactobacillus_phage	57.9	2.0e-12
WP_027821934.1|2124718_2125015_-	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	73.5	2.4e-37
WP_153629956.1|2125015_2126131_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	76.8	1.1e-32
WP_044431346.1|2126309_2126744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044431348.1|2126746_2127196_-	DUF1617 family protein	NA	A0A2P0ZLE0	Lactobacillus_phage	41.1	1.8e-23
WP_153629776.1|2127202_2132527_-	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	59.4	1.9e-143
WP_025015695.1|2132541_2132904_-	hypothetical protein	NA	V5UQS8	Oenococcus_phage	71.2	1.5e-44
WP_153629777.1|2132917_2138749_-|tail	phage tail protein	tail	V5URV5	Oenococcus_phage	41.7	6.3e-238
WP_031275283.1|2138764_2139028_-	hypothetical protein	NA	V9QKH3	Oenococcus_phage	65.4	2.3e-23
WP_003642826.1|2139135_2139534_-	hypothetical protein	NA	V9QJA0	Oenococcus_phage	74.8	3.0e-46
WP_099447638.1|2139633_2140017_-|tail	phage tail protein	tail	V5USQ9	Oenococcus_phage	58.4	1.8e-37
WP_003642824.1|2140118_2140484_-	hypothetical protein	NA	V5UQS4	Oenococcus_phage	53.4	3.0e-29
WP_044431353.1|2140483_2141035_-	HK97 gp10 family phage protein	NA	V5URV0	Oenococcus_phage	62.3	8.8e-65
WP_003642822.1|2141036_2141384_-	hypothetical protein	NA	V5US85	Oenococcus_phage	62.3	3.2e-36
WP_024971556.1|2141383_2141716_-	hypothetical protein	NA	V9QJ97	Oenococcus_phage	45.3	1.8e-12
WP_044431356.1|2141727_2141904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642819.1|2141916_2142939_-	hypothetical protein	NA	V5US24	Oenococcus_phage	62.5	3.7e-117
WP_024971555.1|2142958_2143309_-	hypothetical protein	NA	V5UTH9	Oenococcus_phage	63.8	3.4e-30
WP_024971554.1|2143323_2144001_-	DUF4355 domain-containing protein	NA	Q6SE80	Lactobacillus_prophage	33.0	7.1e-16
WP_003642816.1|2144173_2144380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642815.1|2144431_2144710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024971553.1|2144684_2146370_-	hypothetical protein	NA	V5US81	Oenococcus_phage	59.1	3.1e-121
WP_021356226.1|2146516_2146813_-|protease	ribosomal-processing cysteine protease Prp	protease	D2J003	Enterococcus_phage	39.2	5.6e-10
WP_046811040.1|2146742_2148251_-|portal	phage portal protein	portal	V5US18	Oenococcus_phage	52.0	1.1e-136
WP_099739599.1|2148262_2149501_-|terminase	PBSX family phage terminase large subunit	terminase	M1PG09	Streptococcus_phage	61.5	6.4e-140
WP_128536985.1|2149490_2150087_-|terminase	terminase small subunit	terminase	H9A0M8	Staphylococcus_phage	42.3	1.4e-12
WP_153629778.1|2150140_2150332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076636636.1|2150495_2151122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103420664.1|2151790_2151958_-	BC1881 family protein	NA	NA	NA	NA	NA
WP_061468330.1|2152149_2152767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153629779.1|2153042_2153504_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	57.0	3.1e-39
WP_153629780.1|2153891_2154962_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1I9KKE7	Lactobacillus_phage	61.3	1.1e-124
WP_153629781.1|2154966_2155125_-	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	88.2	1.3e-16
WP_013355743.1|2155117_2155498_-	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_063732517.1|2155494_2156013_-	hypothetical protein	NA	O03915	Lactobacillus_phage	68.4	1.3e-54
WP_153629782.1|2156009_2156297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153629783.1|2156293_2157202_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_080469566.1|2157282_2158143_-	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	50.6	2.3e-75
WP_153629784.1|2158066_2158954_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	47.4	1.0e-62
WP_080469565.1|2158950_2159337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153629785.1|2159469_2159640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063731395.1|2159707_2160220_-	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	43.5	1.6e-28
WP_063731397.1|2160286_2160592_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_003642791.1|2160798_2161095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642790.1|2161094_2161301_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003642789.1|2161442_2161673_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CNE2	Brevibacillus_phage	36.8	8.5e-06
WP_063731398.1|2161702_2161912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016511201.1|2162039_2162270_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101082.1|2162442_2162805_+	helix-turn-helix domain-containing protein	NA	A0A0U4KKM4	Exiguobacterium_phage	32.0	2.6e-09
WP_153629786.1|2162816_2163230_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	31.3	4.5e-05
>prophage 7
NZ_CP021929	Lactobacillus plantarum strain TMW 1.1308 chromosome, complete genome	3221805	2375387	2383901	3221805		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645867.1|2375387_2375966_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_015380733.1|2375958_2376984_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	1.2e-59
WP_153629816.1|2376980_2378435_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	8.6e-51
WP_021356102.1|2378419_2380639_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	3.5e-144
WP_011101895.1|2380631_2381312_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2381311_2381566_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|2381567_2382299_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_015380738.1|2382301_2383432_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642585.1|2383415_2383901_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 1
NZ_CP021931	Lactobacillus plantarum strain TMW 1.1308 plasmid pL11308-1, complete sequence	70917	689	67214	70917	transposase,holin	Streptococcus_phage(21.74%)	60	NA	NA
WP_153629860.1|689_1619_-|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.4	2.3e-25
WP_153629974.1|2645_4781_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	46.2	4.3e-107
WP_153629975.1|4877_6941_-	nickase	NA	NA	NA	NA	NA
WP_153629976.1|7192_7396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153629977.1|7441_7720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153629990.1|7709_8024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014564139.1|8205_8487_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_153629978.1|8748_9057_-	replication protein	NA	NA	NA	NA	NA
WP_063493464.1|9376_9709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013356270.1|10656_11517_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	40.2	1.7e-43
WP_016526703.1|11518_11818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122551633.1|11891_12662_+	Cof-type HAD-IIB family hydrolase	NA	Q0GXW5	Lactococcus_phage	25.2	3.8e-05
WP_122551634.1|12779_13451_-	beta-phosphoglucomutase	NA	A0A1D8KNV9	Synechococcus_phage	22.7	4.6e-07
WP_153629979.1|13469_16187_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_002816285.1|17296_17548_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_153629980.1|17601_18444_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	1.1e-156
WP_122551639.1|18600_19602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046872410.1|19804_20923_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	76.9	6.6e-168
WP_153629981.1|22183_23422_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	28.9	3.5e-37
WP_153629982.1|23506_24436_+|transposase	IS30-like element ISLpl1 family transposase	transposase	H7BW47	unidentified_phage	34.1	8.8e-25
WP_153629983.1|24542_26282_+	pyruvate oxidase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	26.4	1.6e-32
WP_128537161.1|27075_27549_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_128537162.1|27526_27721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128537163.1|28068_28317_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_128537164.1|28483_29854_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_128537165.1|29875_30892_+	general stress protein	NA	NA	NA	NA	NA
WP_153629984.1|30991_31561_+	MFS transporter	NA	NA	NA	NA	NA
WP_153629980.1|31662_32505_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	98.9	1.1e-156
WP_002816285.1|32558_32810_-|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_010579558.1|34002_34221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020090529.1|34220_34397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021356718.1|34644_36414_+	oleate hydratase	NA	NA	NA	NA	NA
WP_056971947.1|36433_36628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128537168.1|37002_37923_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.8	2.3e-49
WP_003561273.1|38666_39170_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_071665442.1|39764_40202_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_128537170.1|42455_43406_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	77.8	2.0e-24
WP_071665474.1|43850_44114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006293514.1|44711_44816_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_128537171.1|45049_46351_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	38.9	2.5e-78
WP_020090488.1|46343_46664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071665472.1|46656_47043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153629985.1|47205_48444_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	28.3	3.5e-37
WP_015062919.1|48986_50156_-	Ser/Thr protein phosphatase	NA	NA	NA	NA	NA
WP_153629986.1|50379_51378_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	9.4e-49
WP_016526714.1|51482_52040_-	YdhK family protein	NA	NA	NA	NA	NA
WP_153629987.1|52259_53120_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_128537175.1|53121_53985_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	5.7e-18
WP_128537176.1|54639_55152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128537177.1|55234_55537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011668823.1|56682_57498_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_063487298.1|57501_58356_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_041095743.1|58361_59660_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_153629988.1|59786_60926_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.3	2.4e-24
WP_016526732.1|62215_63082_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	44.4	3.4e-55
WP_003554871.1|63074_63383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046811092.1|63631_63874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020923829.1|64777_65332_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	45.1	8.9e-33
WP_128537182.1|65623_66151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153629989.1|66290_67214_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	3.9e-33
