The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045697	Brucella sp. 2280 chromosome 1, complete sequence	2268175	317238	355018	2268175	head,capsid,tRNA,terminase,protease,tail,portal	Brucella_phage(34.78%)	55	NA	NA
WP_153526714.1|317238_318786_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.3	2.8e-100
WP_153526716.1|318954_320037_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	27.5	1.9e-07
WP_008935754.1|320033_320678_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	42.4	5.5e-34
WP_070997480.1|320759_321950_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_153526718.1|322060_323326_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	53.6	2.0e-16
WP_153526720.1|323697_324045_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	58.4	3.4e-30
WP_153526722.1|324384_324645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526724.1|324732_325008_-	hypothetical protein	NA	A0A141GEZ0	Brucella_phage	94.5	1.4e-39
WP_153526726.1|325004_325688_-	glycoside hydrolase family protein	NA	A0A141GEY9	Brucella_phage	97.4	1.6e-108
WP_153526727.1|326123_327227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526729.1|327226_327475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526731.1|327491_327854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526733.1|327850_328294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526735.1|328290_328755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526737.1|328761_331401_-|tail	phage tail protein	tail	G8DH58	Emiliania_huxleyi_virus	34.1	4.2e-88
WP_153526739.1|331413_331851_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_153526741.1|331847_332525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526743.1|332521_333130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526745.1|333130_335719_-	hypothetical protein	NA	A0A076G7H2	Sinorhizobium_phage	65.8	5.7e-05
WP_153526747.1|335772_336324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153526749.1|336333_336612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526751.1|336724_337459_-	hypothetical protein	NA	Q7Y5W2	Haemophilus_phage	53.4	2.4e-57
WP_153526753.1|337505_337685_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_153526755.1|337779_338049_+	Arc family DNA-binding protein	NA	A0A0U4B0M9	Pseudomonas_phage	58.1	2.4e-07
WP_153526757.1|338076_338337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153526759.1|338402_338603_-	twin-arginine translocation signal domain-containing protein	NA	A0A141GEY1	Brucella_phage	95.5	5.5e-25
WP_153526761.1|338599_339349_-	hypothetical protein	NA	A0A141GEX9	Brucella_phage	81.9	4.9e-111
WP_153526763.1|339401_339971_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_153526765.1|339967_340189_+	amino acid transporter	NA	NA	NA	NA	NA
WP_025199124.1|340480_340732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153526768.1|340816_340972_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_153526770.1|341007_341346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526772.1|341345_341786_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_153526774.1|341858_342254_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_153526776.1|342253_342748_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_153526778.1|342725_342917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526779.1|342995_343184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153526781.1|343159_343375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526783.1|343386_343731_-|head	phage head closure protein	head	A0A141GEW5	Brucella_phage	83.0	8.8e-47
WP_153526785.1|343733_344300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526787.1|344303_344483_-	hypothetical protein	NA	A0A2H4JDE5	uncultured_Caudovirales_phage	58.7	1.3e-06
WP_153526789.1|344543_345758_-|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	65.6	3.2e-136
WP_153526791.1|345791_346454_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	54.1	1.6e-60
WP_153527993.1|346460_347696_-|portal	phage portal protein	portal	A0A0U2BXP2	Paracoccus_phage	60.1	1.4e-126
WP_153526793.1|347710_349402_-|terminase	terminase large subunit	terminase	A0A141GEV8	Brucella_phage	98.9	0.0e+00
WP_025200428.1|349398_349800_-	hypothetical protein	NA	A0A141GEV7	Brucella_phage	100.0	6.4e-73
WP_153526795.1|350612_350924_-	hypothetical protein	NA	A0A141GF40	Brucella_phage	81.6	1.2e-05
WP_004688321.1|351010_351256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153526797.1|351255_351570_+	hypothetical protein	NA	K4NZP3	Burkholderia_phage	43.4	1.2e-05
WP_153526799.1|351570_351840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526801.1|352403_352982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526803.1|353004_353193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526805.1|353202_353679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526807.1|353678_353903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153526809.1|353899_355018_-	hypothetical protein	NA	A0A068CE61	Rhizobium_phage	26.8	5.3e-16
>prophage 2
NZ_CP045697	Brucella sp. 2280 chromosome 1, complete sequence	2268175	360817	368128	2268175	integrase	Brucella_phage(33.33%)	13	366440:366453	368396:368409
WP_153526835.1|360817_361327_+	hypothetical protein	NA	G8C7S9	Escherichia_phage	29.7	1.6e-07
WP_153526837.1|362013_362415_+	hypothetical protein	NA	A0A1I9KFA6	Aeromonas_phage	37.6	1.1e-11
WP_153526839.1|362411_362588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153526841.1|362999_363410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153526843.1|363406_363724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153526845.1|363720_364272_+	hypothetical protein	NA	A0A240F4V1	Ochrobactrum_phage	75.3	7.5e-24
WP_153526847.1|364268_365009_+	site-specific DNA-methyltransferase	NA	M4M8X6	Vibrio_phage	58.6	1.1e-73
WP_153526849.1|364998_365580_+	hypothetical protein	NA	A0A141GF03	Brucella_phage	49.0	1.0e-34
WP_153526851.1|365576_365852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153526853.1|366334_366535_+	hypothetical protein	NA	NA	NA	NA	NA
366440:366453	attL	GCCGCTGCGGACTG	NA	NA	NA	NA
WP_153526855.1|366715_366913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059243679.1|366915_367116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153526857.1|367102_368128_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A141GEZ3	Brucella_phage	37.5	1.1e-47
368396:368409	attR	CAGTCCGCAGCGGC	NA	NA	NA	NA
>prophage 3
NZ_CP045697	Brucella sp. 2280 chromosome 1, complete sequence	2268175	439274	451187	2268175	tRNA	uncultured_Mediterranean_phage(90.0%)	12	NA	NA
WP_153526912.1|439274_441602_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.5	6.2e-51
WP_002964021.1|441720_442062_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.2	9.1e-12
WP_153526914.1|442221_443088_+	DUF815 domain-containing protein	NA	NA	NA	NA	NA
WP_153526916.1|443136_444435_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q8SBN9	Clostridium_phage	41.1	1.0e-18
WP_004683704.1|444811_445480_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	38.5	6.6e-14
WP_008504702.1|445476_446244_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	40.0	3.6e-40
WP_153527997.1|446392_447676_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.2	1.2e-104
WP_002964014.1|447752_448577_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	41.1	9.8e-44
WP_153526918.1|448573_449143_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_002964012.1|449253_449472_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.1	1.5e-07
WP_153526920.1|449617_450343_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.7	5.1e-44
WP_069715190.1|450335_451187_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.9	2.0e-31
>prophage 4
NZ_CP045697	Brucella sp. 2280 chromosome 1, complete sequence	2268175	618354	656911	2268175	head,integrase,terminase,plate,transposase,tail	Rhizobium_phage(84.78%)	53	611997:612013	657853:657869
611997:612013	attL	ATCATGAATTTCATGGC	NA	NA	NA	NA
WP_153527073.1|618354_619158_-	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	87.6	2.2e-133
WP_153527075.1|619292_619553_-	DUF2312 domain-containing protein	NA	A0A240F4X4	Ochrobactrum_phage	92.9	3.1e-36
WP_153527077.1|619549_619765_-	hypothetical protein	NA	R9U2V1	Rhizobium_phage	40.6	4.7e-06
WP_153527079.1|619761_620289_-	hypothetical protein	NA	R9TP62	Rhizobium_phage	56.5	2.6e-29
WP_153527081.1|620300_622019_-	DUF2793 domain-containing protein	NA	R9U0V1	Rhizobium_phage	51.5	7.9e-112
WP_153527082.1|622021_622693_-|tail	phage tail protein I	tail	R9U468	Rhizobium_phage	68.3	6.7e-75
WP_153527084.1|622685_623819_-|plate	phage baseplate assembly protein	plate	R9U1E3	Rhizobium_phage	64.4	2.2e-126
WP_153527086.1|623811_624219_-|plate	baseplate	plate	R9U2U6	Rhizobium_phage	68.1	1.1e-51
WP_153527088.1|624326_624590_-	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	85.1	7.5e-22
WP_153527091.1|624589_624991_-	hypothetical protein	NA	R9U0U6	Rhizobium_phage	49.6	1.9e-32
WP_153527093.1|624974_625976_-	late control protein D	NA	R9U464	Rhizobium_phage	70.4	9.2e-129
WP_153527095.1|625975_626167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153527097.1|626168_626438_-	hypothetical protein	NA	R9U1D8	Rhizobium_phage	76.1	1.0e-34
WP_153527099.1|626434_626911_-	hypothetical protein	NA	R9U2U2	Rhizobium_phage	72.8	9.0e-58
WP_153527101.1|626907_629478_-	hypothetical protein	NA	R9U4C6	Rhizobium_phage	63.2	4.6e-140
WP_153527103.1|629717_630065_-	hypothetical protein	NA	R9U460	Rhizobium_phage	64.5	3.0e-34
WP_153527105.1|630107_630620_-|tail	phage tail protein	tail	R9U2T4	Rhizobium_phage	90.6	8.7e-91
WP_153527107.1|630635_631898_-|tail	phage tail protein	tail	R9U4C2	Rhizobium_phage	85.7	8.1e-207
WP_153527108.1|631901_632135_-	hypothetical protein	NA	R9U0U0	Rhizobium_phage	64.1	5.4e-16
WP_153527110.1|632147_632648_-	hypothetical protein	NA	R9U453	Rhizobium_phage	83.2	8.8e-72
WP_153527112.1|632638_633106_-	DUF1320 domain-containing protein	NA	R9U1C9	Rhizobium_phage	81.3	1.4e-66
WP_153527114.1|633211_633619_-	hypothetical protein	NA	R9U2T2	Rhizobium_phage	38.8	1.3e-09
WP_153527116.1|633631_634588_-	hypothetical protein	NA	R9U4B8	Rhizobium_phage	92.0	1.9e-163
WP_153527118.1|634598_634937_-	hypothetical protein	NA	R9U0T4	Rhizobium_phage	71.4	1.9e-33
WP_153527999.1|634952_636107_-	hypothetical protein	NA	R9U448	Rhizobium_phage	71.8	1.2e-143
WP_153527120.1|636365_636833_-	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	67.1	1.3e-48
WP_153527122.1|636936_638469_-|head	head morphogenesis protein	head	R9U2S4	Rhizobium_phage	65.9	6.4e-198
WP_153527124.1|638522_639944_-	DUF935 family protein	NA	R9U4B4	Rhizobium_phage	82.0	3.1e-223
WP_153527126.1|639940_641599_-|terminase	phage terminase large subunit	terminase	R9U0T3	Rhizobium_phage	83.3	1.3e-273
WP_153527128.1|641595_642096_-	DUF1804 family protein	NA	R9U444	Rhizobium_phage	64.1	1.8e-56
WP_153527130.1|642095_642431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153527132.1|642427_642835_-	hypothetical protein	NA	R9U2R8	Rhizobium_phage	81.5	3.4e-58
WP_153527134.1|642834_643683_-	hypothetical protein	NA	R9U4A9	Rhizobium_phage	77.8	1.4e-122
WP_153527136.1|643764_644148_-	hypothetical protein	NA	R9U0S8	Rhizobium_phage	77.9	3.8e-51
WP_153527138.1|644228_644561_+	hypothetical protein	NA	R9U440	Rhizobium_phage	52.7	5.9e-24
WP_153527140.1|644563_644956_-	DUF1018 domain-containing protein	NA	F8TVB3	EBPR_siphovirus	55.1	2.6e-34
WP_153527142.1|644952_645636_-	DUF2786 domain-containing protein	NA	A0A219VHD3	Ochrobactrum_phage	49.1	3.8e-49
WP_153527144.1|645722_646256_-	nuclease inhibitor protein	NA	R9U434	Rhizobium_phage	59.0	2.8e-52
WP_153527146.1|646280_646556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153527148.1|646545_646773_-	hypothetical protein	NA	R9U2R2	Rhizobium_phage	68.8	2.6e-15
WP_153528000.1|646762_647125_-	MarR family transcriptional regulator	NA	R9U499	Rhizobium_phage	63.7	7.3e-36
WP_153527150.1|647130_647730_-	hypothetical protein	NA	G8GWC2	Rhodobacter_phage	40.6	3.1e-31
WP_153527152.1|647729_648497_-	AAA family ATPase	NA	R9U430	Rhizobium_phage	66.8	1.2e-96
WP_153527154.1|648525_650778_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	R9U1A8	Rhizobium_phage	74.3	0.0e+00
WP_153527156.1|650774_651242_-	hypothetical protein	NA	R9U2Q7	Rhizobium_phage	76.8	1.0e-61
WP_153527158.1|651244_652228_-	chromosome partitioning protein ParB	NA	R9U496	Rhizobium_phage	56.4	1.2e-83
WP_153527160.1|652224_652377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153527162.1|652376_652793_-	hypothetical protein	NA	R9U1A5	Rhizobium_phage	74.7	3.4e-37
WP_153527164.1|652830_653523_+	helix-turn-helix domain-containing protein	NA	G8GWB1	Rhodobacter_phage	38.7	8.0e-31
WP_153527166.1|654140_654695_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_002964452.1|654791_655214_-	RbsD/FucU transporter	NA	NA	NA	NA	NA
WP_153527168.1|655307_656117_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002964454.1|656131_656911_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	24.5	1.6e-11
657853:657869	attR	GCCATGAAATTCATGAT	NA	NA	NA	NA
>prophage 5
NZ_CP045697	Brucella sp. 2280 chromosome 1, complete sequence	2268175	690334	715149	2268175	integrase,tRNA,protease,transposase,portal	Wolbachia_phage(11.11%)	23	712523:712542	722888:722907
WP_153528001.1|690334_691243_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	33.1	1.5e-29
WP_008506131.1|691275_692508_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_008936018.1|693118_694138_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_015799671.1|694193_694835_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008506137.1|695044_697000_-	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.9	3.7e-73
WP_153527204.1|697369_698110_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_082253233.1|698408_698807_+	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
WP_002964497.1|698807_699929_-	AAA family ATPase	NA	A0A291LA07	Bordetella_phage	53.2	5.1e-104
WP_009365295.1|700108_700681_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002964499.1|700699_702523_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	32.0	1.6e-54
WP_153527206.1|702770_703703_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_008506152.1|703720_704620_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_153527208.1|704654_705836_-	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
WP_153527210.1|705965_707540_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.0	1.6e-23
WP_002964504.1|707865_708051_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_009365290.1|708070_708973_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_153527212.1|708972_710127_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_153527214.1|710251_710770_-	diacylglycerol kinase	NA	A0A1B2IBQ4	Erwinia_phage	45.2	1.4e-27
WP_153527216.1|710772_711567_-	thymidylate synthase	NA	E5DV96	Deep-sea_thermophilic_phage	64.8	1.5e-102
WP_002964509.1|711667_711979_-	DUF2853 family protein	NA	NA	NA	NA	NA
712523:712542	attL	GAAGCCTCCACTTCATTTCC	NA	NA	NA	NA
WP_153528002.1|712567_713275_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153527218.1|713926_714619_-|portal	phage portal protein	portal	A4JWZ9	Burkholderia_virus	38.2	4.5e-34
WP_153527220.1|714567_715149_-|portal	phage portal protein	portal	Q9XJT5	Pseudomonas_phage	30.7	6.5e-18
722888:722907	attR	GAAGCCTCCACTTCATTTCC	NA	NA	NA	NA
>prophage 6
NZ_CP045697	Brucella sp. 2280 chromosome 1, complete sequence	2268175	793486	837507	2268175	capsid,integrase,plate,transposase,tail	Ochrobactrum_phage(92.0%)	58	788447:788461	807232:807246
788447:788461	attL	TGCGCAGGGCGGCAT	NA	NA	NA	NA
WP_004689835.1|793486_794590_-	linear amide C-N hydrolase	NA	A7IWP6	Paramecium_bursaria_Chlorella_virus	32.3	4.0e-32
WP_076771428.1|794865_795669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008936088.1|795933_796431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050786311.1|797211_797742_-	helix-turn-helix transcriptional regulator	NA	A0A219VHC1	Ochrobactrum_phage	82.3	2.8e-76
WP_025199794.1|797880_798177_+	hypothetical protein	NA	A0A219VHB8	Ochrobactrum_phage	96.9	1.5e-50
WP_009365128.1|798498_798855_+	hypothetical protein	NA	A0A219VHC3	Ochrobactrum_phage	72.9	5.7e-41
WP_009365130.1|798854_799667_+	ParB/RepB/Spo0J family partition protein	NA	A0A219VHB6	Ochrobactrum_phage	76.2	9.5e-108
WP_009365131.1|799663_800128_+	hypothetical protein	NA	A0A219VHC5	Ochrobactrum_phage	96.1	5.5e-76
WP_009365132.1|800124_802137_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A219VHD4	Ochrobactrum_phage	93.0	1.3e-267
WP_138144319.1|802162_803206_+	AAA family ATPase	NA	A0A219VHC7	Ochrobactrum_phage	85.4	1.8e-164
WP_069713856.1|803202_803490_+	hypothetical protein	NA	A0A219VHD6	Ochrobactrum_phage	88.4	7.1e-42
WP_153527298.1|803486_803777_+	hypothetical protein	NA	A0A219VHD2	Ochrobactrum_phage	93.8	1.8e-45
WP_153528006.1|803799_804450_+	DUF3164 family protein	NA	A0A1B0T6G5	Thiobacimonas_phage	45.9	2.1e-41
WP_153527300.1|804459_804756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153527302.1|804752_805049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153527304.1|805039_805474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153527306.1|805470_805752_+	hypothetical protein	NA	A0A219VHC8	Ochrobactrum_phage	88.2	3.4e-41
WP_153527309.1|805748_806057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153527311.1|806053_806287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153527313.1|806283_806934_+	DUF1018 domain-containing protein	NA	A0A219VHC6	Ochrobactrum_phage	92.1	5.1e-112
WP_138144311.1|806930_807155_+	hypothetical protein	NA	A0A219VHD0	Ochrobactrum_phage	94.6	4.0e-32
WP_138144310.1|807151_807529_+	helix-turn-helix domain-containing protein	NA	A0A219VHE2	Ochrobactrum_phage	98.4	2.8e-62
807232:807246	attR	TGCGCAGGGCGGCAT	NA	NA	NA	NA
WP_153527315.1|807579_808479_+	peptidoglycan-binding protein	NA	A0A219VHE4	Ochrobactrum_phage	93.6	1.7e-158
WP_138144309.1|808475_808742_+	NAD(P)+ transhydrogenase beta chain	NA	A0A219VHD7	Ochrobactrum_phage	96.6	7.3e-41
WP_153527317.1|808738_809146_+	hypothetical protein	NA	A0A219VHE7	Ochrobactrum_phage	77.0	3.3e-45
WP_006467436.1|809120_809351_+	hypothetical protein	NA	A0A219VHE3	Ochrobactrum_phage	97.4	8.8e-35
WP_138144307.1|809347_809578_+	TraR/DksA family transcriptional regulator	NA	A0A219VHE0	Ochrobactrum_phage	90.4	1.2e-31
WP_138144306.1|809550_809928_+	DUF2730 family protein	NA	A0A219VHD8	Ochrobactrum_phage	44.8	1.7e-19
WP_138144305.1|809924_810236_+	hypothetical protein	NA	A0A219VHE1	Ochrobactrum_phage	59.8	1.0e-25
WP_138144304.1|810238_810856_+	DUF3486 family protein	NA	A0A219VH75	Ochrobactrum_phage	65.4	6.2e-67
WP_153527319.1|810852_812502_+	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	86.3	3.0e-270
WP_153528007.1|812510_814121_+	DUF935 family protein	NA	A0A219VH73	Ochrobactrum_phage	95.9	3.8e-302
WP_153527321.1|814124_815333_+	hypothetical protein	NA	A0A219VH74	Ochrobactrum_phage	91.8	4.1e-224
WP_153527322.1|815648_816746_+	hypothetical protein	NA	A0A219VH76	Ochrobactrum_phage	94.8	1.5e-185
WP_153527323.1|816742_817111_+	hypothetical protein	NA	A0A219VH82	Ochrobactrum_phage	95.1	3.1e-58
WP_153527324.1|817170_818136_+|capsid	capsid protein	capsid	A0A219VH83	Ochrobactrum_phage	95.3	1.0e-172
WP_006467425.1|818583_819003_+	DUF1320 domain-containing protein	NA	A0A219VH93	Ochrobactrum_phage	98.6	6.2e-71
WP_153527325.1|818999_819479_+	virion morphogenesis protein	NA	A0A219VH84	Ochrobactrum_phage	94.3	7.9e-78
WP_153527326.1|819475_819994_+	hypothetical protein	NA	A0A219VH99	Ochrobactrum_phage	88.4	4.8e-81
WP_153527327.1|819990_820509_+|plate	phage baseplate protein	plate	A0A219VHA3	Ochrobactrum_phage	92.4	8.5e-86
WP_153527328.1|820521_820716_+	hypothetical protein	NA	A0A219VHA0	Ochrobactrum_phage	89.1	1.3e-26
WP_006471556.1|820718_821105_+|plate	phage-related baseplate assembly protein	plate	A0A219VH96	Ochrobactrum_phage	99.2	5.4e-69
WP_153527329.1|821101_821965_+|plate	baseplate J protein	plate	A0A219VH98	Ochrobactrum_phage	74.6	1.8e-120
WP_153527330.1|821961_822768_+|tail	phage tail protein	tail	A0A219VHA2	Ochrobactrum_phage	69.1	5.0e-93
WP_069713989.1|822767_823286_+	hypothetical protein	NA	A0A219VHA4	Ochrobactrum_phage	39.5	1.1e-29
WP_153527331.1|823296_826617_+	DUF4815 domain-containing protein	NA	A0A219VHA1	Ochrobactrum_phage	71.6	0.0e+00
WP_153527332.1|827978_828440_+	hypothetical protein	NA	A0A076YJ67	Mesorhizobium_phage	37.2	2.8e-08
WP_153527333.1|828510_829314_+	glycosyl transferase	NA	A0A1S5NQ44	Burkholderia_phage	28.1	7.6e-09
WP_153527334.1|829645_830917_+|tail	phage tail protein	tail	A0A219VHA7	Ochrobactrum_phage	97.2	1.9e-232
WP_009365134.1|830929_831448_+|tail	phage tail protein	tail	A0A219VHB2	Ochrobactrum_phage	97.7	1.6e-97
WP_008506793.1|831460_831928_+	hypothetical protein	NA	A0A219VHB1	Ochrobactrum_phage	94.8	1.4e-74
WP_153527335.1|832012_834301_+|tail	phage tail tape measure protein	tail	A0A219VHB3	Ochrobactrum_phage	76.2	0.0e+00
WP_153527336.1|834301_834733_+|tail	phage tail protein	tail	A0A219VHA8	Ochrobactrum_phage	96.5	3.3e-75
WP_138144131.1|834729_834990_+|tail	phage tail protein	tail	A0A219VHB0	Ochrobactrum_phage	94.1	6.6e-39
WP_138144132.1|834989_835964_+	late control protein	NA	A0A219VHA9	Ochrobactrum_phage	94.8	8.8e-177
WP_153527337.1|835963_836251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153527338.1|836247_836568_+	hypothetical protein	NA	A0A219VHA6	Ochrobactrum_phage	90.1	8.7e-49
WP_008506794.1|836703_837507_+	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	94.4	2.3e-146
>prophage 7
NZ_CP045697	Brucella sp. 2280 chromosome 1, complete sequence	2268175	905112	998901	2268175	head,integrase,tRNA,terminase,plate,transposase,tail,holin	Rhizobium_phage(69.09%)	102	928707:928724	1003927:1003944
WP_153528009.1|905112_905592_+|tRNA	tRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_153527368.1|905701_906739_+	purine nucleoside permease	NA	NA	NA	NA	NA
WP_002964653.1|906849_907110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153527369.1|907403_908315_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_153527370.1|908348_908843_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_153527371.1|908929_909766_-	aspartyl/asparaginyl beta-hydroxylase domain-containing protein	NA	K7YFV1	Megavirus	33.2	4.5e-28
WP_008506953.1|909875_911147_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A1B0V011	Roseobacter_phage	34.4	2.5e-54
WP_002964658.1|911143_911767_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_153527372.1|911763_912429_-	DUF1285 domain-containing protein	NA	NA	NA	NA	NA
WP_002964660.1|912548_913556_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_153527373.1|913555_914488_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_153527374.1|914484_917334_+	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
WP_153527375.1|917397_919473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153527376.1|919539_920046_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_153527377.1|920349_921333_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_008506971.1|921481_922165_+	OmpW family protein	NA	NA	NA	NA	NA
WP_002971105.1|922198_922654_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_153528010.1|922762_923665_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_069714990.1|923865_925593_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002964670.1|925900_926809_-	cation transporter	NA	NA	NA	NA	NA
WP_153527378.1|927278_929474_-	anthranilate synthase component I	NA	NA	NA	NA	NA
928707:928724	attL	CTTGGCGCGCTCGACAAG	NA	NA	NA	NA
WP_002970216.1|929472_929661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002964674.1|930152_930614_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004685800.1|930754_931165_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_153527379.1|931258_932551_+	MFS transporter	NA	NA	NA	NA	NA
WP_153527380.1|932545_933511_-	methyltransferase	NA	NA	NA	NA	NA
WP_153527381.1|933516_934713_-	DUF2333 family protein	NA	NA	NA	NA	NA
WP_153527382.1|935148_936117_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_004689872.1|936204_937041_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_138144184.1|937210_938257_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	33.2	7.8e-22
WP_002964683.1|938530_939379_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	3.7e-22
WP_153527383.1|939375_940224_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.9	1.4e-08
WP_002964685.1|940229_941138_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002964686.1|941145_942153_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_008507032.1|942377_943973_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004684095.1|944956_945304_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_153527384.1|945334_946165_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_153528011.1|946386_947577_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_153527385.1|947620_947779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002964694.1|947887_948163_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_002964695.1|948365_948659_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_153528012.1|948705_949617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069714978.1|949875_950472_-	DUF1134 domain-containing protein	NA	NA	NA	NA	NA
WP_004688632.1|950884_951514_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_002964699.1|951625_952324_-	response regulator transcription factor	NA	F4YXP8	Roseobacter_phage	51.6	1.6e-15
WP_153527386.1|952854_953247_+	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_153527387.1|953355_954726_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	39.6	3.2e-84
WP_153527388.1|954886_956011_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2K9L0G1	Tupanvirus	30.8	4.2e-29
WP_008936186.1|956170_957127_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_153527389.1|957570_958050_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_153527073.1|958049_958853_-	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	87.6	2.2e-133
WP_153527075.1|958987_959248_-	DUF2312 domain-containing protein	NA	A0A240F4X4	Ochrobactrum_phage	92.9	3.1e-36
WP_153527077.1|959244_959460_-	hypothetical protein	NA	R9U2V1	Rhizobium_phage	40.6	4.7e-06
WP_153527079.1|959456_959984_-	hypothetical protein	NA	R9TP62	Rhizobium_phage	56.5	2.6e-29
WP_153527081.1|959995_961714_-	DUF2793 domain-containing protein	NA	R9U0V1	Rhizobium_phage	51.5	7.9e-112
WP_153527082.1|961716_962388_-|tail	phage tail protein I	tail	R9U468	Rhizobium_phage	68.3	6.7e-75
WP_153527084.1|962380_963514_-|plate	phage baseplate assembly protein	plate	R9U1E3	Rhizobium_phage	64.4	2.2e-126
WP_153527390.1|963506_963914_-|plate	baseplate	plate	R9U2U6	Rhizobium_phage	69.6	9.7e-53
WP_070997209.1|964021_964285_-	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	85.1	1.7e-21
WP_153527091.1|964284_964686_-	hypothetical protein	NA	R9U0U6	Rhizobium_phage	49.6	1.9e-32
WP_153527391.1|964669_965671_-	late control protein D	NA	R9U464	Rhizobium_phage	70.1	3.5e-128
WP_134789780.1|965670_965862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070997206.1|965865_966135_-	hypothetical protein	NA	R9U1D8	Rhizobium_phage	75.0	2.3e-34
WP_153527392.1|966131_966608_-	hypothetical protein	NA	R9U2U2	Rhizobium_phage	72.8	9.0e-58
WP_153527393.1|966604_969082_-	hypothetical protein	NA	R9U4C6	Rhizobium_phage	59.8	4.4e-148
WP_025200315.1|969319_969667_-	hypothetical protein	NA	R9U460	Rhizobium_phage	65.4	7.8e-35
WP_025200316.1|969709_970222_-|tail	phage major tail tube protein	tail	R9U2T4	Rhizobium_phage	89.4	1.2e-89
WP_025200317.1|970237_971500_-|tail	phage tail sheath protein	tail	R9U4C2	Rhizobium_phage	86.2	9.6e-208
WP_025200318.1|971503_971737_-	hypothetical protein	NA	R9U0U0	Rhizobium_phage	60.3	6.0e-15
WP_134789779.1|971749_972250_-	hypothetical protein	NA	R9U453	Rhizobium_phage	83.9	6.1e-73
WP_025200320.1|972240_972708_-	DUF1320 domain-containing protein	NA	R9U1C9	Rhizobium_phage	81.2	5.1e-66
WP_025200321.1|972813_973221_-	hypothetical protein	NA	R9U2T2	Rhizobium_phage	38.8	6.6e-09
WP_153527394.1|973232_974189_-	hypothetical protein	NA	R9U4B8	Rhizobium_phage	92.0	2.2e-164
WP_153527395.1|974199_974538_-	hypothetical protein	NA	R9U0T4	Rhizobium_phage	70.5	7.1e-33
WP_153528013.1|974553_975708_-	hypothetical protein	NA	R9U448	Rhizobium_phage	69.5	2.3e-139
WP_025200323.1|975966_976434_-	phage virion morphogenesis protein	NA	R9U1C4	Rhizobium_phage	67.1	1.3e-48
WP_153527396.1|976537_978070_-|head	head morphogenesis protein	head	R9U2S4	Rhizobium_phage	65.7	2.9e-198
WP_153527397.1|978123_979545_-	DUF935 family protein	NA	R9U4B4	Rhizobium_phage	82.2	7.0e-223
WP_153527398.1|979541_981197_-|terminase	phage terminase large subunit	terminase	R9U0T3	Rhizobium_phage	84.8	5.2e-278
WP_025200327.1|981193_981697_-	DUF1804 family protein	NA	R9U444	Rhizobium_phage	84.9	1.4e-72
WP_025200328.1|981696_982032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153527399.1|982028_982436_-	hypothetical protein	NA	R9U2R8	Rhizobium_phage	81.5	1.0e-57
WP_025200330.1|982435_983284_-	hypothetical protein	NA	R9U4A9	Rhizobium_phage	77.5	9.2e-122
WP_076781167.1|983365_983752_-	helix-turn-helix domain-containing protein	NA	R9U0S8	Rhizobium_phage	76.2	1.5e-47
WP_025200332.1|983832_984159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153527400.1|984161_984554_-	DUF1018 domain-containing protein	NA	F8TVB3	EBPR_siphovirus	56.6	8.8e-35
WP_153527401.1|984550_985234_-	DUF2786 domain-containing protein	NA	A0A219VHD3	Ochrobactrum_phage	48.7	5.4e-48
WP_025200335.1|985230_985518_-	hypothetical protein	NA	A0A219VHC8	Ochrobactrum_phage	62.0	9.0e-29
WP_025200336.1|985604_986138_-	nuclease inhibitor	NA	R9U434	Rhizobium_phage	59.0	1.7e-52
WP_025200337.1|986163_986436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025200338.1|986425_986656_-	hypothetical protein	NA	R9U2R2	Rhizobium_phage	71.7	4.5e-15
WP_153528014.1|986645_987008_-	MarR family transcriptional regulator	NA	R9U499	Rhizobium_phage	62.6	8.7e-37
WP_025200340.1|987013_987613_-	hypothetical protein	NA	G8GWC2	Rhodobacter_phage	39.4	2.9e-29
WP_153527402.1|987612_988380_-	AAA family ATPase	NA	R9U430	Rhizobium_phage	66.8	2.1e-96
WP_153527403.1|988408_990670_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	R9U1A8	Rhizobium_phage	73.6	0.0e+00
WP_025200343.1|990666_991134_-	hypothetical protein	NA	R9U2Q7	Rhizobium_phage	79.4	3.1e-63
WP_153527158.1|991136_992120_-	chromosome partitioning protein ParB	NA	R9U496	Rhizobium_phage	56.4	1.2e-83
WP_153527160.1|992116_992269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081456475.1|992268_992820_-	hypothetical protein	NA	R9U1A5	Rhizobium_phage	74.7	3.5e-37
WP_153527404.1|992666_993419_+	transcriptional regulator	NA	G8GWB1	Rhodobacter_phage	38.8	7.1e-33
WP_153527405.1|994153_994894_-	methyltransferase domain-containing protein	NA	A0A219VHB4	Ochrobactrum_phage	85.4	7.3e-123
WP_153527406.1|995790_998901_+	PAS domain S-box protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.8	7.3e-23
1003927:1003944	attR	CTTGTCGAGCGCGCCAAG	NA	NA	NA	NA
>prophage 8
NZ_CP045697	Brucella sp. 2280 chromosome 1, complete sequence	2268175	1817098	1833176	2268175	head,capsid,integrase,terminase,protease,portal,tail	uncultured_Caudovirales_phage(18.18%)	25	1816994:1817042	1835464:1835512
1816994:1817042	attL	ATGGTGCCCGGAGGCGGATTCGAACCACCGACACGCGGATTTTCAATCC	NA	NA	NA	NA
WP_153527773.1|1817098_1818337_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JCB7	uncultured_Caudovirales_phage	26.1	2.8e-18
WP_153527774.1|1818339_1818783_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_153527775.1|1818895_1819084_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_153527776.1|1819080_1819590_+	hypothetical protein	NA	A0A141GEX9	Brucella_phage	44.7	2.5e-26
WP_153527777.1|1819589_1820195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153527778.1|1821028_1821325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153527779.1|1821572_1821764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153527780.1|1821757_1822057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153527781.1|1822053_1822350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153527782.1|1822346_1822604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153527783.1|1822671_1823895_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	26.6	1.1e-22
WP_153527784.1|1823884_1824274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153527785.1|1824273_1824777_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PIR7	Moraxella_phage	40.1	1.0e-19
WP_153527786.1|1824778_1825987_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	35.8	2.2e-52
WP_153527787.1|1825999_1826389_+	hypothetical protein	NA	A0A193GYY3	Enterobacter_phage	34.5	1.2e-07
WP_153527788.1|1826390_1826747_+	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	53.8	6.3e-16
WP_153527789.1|1826750_1827230_+	hypothetical protein	NA	A0A2H4JDL7	uncultured_Caudovirales_phage	34.6	2.8e-14
WP_153527790.1|1827233_1827701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153527791.1|1827810_1828131_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_153527792.1|1828130_1828550_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_153527793.1|1828546_1828960_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_153527794.1|1828956_1829271_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_029924572.1|1829267_1829642_+|terminase	phage terminase small subunit P27 family	terminase	Q6DMU4	Streptococcus_phage	30.7	9.7e-07
WP_153527795.1|1829607_1831218_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	35.2	5.3e-78
WP_153527796.1|1831217_1833176_+	hypothetical protein	NA	A0A291AUM6	Sinorhizobium_phage	33.7	3.6e-60
1835464:1835512	attR	ATGGTGCCCGGAGGCGGATTCGAACCACCGACACGCGGATTTTCAATCC	NA	NA	NA	NA
>prophage 1
NZ_CP045698	Brucella sp. 2280 chromosome 2, complete sequence	1316279	49159	126529	1316279	portal,transposase,terminase,capsid,tail,head,plate,protease	Rhizobium_phage(33.33%)	80	NA	NA
WP_153528655.1|49159_49993_-	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	75.8	1.3e-120
WP_153528055.1|50274_50466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070999525.1|50676_50982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070999129.1|51495_52041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083262164.1|52112_52355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069714048.1|52460_52727_-	hypothetical protein	NA	A0A141GEZ0	Brucella_phage	55.7	1.9e-12
WP_069714049.1|52710_52938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153528056.1|52937_53591_-	hypothetical protein	NA	L7TLM2	Rhizobium_phage	45.7	6.4e-30
WP_153528057.1|54772_54994_-|tail	phage tail protein	tail	A0A0A8IL62	Aurantimonas_phage	40.0	7.4e-07
WP_153528656.1|55004_55439_-|tail	phage tail protein	tail	A0A0A8IL04	Aurantimonas_phage	42.4	4.8e-26
WP_153528058.1|55438_57550_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	28.9	6.9e-33
WP_153528059.1|57828_58188_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_025089776.1|58162_58675_-	hypothetical protein	NA	A0A0A8ILB8	Aurantimonas_phage	59.9	2.2e-54
WP_153528060.1|58710_59934_-|tail	phage tail protein	tail	A0A0A8IL59	Aurantimonas_phage	56.4	1.9e-123
WP_153528061.1|60051_60558_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_153528062.1|60592_62656_-	hypothetical protein	NA	A0A0H4IPB2	Stenotrophomonas_phage	28.0	6.7e-09
WP_153528063.1|62657_62843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153528064.1|62904_65190_-	hypothetical protein	NA	A0A0A8ILB4	Aurantimonas_phage	26.9	5.3e-63
WP_153528065.1|65186_66464_-|tail	phage tail protein I	tail	A4PE44	Ralstonia_virus	37.1	9.6e-06
WP_153528066.1|66460_67372_-	hypothetical protein	NA	D5LGZ3	Escherichia_phage	37.3	6.3e-44
WP_153528067.1|67368_67770_-	hypothetical protein	NA	A0A0A8IN57	Aurantimonas_phage	49.2	1.9e-24
WP_153528657.1|67780_68299_-|plate	baseplate assembly protein	plate	A0A0A8IL55	Aurantimonas_phage	49.7	8.3e-33
WP_153528068.1|68298_69117_-	hypothetical protein	NA	A0A0A8IKZ7	Aurantimonas_phage	42.1	1.4e-45
WP_153528069.1|69119_69524_-	hypothetical protein	NA	A0A0A8IN54	Aurantimonas_phage	41.7	7.5e-13
WP_153528070.1|69520_70087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153528071.1|70154_71165_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	40.5	1.0e-58
WP_153528072.1|71177_71561_-|head	head decoration protein	head	R9TP46	Rhizobium_phage	35.3	5.2e-08
WP_153528073.1|71573_72614_-|protease	Clp protease ClpP	protease	R9TQF0	Rhizobium_phage	50.6	1.0e-69
WP_070999134.1|72633_72891_-	hypothetical protein	NA	A0A068CH50	Rhizobium_phage	33.0	3.0e-07
WP_153528074.1|72887_74501_-|portal	phage portal protein	portal	A0A068CC70	Rhizobium_phage	51.6	8.3e-156
WP_153528075.1|74497_76600_-|terminase	terminase	terminase	G8DH41	Emiliania_huxleyi_virus	33.8	4.5e-101
WP_153528076.1|76596_77214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153528077.1|77363_77936_-	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	48.9	1.1e-36
WP_153528078.1|78039_78879_-	hypothetical protein	NA	R9TRT9	Rhizobium_phage	34.6	1.3e-35
WP_153528079.1|79226_81032_-	DNA primase	NA	A0A0A8IN90	Aurantimonas_phage	29.6	6.2e-51
WP_153528080.1|81028_82243_-	P4 alpha zinc-binding domain-containing protein	NA	R9TNC4	Rhizobium_phage	46.5	3.7e-92
WP_153528081.1|82239_83031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153528082.1|83027_83213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153528083.1|83209_85141_-	C-5 cytosine-specific DNA methylase	NA	R9TP91	Rhizobium_phage	61.9	5.2e-245
WP_153528084.1|85137_85383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153528085.1|85379_85622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153528086.1|86987_87491_-	hypothetical protein	NA	A0A068CCD6	Rhizobium_phage	47.8	6.8e-32
WP_153528087.1|87594_88152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083331559.1|88148_88376_-	CI repressor	NA	W6MWX8	Pseudomonas_phage	60.0	4.0e-08
WP_153528658.1|88450_89152_+	helix-turn-helix domain-containing protein	NA	R9TRS6	Rhizobium_phage	32.5	3.8e-12
WP_153528088.1|89570_90143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153528089.1|90219_90852_+	hypothetical protein	NA	R9TQJ1	Rhizobium_phage	41.8	3.5e-33
WP_153528090.1|90797_91343_+	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	46.2	1.0e-33
WP_070999528.1|91377_91734_+	hypothetical protein	NA	A0A0A8ILD6	Aurantimonas_phage	52.7	5.9e-22
WP_153528091.1|91758_92715_+	DUF2303 family protein	NA	R9TSA8	Rhizobium_phage	46.3	5.4e-70
WP_153528092.1|92681_93836_+	DNA polymerase III subunit beta	NA	A0A0A8IL17	Aurantimonas_phage	42.6	5.3e-72
WP_070999175.1|94015_94222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070999177.1|94211_94616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153528093.1|94608_95718_+	DUF5131 family protein	NA	R9TNA8	Rhizobium_phage	60.0	2.1e-126
WP_070999181.1|95710_95890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153528094.1|96086_97331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002966536.1|97565_97928_-	response regulator	NA	NA	NA	NA	NA
WP_153528095.1|98246_99137_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_153528096.1|99297_100074_+	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_153528097.1|100125_101121_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_153528659.1|101915_102650_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_009363975.1|102655_103525_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_153528098.1|103539_103863_+	DUF1634 domain-containing protein	NA	NA	NA	NA	NA
WP_153527652.1|105075_106575_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.2	3.1e-19
WP_151653755.1|106576_107311_+|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	32.1	2.9e-31
WP_153528099.1|107872_109387_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_153528660.1|109408_110446_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_153528100.1|110453_111206_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	35.5	2.2e-18
WP_153528661.1|111222_112368_-	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
WP_153528101.1|112645_114115_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_153528102.1|114119_115640_+	xylulokinase	NA	NA	NA	NA	NA
WP_153528103.1|115676_116333_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_153528104.1|116361_117207_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_153528105.1|117267_117972_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_153528106.1|118158_119241_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_153528107.1|119325_120852_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	28.3	1.2e-15
WP_078341188.1|120880_121879_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_153528108.1|121914_123621_+	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_151653755.1|124293_125028_-|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	32.1	2.9e-31
WP_153527652.1|125029_126529_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.2	3.1e-19
>prophage 2
NZ_CP045698	Brucella sp. 2280 chromosome 2, complete sequence	1316279	601269	612586	1316279		Pseudomonas_phage(12.5%)	14	NA	NA
WP_153528316.1|601269_601962_-	DNA polymerase III subunit epsilon	NA	A0A2H4P776	Pseudomonas_phage	30.0	5.8e-05
WP_002969331.1|602022_602220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008510705.1|602366_602555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002971236.1|602699_603005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153528317.1|603145_603523_+	endonuclease V	NA	F4YXR7	Roseobacter_phage	64.2	2.0e-36
WP_153528318.1|604427_605147_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.7	1.2e-10
WP_153528319.1|605276_605462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153528320.1|605721_606018_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	40.0	3.3e-10
WP_153528321.1|606030_606312_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	44.6	5.9e-09
WP_153528322.1|607028_609218_-	alkaline phosphatase	NA	M4SLV1	Cyanophage	47.6	3.6e-93
WP_153528323.1|609390_610731_-	DNA polymerase IV	NA	A0A218MNF2	uncultured_virus	24.0	9.4e-20
WP_009364284.1|611181_611691_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002966021.1|611746_612034_-	DUF3572 domain-containing protein	NA	NA	NA	NA	NA
WP_002966022.1|612214_612586_+	response regulator	NA	B5LWN0	Feldmannia_species_virus	30.5	3.1e-05
>prophage 3
NZ_CP045698	Brucella sp. 2280 chromosome 2, complete sequence	1316279	638861	647567	1316279	integrase,transposase	Brucella_phage(57.14%)	10	630063:630077	647449:647463
630063:630077	attL	CCAAGGCCATTACCG	NA	NA	NA	NA
WP_153528674.1|638861_639779_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141GEZ3	Brucella_phage	39.9	1.9e-48
WP_153528337.1|640270_640513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153528338.1|640509_640854_-	hypothetical protein	NA	A0A141GEZ9	Brucella_phage	72.0	1.1e-17
WP_153528339.1|640850_641027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153527272.1|641159_642362_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	2.4e-43
WP_153528340.1|642248_643004_-	DUF3850 domain-containing protein	NA	A0A141GF03	Brucella_phage	57.7	8.8e-07
WP_153528341.1|643488_643884_-|transposase	transposase	transposase	A0A059NT77	Lactococcus_phage	34.6	3.4e-18
WP_153528342.1|645419_645602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153528343.1|645629_646724_-	acyltransferase family protein	NA	A0A1R3Y5Q6	Salmonella_virus	26.6	5.3e-05
WP_153528344.1|646883_647567_+	glycoside hydrolase family protein	NA	A0A141GEY9	Brucella_phage	94.7	2.6e-106
647449:647463	attR	CCAAGGCCATTACCG	NA	NA	NA	NA
