The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045087	Burkholderia glumae strain GX chromosome 1, complete sequence	3712850	291676	381271	3712850	transposase,tRNA,integrase,protease	uncultured_Mediterranean_phage(10.71%)	84	320365:320387	369264:369286
WP_012734406.1|291676_292405_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012734407.1|292674_297375_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
WP_017922999.1|297479_298946_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_012734409.1|299036_300785_-	ABC transporter ATP-binding protein/permease	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	29.0	8.5e-05
WP_012734410.1|301501_302668_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012734411.1|302696_302894_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_012734412.1|302942_303758_+	thiazole synthase	NA	NA	NA	NA	NA
WP_100556277.1|303754_304852_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_012734414.1|305156_305975_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	4.0e-21
WP_012734415.1|305971_306739_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_012734416.1|306755_307262_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_012734417.1|307326_308313_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_012734418.1|308420_309047_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012734419.1|309043_309313_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_020381404.1|309494_310421_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.8e-22
WP_012734421.1|310417_311173_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_012734422.1|311196_311436_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_012734423.1|311452_312799_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_012734424.1|312795_313452_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_012734425.1|313492_314818_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_012734426.1|314968_316039_+	histidinol-phosphate transaminase	NA	A0A1X7BZP2	Faustovirus	24.3	1.7e-11
WP_012734427.1|316114_316702_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_012734428.1|316799_317420_+	NAAT family transporter	NA	NA	NA	NA	NA
WP_012734429.1|317416_318058_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_012734430.1|318222_318978_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_012734431.1|319062_319836_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_012734432.1|319838_320258_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_153477202.1|320254_320620_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
320365:320387	attL	CGACGCGGTGCTCAAGAAGATCG	NA	NA	NA	NA
WP_012734434.1|320666_321083_+	membrane protein	NA	NA	NA	NA	NA
WP_153477203.1|321114_321480_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_012734436.1|321602_321836_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_012734437.1|321862_322405_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_012734438.1|322458_323241_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	31.3	1.6e-27
WP_012734439.1|323553_324759_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.3	3.2e-11
WP_012734440.1|324780_325527_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_012734441.1|325746_326367_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_012734442.1|326366_327749_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_012734443.1|327771_328530_+	cytochrome c1	NA	NA	NA	NA	NA
WP_012734444.1|328626_329238_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_012734445.1|329301_329820_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	48.6	1.2e-20
WP_017424055.1|329990_331019_-|integrase	tyrosine-type recombinase/integrase	integrase	E5E3T0	Burkholderia_phage	99.4	1.0e-191
WP_034176285.1|331018_331297_-	DUF4224 domain-containing protein	NA	E5E3T1	Burkholderia_phage	97.7	8.1e-43
WP_153477204.1|334655_334952_-	hypothetical protein	NA	A0A2D1GNL7	Pseudomonas_phage	36.0	2.8e-09
WP_153477205.1|335519_336776_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	26.2	3.6e-21
WP_153478157.1|336778_337396_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_153477206.1|337715_337934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153477207.1|337896_339090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153477208.1|339733_339982_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.5	2.3e-20
WP_015877613.1|340118_341165_+|transposase	IS481-like element IS1419 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	73.9	7.1e-148
WP_153477209.1|343430_344687_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	33.5	1.5e-48
WP_012732871.1|344683_345550_+	ATPase AAA	NA	U5N3V8	Enterobacteria_phage	44.1	2.8e-49
WP_153477210.1|345627_345843_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_153477211.1|345911_346958_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	73.3	1.1e-148
WP_153477212.1|347049_348221_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	61.5	1.8e-91
WP_153477213.1|348450_348642_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	58.6	5.2e-17
WP_153477214.1|348656_351143_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	37.0	8.1e-25
WP_153477215.1|351214_352495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153478158.1|352566_355002_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	34.3	1.5e-39
WP_153477216.1|355013_356342_+	2-keto-D-gluconate dehydrogenase	NA	NA	NA	NA	NA
WP_012732738.1|356832_357852_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_153477217.1|358327_359878_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	54.4	4.2e-157
WP_006400877.1|359893_360643_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	61.2	1.8e-81
WP_012734051.1|361481_361958_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012732753.1|361933_362284_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_012732752.1|362315_363872_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.1e-67
WP_153477218.1|363823_364924_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_153477219.1|364924_365230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015877104.1|365777_366035_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_006398175.1|366383_366722_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_035981926.1|366772_368239_+	ammonium transporter	NA	NA	NA	NA	NA
WP_015877102.1|368493_369783_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
369264:369286	attR	CGACGCGGTGCTCAAGAAGATCG	NA	NA	NA	NA
WP_017923398.1|369854_370811_+	glutathione synthase	NA	NA	NA	NA	NA
WP_015877100.1|371047_371518_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_015877099.1|371603_371873_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_015877098.1|372095_373868_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.4	1.5e-12
WP_015877097.1|374003_374756_-	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SCZ9	Indivirus	31.7	2.5e-06
WP_015877096.1|374919_376476_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_015877095.1|376778_377525_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_015877094.1|377660_378068_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_015877093.1|378079_378340_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	44.9	2.6e-11
WP_015877092.1|378463_378949_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_015877091.1|378975_379974_+	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017924300.1|380216_380738_+	O-acetyl-ADP-ribose deacetylase	NA	F1SVT2	Red_sea_bream_iridovirus	50.6	4.4e-34
WP_015877089.1|380800_381271_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP045087	Burkholderia glumae strain GX chromosome 1, complete sequence	3712850	735950	743483	3712850	protease	Bacillus_thuringiensis_phage(16.67%)	7	NA	NA
WP_015876803.1|735950_736316_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	29.8	1.2e-06
WP_153477277.1|736395_738000_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_004196460.1|738123_738327_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_015876801.1|738856_739171_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	43.4	7.6e-13
WP_015876800.1|739167_741465_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.4e-169
WP_015876799.1|741741_742188_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	63.7	6.7e-47
WP_015876798.1|742271_743483_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.1	6.3e-39
>prophage 3
NZ_CP045087	Burkholderia glumae strain GX chromosome 1, complete sequence	3712850	810628	877471	3712850	transposase,tRNA,integrase,protease	Escherichia_phage(21.43%)	59	847601:847617	878794:878810
WP_100556004.1|810628_812785_-|tRNA	methionine--tRNA ligase	tRNA	K7Y9Y6	Megavirus	27.7	3.8e-47
WP_153477286.1|812949_813156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477287.1|813279_813939_-	OmpA family protein	NA	NA	NA	NA	NA
WP_017923651.1|814272_815361_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_015876725.1|815486_816014_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_015876724.1|816124_816694_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	1.7e-71
WP_015876723.1|816782_819062_+	arginine/lysine/ornithine decarboxylase	NA	NA	NA	NA	NA
WP_017423934.1|819082_819790_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_015876721.1|819895_821302_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_015876720.1|821473_822304_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015876719.1|822554_825650_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_153477288.1|825843_826812_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_035980043.1|829086_830277_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_015876715.1|830349_831654_-	MFS transporter	NA	NA	NA	NA	NA
WP_015876714.1|831765_832524_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015876713.1|832598_834038_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_015876712.1|834263_834791_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.8	5.8e-50
WP_015876710.1|835421_836600_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_015876709.1|836702_838388_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.5	3.3e-94
WP_013699037.1|838441_838780_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_017423148.1|838941_840036_-	porin	NA	NA	NA	NA	NA
WP_153477289.1|840819_841866_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	73.9	9.9e-150
WP_043307663.1|841983_842763_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	3.3e-17
WP_015876706.1|842781_843495_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015876705.1|843491_844181_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015876704.1|844361_845138_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015876703.1|845517_846072_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_015876702.1|846304_847030_+	response regulator	NA	W8CYM9	Bacillus_phage	35.4	3.2e-30
WP_015876701.1|847013_848327_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
847601:847617	attL	GCGCGAGCTGCGCCAGC	NA	NA	NA	NA
WP_015876700.1|848391_848658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876699.1|849157_850912_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_015876698.1|850934_852260_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.1	1.3e-32
WP_015876697.1|852324_852822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876696.1|852818_853454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876695.1|853712_853910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015876694.1|854092_855511_+	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_015876693.1|855503_856151_+	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	61.3	1.2e-23
WP_017433512.1|856169_857540_-	MFS transporter	NA	NA	NA	NA	NA
WP_017923656.1|857674_858178_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_017924830.1|858368_858749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876689.1|858933_859293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015876687.1|860215_860755_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_045678837.1|860792_861983_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_015876685.1|862077_862287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876684.1|862408_862678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017433131.1|862789_863170_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_035979006.1|863479_863830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477290.1|863927_865586_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_153477291.1|866013_867639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153477292.1|868219_868621_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153477293.1|868679_869063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012732721.1|869374_870880_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_012732720.1|870872_871670_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	37.7	4.4e-33
WP_153477294.1|871729_872287_+	hypothetical protein	NA	Q775E2	Bordetella_phage	62.6	8.9e-41
WP_035982028.1|872283_872502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477295.1|872516_872909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477296.1|873083_874130_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	73.9	7.6e-150
WP_153477297.1|874691_875891_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	44.5	1.7e-84
WP_059497642.1|876364_877471_+|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	31.3	3.5e-44
878794:878810	attR	GCGCGAGCTGCGCCAGC	NA	NA	NA	NA
>prophage 4
NZ_CP045087	Burkholderia glumae strain GX chromosome 1, complete sequence	3712850	1194924	1257642	3712850	transposase,tRNA,protease	Indivirus(13.33%)	51	NA	NA
WP_015876390.1|1194924_1195587_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_015876389.1|1195596_1196799_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015876388.1|1196872_1197433_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_015876387.1|1197477_1198380_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_015876386.1|1198482_1199628_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_015876385.1|1199632_1200406_+	MBL fold metallo-hydrolase	NA	A0A2I7SDH3	Paenibacillus_phage	35.8	1.4e-28
WP_042967767.1|1200519_1200786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085962399.1|1201015_1202179_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015876383.1|1202271_1202817_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_043307866.1|1202867_1204121_-	membrane protein	NA	NA	NA	NA	NA
WP_153477344.1|1204104_1206816_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.5	6.3e-23
WP_015876331.1|1207446_1208679_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_015876330.1|1208788_1210507_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.9	6.6e-10
WP_015876329.1|1210857_1211685_+	cytochrome c	NA	NA	NA	NA	NA
WP_015876328.1|1212093_1212927_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_015876327.1|1213468_1214494_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_015876326.1|1214816_1215437_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_039202447.1|1217100_1218171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015876324.1|1218606_1219422_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_085962366.1|1219680_1220583_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_015876322.1|1220769_1221534_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_015876321.1|1221597_1222401_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_015876320.1|1222423_1222915_-	peptidyl-prolyl cis-trans isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	29.4	1.1e-05
WP_015876319.1|1223002_1223581_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	40.7	2.2e-13
WP_085962365.1|1223640_1224507_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015876317.1|1224585_1225980_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	32.6	9.4e-39
WP_017423377.1|1227038_1228010_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017432558.1|1229838_1231089_+	aspartate kinase	NA	NA	NA	NA	NA
WP_153478177.1|1232329_1232662_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_153478178.1|1232714_1233020_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_153477345.1|1233188_1233764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012732871.1|1233950_1234817_-	ATPase AAA	NA	U5N3V8	Enterobacteria_phage	44.1	2.8e-49
WP_017432522.1|1234813_1236070_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	33.0	7.7e-48
WP_153477346.1|1236089_1236587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477348.1|1236632_1237919_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_153477350.1|1238592_1239039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477351.1|1239119_1239536_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_153477352.1|1239747_1240137_-	DUF3775 domain-containing protein	NA	NA	NA	NA	NA
WP_153477353.1|1240329_1241505_-	DUF3396 domain-containing protein	NA	E5E3X7	Burkholderia_phage	74.1	2.2e-161
WP_153477354.1|1241514_1242255_-	VRR-NUC domain-containing protein	NA	A4JWV4	Burkholderia_virus	48.5	1.5e-51
WP_153477355.1|1242251_1242773_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	63.6	3.2e-56
WP_153477356.1|1243361_1244885_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_153477357.1|1244881_1246693_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_085962356.1|1247008_1247825_+|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
WP_085962421.1|1247834_1248640_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153477358.1|1248774_1249473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477359.1|1251684_1253235_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.2	1.5e-157
WP_006400877.1|1253250_1254000_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	61.2	1.8e-81
WP_012734051.1|1255251_1255728_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012732753.1|1255703_1256054_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_012732752.1|1256085_1257642_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.1e-67
>prophage 5
NZ_CP045087	Burkholderia glumae strain GX chromosome 1, complete sequence	3712850	1638827	1647901	3712850		Burkholderia_phage(33.33%)	12	NA	NA
WP_153477451.1|1638827_1639106_-	hypothetical protein	NA	Q3HQV5	Burkholderia_phage	61.2	1.0e-21
WP_153477453.1|1639102_1639780_-	hypothetical protein	NA	O03965	Myxococcus_phage	42.7	6.2e-44
WP_153477455.1|1639776_1639974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153477456.1|1639970_1640999_-	DUF5131 family protein	NA	Q8W6R4	Burkholderia_virus	55.8	2.3e-95
WP_153477458.1|1640995_1642126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153477460.1|1642318_1643011_-	hypothetical protein	NA	Q6JII4	Burkholderia_virus	50.6	9.4e-56
WP_153477462.1|1643112_1643394_-	hypothetical protein	NA	A9YX18	Burkholderia_phage	77.8	1.2e-14
WP_153477463.1|1643360_1643792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153477465.1|1643788_1645558_-	AAA family ATPase	NA	J7HXJ7	Pseudomonas_phage	37.3	3.7e-80
WP_153477467.1|1645572_1646766_-	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	52.4	1.2e-66
WP_153477469.1|1646777_1647587_-	PD-(D/E)XK nuclease family protein	NA	J7HXJ4	Pseudomonas_phage	55.6	2.1e-83
WP_015875567.1|1647583_1647901_-	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	71.7	4.2e-35
>prophage 6
NZ_CP045087	Burkholderia glumae strain GX chromosome 1, complete sequence	3712850	1651216	1691715	3712850	tail,terminase,head	Burkholderia_phage(57.5%)	52	NA	NA
WP_153477475.1|1651216_1652509_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	66.7	6.5e-151
WP_153477477.1|1652651_1653545_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	71.3	2.0e-122
WP_153477479.1|1653566_1653977_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	48.1	1.2e-13
WP_153477481.1|1654059_1654302_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	47.9	8.4e-12
WP_153477482.1|1654434_1654911_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	39.0	2.1e-22
WP_052231196.1|1655025_1655616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477484.1|1655924_1656299_+	hypothetical protein	NA	A9YWX9	Burkholderia_phage	73.4	1.9e-47
WP_153477486.1|1656295_1656523_+	hypothetical protein	NA	A9YWY0	Burkholderia_phage	68.5	2.9e-22
WP_153477488.1|1656690_1658595_+	DNA cytosine methyltransferase	NA	Q9ZXI4	Pseudomonas_virus	60.3	1.5e-172
WP_153477490.1|1658591_1659461_+	hypothetical protein	NA	A9YWY3	Burkholderia_phage	70.6	5.6e-114
WP_153477491.1|1659457_1659934_+	hypothetical protein	NA	Q6JIG5	Burkholderia_virus	77.7	9.0e-66
WP_153477493.1|1659930_1661058_+	site-specific DNA-methyltransferase	NA	Q8W6P4	Burkholderia_virus	62.7	1.0e-131
WP_153478187.1|1661783_1662203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477495.1|1662199_1662394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477496.1|1662390_1662861_+	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	70.7	1.8e-50
WP_153477498.1|1662870_1663200_+	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	71.0	4.6e-29
WP_153477500.1|1663196_1663889_+	hypothetical protein	NA	Q6JIF4	Burkholderia_virus	35.9	7.7e-26
WP_153477501.1|1663980_1664244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477503.1|1664508_1664892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153478189.1|1665008_1665608_+	hypothetical protein	NA	A9YWZ4	Burkholderia_phage	81.4	1.2e-94
WP_153477505.1|1665611_1666295_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	36.9	8.7e-30
WP_153477507.1|1666347_1666827_+	DUF2280 domain-containing protein	NA	A9YWZ5	Burkholderia_phage	70.4	1.8e-53
WP_153477509.1|1666777_1668334_+|terminase	phage terminase large subunit	terminase	W8VT11	Pseudomonas_phage	45.7	7.4e-109
WP_153477511.1|1668355_1669822_+	DUF1073 domain-containing protein	NA	A9YWZ7	Burkholderia_phage	80.6	2.2e-227
WP_153477513.1|1669818_1670574_+|head	phage head morphogenesis protein	head	A9YWZ8	Burkholderia_phage	66.7	3.8e-87
WP_153477514.1|1670576_1670870_+	ammonia monooxygenase	NA	A9YWZ9	Burkholderia_phage	65.3	5.0e-35
WP_153478191.1|1671024_1671414_+	hypothetical protein	NA	A9YX01	Burkholderia_phage	51.2	2.4e-32
WP_153478193.1|1671562_1673026_+	DUF2213 domain-containing protein	NA	A9YX03	Burkholderia_phage	69.7	3.3e-167
WP_017424288.1|1673035_1673551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477516.1|1673625_1674726_+	DUF2184 domain-containing protein	NA	A9YX23	Burkholderia_phage	82.4	2.4e-146
WP_153477518.1|1674727_1675186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017424285.1|1675247_1675631_+	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	74.0	2.3e-48
WP_100555587.1|1675656_1676244_+	hypothetical protein	NA	A9YX26	Burkholderia_phage	51.6	8.0e-40
WP_015875598.1|1676305_1676689_+	hypothetical protein	NA	A9YX28	Burkholderia_phage	79.2	5.9e-52
WP_017424284.1|1676685_1677276_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	75.9	1.1e-81
WP_017424283.1|1677284_1679096_+	DUF3383 family protein	NA	A0A0P0I492	Acinetobacter_phage	37.5	4.0e-90
WP_017424282.1|1679111_1679552_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	58.2	2.2e-42
WP_017424281.1|1679551_1680004_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	33.8	1.8e-15
WP_017424280.1|1680178_1682071_+	glucosaminidase	NA	B2ZYI5	Ralstonia_phage	36.5	1.6e-25
WP_017424279.1|1682067_1682673_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	39.9	1.9e-20
WP_017424278.1|1682672_1682984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100555588.1|1682993_1683965_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	57.2	7.1e-94
WP_153477520.1|1683961_1684327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017424277.1|1684338_1685124_+	hypothetical protein	NA	A9YX06	Burkholderia_phage	55.9	4.6e-75
WP_017424276.1|1685184_1685538_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	71.8	1.3e-40
WP_017424275.1|1685534_1686722_+	hypothetical protein	NA	A9YX12	Burkholderia_phage	68.3	1.7e-142
WP_153477522.1|1686727_1687444_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	67.7	6.0e-82
WP_153477524.1|1687472_1688489_+|tail	phage tail protein	tail	A9YX14	Burkholderia_phage	45.9	8.7e-18
WP_153477526.1|1688501_1688732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477528.1|1688744_1690700_+	transporter	NA	NA	NA	NA	NA
WP_039203325.1|1690759_1691143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039203323.1|1691148_1691715_+	lysozyme	NA	A0A059VA40	Pseudomonas_phage	46.7	1.6e-32
>prophage 7
NZ_CP045087	Burkholderia glumae strain GX chromosome 1, complete sequence	3712850	1850070	1875953	3712850	terminase,plate,capsid,tail,transposase,head,portal	Burkholderia_phage(93.1%)	34	NA	NA
WP_017433119.1|1850070_1850298_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015875735.1|1850350_1850680_-	helix-turn-helix domain-containing protein	NA	R4JEU7	Burkholderia_phage	57.8	2.3e-28
WP_015875738.1|1851980_1852160_+	hypothetical protein	NA	R4JEN9	Burkholderia_phage	76.3	6.0e-15
WP_015875739.1|1852156_1852387_+	hypothetical protein	NA	R4JJR9	Burkholderia_phage	93.4	1.5e-34
WP_015875740.1|1852383_1853289_+	DNA adenine methylase	NA	R4JMC6	Burkholderia_phage	94.7	6.5e-166
WP_015875741.1|1853290_1853506_+	hypothetical protein	NA	R4JG87	Burkholderia_phage	80.3	5.5e-23
WP_153477595.1|1853696_1855604_+	replication endonuclease	NA	A4JWW0	Burkholderia_virus	72.5	1.7e-256
WP_043307766.1|1855630_1855879_+	ogr/delta-like zinc finger family protein	NA	R4JMD0	Burkholderia_phage	91.5	1.4e-38
WP_015875745.1|1855880_1856162_+	ogr/Delta-like zinc finger family protein	NA	R4JG92	Burkholderia_phage	91.4	1.6e-46
WP_015875746.1|1856158_1857106_+	ParB-like partition protein	NA	R4JDJ1	Burkholderia_phage	89.8	3.0e-145
WP_148270991.1|1857313_1858357_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015875748.1|1858417_1858777_-	type II toxin-antitoxin system HicB family antitoxin	NA	R4JJS9	Burkholderia_phage	89.1	6.3e-56
WP_015875749.1|1858773_1859028_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	100.0	1.6e-42
WP_148270992.1|1859458_1860415_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	35.1	1.0e-39
WP_015875751.1|1860463_1861396_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_015875752.1|1861450_1862506_-|portal	phage portal protein	portal	R4JG97	Burkholderia_phage	98.8	7.6e-142
WP_153477597.1|1862505_1864323_-|terminase	terminase	terminase	R4JDJ3	Burkholderia_phage	96.5	0.0e+00
WP_015875754.1|1864477_1865350_+|capsid	phage capsid scaffolding protein	capsid	R4JEQ3	Burkholderia_phage	75.3	7.0e-117
WP_015875757.1|1866607_1867108_+|head	head completion/stabilization protein	head	R4JGC6	Burkholderia_phage	98.2	7.4e-87
WP_015875758.1|1867107_1867314_+|tail	tail protein	tail	R4JDL4	Burkholderia_phage	98.5	1.5e-33
WP_015875759.1|1867321_1867765_+	hypothetical protein	NA	R4JES4	Burkholderia_phage	98.0	1.2e-75
WP_015875760.1|1867752_1868157_+	hypothetical protein	NA	R4JJW4	Burkholderia_phage	100.0	1.0e-62
WP_015875761.1|1868192_1868642_+	DUF882 domain-containing protein	NA	R4JMG7	Burkholderia_phage	98.0	1.5e-75
WP_015875762.1|1868638_1869079_+	protein lysB	NA	R4JGE0	Burkholderia_phage	99.3	5.5e-70
WP_050811399.1|1869121_1869682_+|tail	phage tail protein	tail	R4JET5	Burkholderia_phage	98.4	7.2e-99
WP_015875764.1|1869678_1870152_+	phage virion morphogenesis protein	NA	R4JJX8	Burkholderia_phage	97.5	1.8e-79
WP_015875765.1|1870284_1871001_+|plate	phage baseplate assembly protein V	plate	R4JMH2	Burkholderia_phage	95.8	2.4e-123
WP_153477599.1|1871258_1872170_+	phage late control D family protein	NA	R4JDM6	Burkholderia_phage	98.7	1.3e-169
WP_148270994.1|1872260_1872611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148270995.1|1872706_1873339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015875779.1|1873382_1873721_-	hypothetical protein	NA	R4JEU5	Burkholderia_phage	91.1	3.1e-52
WP_015875780.1|1873720_1874341_-	hypothetical protein	NA	R4JJZ3	Burkholderia_phage	100.0	1.1e-119
WP_015875781.1|1874344_1874899_-	PAAR domain-containing protein	NA	R4JMI1	Burkholderia_phage	92.4	5.5e-99
WP_153477601.1|1875425_1875953_-|transposase	IS21 family transposase	transposase	R4JDM9	Burkholderia_phage	96.6	7.8e-95
>prophage 8
NZ_CP045087	Burkholderia glumae strain GX chromosome 1, complete sequence	3712850	2014541	2067384	3712850	transposase,tRNA	Burkholderia_phage(20.0%)	37	NA	NA
WP_015875901.1|2014541_2015552_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_088499465.1|2016075_2017917_-	transporter	NA	NA	NA	NA	NA
WP_017432901.1|2018747_2020220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153477629.1|2021508_2022325_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_006400877.1|2022639_2023389_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	61.2	1.8e-81
WP_012732738.1|2025428_2026448_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012734051.1|2027580_2028057_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012732753.1|2028032_2028383_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_015875907.1|2031282_2032899_-	amino acid adenylation domain-containing protein	NA	NA	NA	NA	NA
WP_015875908.1|2032895_2033849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015875909.1|2033914_2036188_-	N,N-dimethylformamidase large subunit	NA	NA	NA	NA	NA
WP_015875910.1|2036184_2037888_-	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.1	2.0e-22
WP_080569301.1|2037924_2039223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017433090.1|2039137_2039425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080763615.1|2039460_2040480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015875913.1|2040492_2041485_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	83.3	1.5e-152
WP_017432258.1|2041897_2042953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015875914.1|2042922_2043936_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_015875915.1|2044743_2045682_-	nucleoside-diphosphate kinase	NA	NA	NA	NA	NA
WP_015875916.1|2045703_2046891_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_015875917.1|2046992_2047967_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_015875918.1|2047992_2049231_-	oxidoreductase-like protein	NA	NA	NA	NA	NA
WP_015875919.1|2049227_2049932_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015875920.1|2050121_2051180_-	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_015875921.1|2051238_2051577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015875922.1|2051624_2052677_-	nucleoside-diphosphate kinase	NA	NA	NA	NA	NA
WP_015875923.1|2052673_2055904_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	22.9	7.0e-69
WP_153477631.1|2055943_2057449_-	MFS transporter	NA	NA	NA	NA	NA
WP_015875925.1|2057708_2058557_+	UDP-2,3-diacylglucosamine diphosphatase	NA	A0A218MKA7	uncultured_virus	29.1	3.0e-19
WP_015875926.1|2058553_2059192_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_015875927.1|2059252_2060200_-	NAD-dependent epimerase/dehydratase family protein	NA	M1HUT1	Acanthocystis_turfacea_Chlorella_virus	22.5	4.9e-07
WP_015875928.1|2060196_2061516_-	vanadium-dependent haloperoxidase	NA	NA	NA	NA	NA
WP_080569303.1|2061715_2062522_-	thioesterase	NA	NA	NA	NA	NA
WP_015875930.1|2062552_2063437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733315.1|2064047_2064443_+|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	68.2	1.0e-38
WP_153478200.1|2065116_2066097_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	77.1	5.5e-118
WP_153477633.1|2066337_2067384_+|transposase	IS481-like element IS1419 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	74.2	1.1e-148
>prophage 9
NZ_CP045087	Burkholderia glumae strain GX chromosome 1, complete sequence	3712850	2176418	2183001	3712850	integrase	Burkholderia_virus(55.56%)	11	2175242:2175256	2185783:2185797
2175242:2175256	attL	ATCCCGTCGCTGCAG	NA	NA	NA	NA
WP_153477690.1|2176418_2176898_+	hypothetical protein	NA	A0A0K2FHI1	Achromobacter_phage	45.8	7.0e-34
WP_153477691.1|2176999_2178262_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.9	7.0e-17
WP_153477693.1|2178261_2178753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477695.1|2178745_2178985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477696.1|2178981_2179392_+	hypothetical protein	NA	H2BDF1	Pseudomonas_virus	47.7	6.6e-09
WP_153477698.1|2179388_2179763_+	DUF4031 domain-containing protein	NA	Q6V7P5	Burkholderia_virus	56.9	1.6e-30
WP_153477700.1|2179759_2179996_+	hypothetical protein	NA	A9YWV8	Burkholderia_phage	75.6	3.1e-27
WP_153477702.1|2179992_2180925_+	DUF5131 family protein	NA	Q8W6R4	Burkholderia_virus	62.0	1.2e-119
WP_153477703.1|2180921_2181623_+	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	36.3	3.3e-24
WP_124836408.1|2181502_2181868_+	DUF4224 domain-containing protein	NA	Q8W6R6	Burkholderia_virus	45.3	2.4e-10
WP_153477705.1|2181864_2183001_+|integrase	tyrosine-type recombinase/integrase	integrase	Q6JIJ8	Burkholderia_virus	44.8	1.5e-82
2185783:2185797	attR	CTGCAGCGACGGGAT	NA	NA	NA	NA
>prophage 10
NZ_CP045087	Burkholderia glumae strain GX chromosome 1, complete sequence	3712850	2426454	2463857	3712850	transposase,tail,plate,integrase	uncultured_Caudovirales_phage(38.89%)	38	2414867:2414885	2465187:2465205
2414867:2414885	attL	GCCGTTCGCGCCGGCCGGC	NA	NA	NA	NA
WP_153477793.1|2426454_2427501_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	73.9	3.2e-148
WP_080569367.1|2427659_2428247_-	DUF3396 domain-containing protein	NA	NA	NA	NA	NA
WP_015876297.1|2428690_2429740_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_015876298.1|2429709_2430834_-	beta-ketoacyl synthase	NA	NA	NA	NA	NA
WP_153477794.1|2430830_2431919_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_026051330.1|2431923_2432175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015876300.1|2432171_2433461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153477796.1|2433553_2435713_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.4	4.7e-61
WP_124837732.1|2437373_2438611_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.9	1.8e-102
WP_153477798.1|2438597_2439062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017423135.1|2439062_2439635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017423134.1|2439656_2440034_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_153477800.1|2440784_2441912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153477802.1|2442920_2443187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153477803.1|2443227_2443617_+	DUF2513 domain-containing protein	NA	A0A0H4TJ44	Erysipelothrix_phage	31.5	5.3e-08
WP_153477805.1|2444219_2445995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477807.1|2446555_2447146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477808.1|2447433_2447841_+	PAAR domain-containing protein	NA	Q8W6S2	Burkholderia_virus	48.3	4.0e-14
WP_153477810.1|2447898_2448348_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	44.6	1.2e-19
WP_153477812.1|2448695_2449277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477813.1|2449281_2450010_+	hypothetical protein	NA	A4PE26	Ralstonia_virus	41.2	6.6e-36
WP_153477815.1|2450332_2451118_-	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	81.7	1.7e-125
WP_153477817.1|2452564_2452771_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	55.2	6.5e-13
WP_153477819.1|2452745_2453624_-	oxidoreductase	NA	A0A2H4J875	uncultured_Caudovirales_phage	37.6	9.8e-34
WP_153477821.1|2453636_2454257_-	hypothetical protein	NA	A0A2H4J869	uncultured_Caudovirales_phage	56.8	4.0e-05
WP_153477822.1|2454334_2454799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153477824.1|2455926_2456817_-|plate	baseplate J protein	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	42.4	3.3e-45
WP_153477825.1|2456813_2457149_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	44.3	6.8e-20
WP_153477827.1|2457412_2458663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153477829.1|2458765_2459446_-|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	27.8	2.7e-15
WP_153477831.1|2459449_2459974_-	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	32.8	7.9e-15
WP_153477833.1|2459963_2460494_-|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	30.9	2.0e-13
WP_153477835.1|2460496_2460787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153477837.1|2460946_2461324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153477839.1|2461325_2461853_-	hypothetical protein	NA	C7BGG0	Burkholderia_phage	48.2	1.2e-31
WP_153477840.1|2461922_2462132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477842.1|2462203_2462581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477844.1|2462789_2463857_+|integrase	tyrosine-type recombinase/integrase	integrase	A4PE72	Ralstonia_virus	38.1	2.9e-56
2465187:2465205	attR	GCCGGCCGGCGCGAACGGC	NA	NA	NA	NA
>prophage 11
NZ_CP045087	Burkholderia glumae strain GX chromosome 1, complete sequence	3712850	2805986	2814254	3712850		Cowpox_virus(16.67%)	9	NA	NA
WP_124837039.1|2805986_2806793_+	alpha/beta hydrolase	NA	P87627	Cowpox_virus	30.6	2.6e-25
WP_153477918.1|2806863_2807787_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.2	1.9e-43
WP_153477920.1|2807964_2809245_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_012734959.1|2809333_2810236_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.2	3.1e-51
WP_153477922.1|2810260_2810407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153477924.1|2810459_2810783_-	competence protein ComE	NA	NA	NA	NA	NA
WP_012734957.1|2810857_2811850_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.8	2.8e-29
WP_017922220.1|2811904_2812885_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	26.4	1.9e-14
WP_153477925.1|2812853_2814254_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	36.9	5.1e-77
>prophage 12
NZ_CP045087	Burkholderia glumae strain GX chromosome 1, complete sequence	3712850	3108525	3117423	3712850		Pandoravirus(33.33%)	7	NA	NA
WP_153478026.1|3108525_3110103_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	28.4	1.7e-23
WP_012734722.1|3110132_3110666_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	40.5	6.2e-15
WP_012734721.1|3110662_3111346_+	deoxynucleoside kinase	NA	NA	NA	NA	NA
WP_012734720.1|3111392_3112208_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	30.5	1.8e-34
WP_153478027.1|3112236_3114087_-	chloride transporter	NA	S4VT78	Pandoravirus	37.5	4.4e-52
WP_012734718.1|3114103_3115240_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.0	1.2e-23
WP_012734717.1|3115461_3117423_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.0	6.6e-147
>prophage 13
NZ_CP045087	Burkholderia glumae strain GX chromosome 1, complete sequence	3712850	3352329	3413619	3712850	transposase,tRNA,plate	Leptospira_phage(25.0%)	51	NA	NA
WP_012734511.1|3352329_3353616_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_012734510.1|3353696_3354779_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-07
WP_012734509.1|3354799_3355648_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_012734508.1|3355802_3356114_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_012734507.1|3356121_3356718_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_012734506.1|3356895_3357687_+	dioxygenase	NA	NA	NA	NA	NA
WP_012734505.1|3357788_3359387_-	APC family permease	NA	NA	NA	NA	NA
WP_012734504.1|3359821_3360025_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	71.6	1.4e-20
WP_012734503.1|3360266_3361526_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_012734502.1|3361767_3362370_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_012734501.1|3362522_3363809_-	MFS transporter	NA	NA	NA	NA	NA
WP_012734500.1|3363973_3364588_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012734499.1|3364681_3365263_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_012734498.1|3365306_3366170_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012734497.1|3366380_3367514_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_012734496.1|3367684_3368170_-	water stress/hypersensitive response domain-containing protein	NA	NA	NA	NA	NA
WP_012734495.1|3368368_3369292_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012734494.1|3369457_3370435_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_012734493.1|3370476_3370629_+	DUF1427 family protein	NA	NA	NA	NA	NA
WP_026051673.1|3370701_3371736_-	transporter	NA	NA	NA	NA	NA
WP_012734491.1|3372121_3373081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012734490.1|3373204_3374056_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017433311.1|3374321_3378197_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_012734488.1|3378193_3379186_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_012734487.1|3379190_3380258_+	OmpA family protein	NA	NA	NA	NA	NA
WP_012734486.1|3380351_3381494_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_012734485.1|3381584_3384254_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	31.1	6.1e-87
WP_124837387.1|3384319_3385417_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012734483.1|3385380_3387219_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012734482.1|3387311_3387794_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_012734481.1|3387871_3388375_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_012734480.1|3388452_3389943_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_012734479.1|3389957_3390497_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_153478072.1|3390540_3391185_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012734477.1|3391554_3392172_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012734476.1|3392273_3393620_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_012734475.1|3393616_3394408_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_012734474.1|3394586_3395774_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.0	9.5e-16
WP_153478074.1|3396296_3397343_-|transposase	IS481-like element IS1419 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	74.2	8.4e-149
WP_050811391.1|3397793_3398426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080569284.1|3398422_3398716_-	DUF3380 domain-containing protein	NA	NA	NA	NA	NA
WP_012732753.1|3401181_3401532_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_012734051.1|3401507_3401984_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_041193252.1|3402476_3402764_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_153478076.1|3403603_3403981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153478078.1|3404007_3404658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153478080.1|3405232_3407992_+	lactate dehydrogenase	NA	Q6NE04	Leptospira_phage	32.6	6.3e-119
WP_153478081.1|3407988_3410058_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_153478083.1|3410050_3411244_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_012732720.1|3411323_3412121_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	37.7	4.4e-33
WP_012732721.1|3412113_3413619_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP045088	Burkholderia glumae strain GX chromosome 2, complete sequence	2750046	363703	370891	2750046	transposase	Burkholderia_phage(83.33%)	8	NA	NA
WP_153478377.1|363703_364375_-	transglycosylase SLT domain-containing protein	NA	B5TA73	Burkholderia_phage	77.6	1.3e-97
WP_015878156.1|364371_364746_-	membrane protein	NA	B5TA74	Burkholderia_phage	89.5	1.0e-56
WP_085962346.1|364998_365816_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153478379.1|366465_367282_+|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
WP_080569416.1|367311_367845_-	hypothetical protein	NA	B5TA76	Burkholderia_phage	91.5	9.6e-85
WP_015878157.1|367899_368370_-	helix-turn-helix transcriptional regulator	NA	B5TA77	Burkholderia_phage	87.2	7.2e-68
WP_015878158.1|368451_368643_+	DNA-binding protein	NA	B5TA78	Burkholderia_phage	95.2	1.5e-27
WP_015878173.1|369934_370891_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	35.4	5.5e-22
>prophage 2
NZ_CP045088	Burkholderia glumae strain GX chromosome 2, complete sequence	2750046	587281	654315	2750046	transposase,plate	uncultured_Caudovirales_phage(40.0%)	46	NA	NA
WP_153477537.1|587281_588097_+|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
WP_153478435.1|588022_589513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127913912.1|590134_591097_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153478436.1|591918_593562_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_012733002.1|593878_594829_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153478437.1|594926_596519_+	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_153478439.1|596540_599219_+	DUF2309 family protein	NA	NA	NA	NA	NA
WP_012733005.1|599700_600510_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012733006.1|600617_601157_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017423252.1|601249_602206_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012733008.1|602413_603343_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_012733009.1|603339_604815_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_012733010.1|604828_605455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153478441.1|605512_606703_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_017423253.1|606699_607134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153478443.1|607293_608397_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_153478444.1|608393_611480_+	MMPL family transporter	NA	S5VTK5	Leptospira_phage	21.6	9.0e-50
WP_012733015.1|611476_613063_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_012733016.1|613302_613824_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_153478445.1|613966_614716_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017923693.1|615204_615978_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_017423258.1|615974_617138_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_012733020.1|617134_618859_+	ubiquinone-dependent pyruvate dehydrogenase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	24.5	4.0e-15
WP_012733021.1|619959_620508_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_017423261.1|620603_621383_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_012733023.1|621451_624268_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_012733024.1|624368_624905_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_012733025.1|624923_625682_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_012733026.1|625678_627388_+	OmpA family protein	NA	NA	NA	NA	NA
WP_012733027.1|627594_628128_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_012733028.1|628205_629708_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_153478447.1|630011_630827_+|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
WP_012733030.1|631386_631941_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012733031.1|631937_633287_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_100556304.1|633283_634600_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_035979585.1|634612_638710_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_153478449.1|638727_640785_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.2	1.3e-31
WP_153478451.1|640927_643504_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	24.8	9.9e-34
WP_012733036.1|643582_643846_+	membrane protein	NA	NA	NA	NA	NA
WP_035978578.1|643930_647341_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_012733038.1|647245_648646_-	hypothetical protein	NA	A0A292GJ55	Xanthomonas_phage	45.7	1.6e-110
WP_012733039.1|648691_649699_-	fimbrial protein	NA	NA	NA	NA	NA
WP_012733040.1|649764_650829_-	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_012733041.1|650847_651918_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012733042.1|651914_653795_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012733043.1|653796_654315_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP045088	Burkholderia glumae strain GX chromosome 2, complete sequence	2750046	1226698	1276869	2750046	tRNA,transposase	uncultured_Caudovirales_phage(25.0%)	44	NA	NA
WP_085962356.1|1226698_1227516_-|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
WP_153478630.1|1227590_1229036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012733479.1|1229173_1229605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012733480.1|1230028_1231108_-	porin	NA	NA	NA	NA	NA
WP_153478631.1|1231217_1232504_-	MFS transporter	NA	NA	NA	NA	NA
WP_017424350.1|1232858_1233332_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153478633.1|1233385_1235545_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_012733484.1|1235563_1236397_-	p-hydroxycinnamoyl CoA hydratase/lyase	NA	NA	NA	NA	NA
WP_012733485.1|1236468_1237941_-	benzaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_153478635.1|1237978_1238746_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_153479126.1|1239437_1239704_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_012733489.1|1242898_1245577_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	26.2	3.2e-51
WP_124837821.1|1245573_1247304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153478637.1|1247384_1248254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012732753.1|1250429_1250780_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_012734051.1|1250755_1251232_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012733493.1|1251717_1252173_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_153478639.1|1252499_1252868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017424803.1|1252901_1253651_+	FkbM family methyltransferase	NA	E3SJ86	Synechococcus_phage	31.4	9.6e-22
WP_153478641.1|1253651_1254698_+	phosphotransferase	NA	NA	NA	NA	NA
WP_012733496.1|1254699_1255569_+	4Fe-4S cluster-binding domain-containing protein	NA	NA	NA	NA	NA
WP_153478642.1|1255565_1256633_+	asparagine synthase	NA	NA	NA	NA	NA
WP_017923321.1|1256650_1257865_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_012733499.1|1257821_1258511_-	cephalosporin hydroxylase	NA	NA	NA	NA	NA
WP_153478644.1|1258537_1259515_+	phosphotransferase	NA	NA	NA	NA	NA
WP_017425138.1|1259530_1260106_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_124837742.1|1261304_1262084_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012733503.1|1262138_1262597_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153478646.1|1262677_1263052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085962421.1|1263071_1263876_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012733504.1|1264248_1265412_+	serine hydrolase	NA	NA	NA	NA	NA
WP_012733505.1|1265463_1266159_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_012733506.1|1266177_1267254_-	DUF3419 family protein	NA	NA	NA	NA	NA
WP_012733507.1|1267262_1267994_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_153478648.1|1268018_1268836_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012733508.1|1268923_1269607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012733509.1|1269610_1270003_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_153478650.1|1270600_1271026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012733510.1|1271137_1272160_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_153478652.1|1272355_1272580_-	DUF4260 family protein	NA	NA	NA	NA	NA
WP_124837732.1|1273329_1274566_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.9	1.8e-102
WP_153478654.1|1274625_1275051_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_085962421.1|1275103_1275909_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153478656.1|1276052_1276869_+|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP045088	Burkholderia glumae strain GX chromosome 2, complete sequence	2750046	1503819	1511971	2750046	transposase	Burkholderia_phage(77.78%)	11	NA	NA
WP_035983169.1|1503819_1504428_+	hypothetical protein	NA	A0A0P0IKS1	Acinetobacter_phage	31.6	2.5e-12
WP_017922206.1|1504424_1504733_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	42.6	6.7e-14
WP_153477537.1|1504741_1505558_-|transposase	IS5-like element ISBugl2 family transposase	transposase	NA	NA	NA	NA
WP_035976925.1|1505938_1506904_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	54.1	7.6e-88
WP_153478723.1|1506940_1507144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035976924.1|1507142_1507928_+	phage protein	NA	A9YX06	Burkholderia_phage	55.9	9.6e-73
WP_017922209.1|1507986_1508340_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	69.2	2.4e-39
WP_153478724.1|1508336_1509533_+	hypothetical protein	NA	A9YX12	Burkholderia_phage	69.1	3.3e-141
WP_035978482.1|1509537_1510200_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	75.9	5.7e-95
WP_035978485.1|1511073_1511778_+	hypothetical protein	NA	A9YX14	Burkholderia_phage	61.8	9.2e-67
WP_035978483.1|1511788_1511971_+	hypothetical protein	NA	A9YX15	Burkholderia_phage	48.3	3.5e-10
>prophage 5
NZ_CP045088	Burkholderia glumae strain GX chromosome 2, complete sequence	2750046	2428981	2442287	2750046	transposase,integrase	Acidithiobacillus_phage(50.0%)	9	2418084:2418099	2440483:2440498
2418084:2418099	attL	GGGCTGCGCGAGCGGC	NA	NA	NA	NA
WP_153479034.1|2428981_2429798_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_127913895.1|2431008_2431563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088499505.1|2431738_2432976_-|transposase	IS3-like element IS1416 family transposase	transposase	Q8W6R2	Burkholderia_virus	94.7	1.9e-155
WP_153479036.1|2434655_2435018_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_012732738.1|2435208_2436228_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_153477359.1|2436703_2438254_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.2	1.5e-157
WP_006400877.1|2438269_2439019_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	61.2	1.8e-81
WP_153479038.1|2439157_2440018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012732752.1|2440730_2442287_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.1e-67
2440483:2440498	attR	GGGCTGCGCGAGCGGC	NA	NA	NA	NA
>prophage 1
NZ_CP045089	Burkholderia glumae strain GX plasmid pWSGX1, complete sequence	201571	1654	58772	201571	transposase,integrase	Mycobacterium_phage(23.53%)	41	NA	NA
WP_045678676.1|1654_2674_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_153479163.1|2876_3692_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.0	1.2e-25
WP_017924798.1|4037_4589_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_012732724.1|6106_7690_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.6	1.5e-11
WP_012732723.1|8556_10254_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.0	5.4e-12
WP_039204250.1|10429_12154_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.9	5.1e-10
WP_080569430.1|12372_12861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045678677.1|13303_13498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012734076.1|14417_15977_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.6	5.1e-41
WP_012734051.1|16865_17342_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_012732753.1|17317_17668_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_012732752.1|18169_19726_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	4.1e-67
WP_012732753.1|19757_20108_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_012734051.1|20083_20560_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_039202049.1|22587_25275_-	hybrid sensor histidine kinase/response regulator	NA	Q6XLV6	Feldmannia_irregularis_virus	25.4	6.7e-17
WP_012734079.1|25271_26051_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.1	4.8e-16
WP_017423070.1|26270_27008_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_124837819.1|28699_30187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012734082.1|30282_32130_+	peptidase C11	NA	NA	NA	NA	NA
WP_085962449.1|32308_33113_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.4	6.2e-27
WP_080569432.1|33983_34124_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_017924497.1|34865_35153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012734085.1|35350_35851_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_012734086.1|36210_37758_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.5	1.9e-19
WP_012734087.1|38819_39479_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_012734088.1|39581_40364_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_085962450.1|40510_41316_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.8	5.1e-29
WP_012734091.1|42181_42436_+	antitoxin	NA	NA	NA	NA	NA
WP_039203971.1|42426_42837_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_017925051.1|42899_43217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080763664.1|43251_43632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039203972.1|43628_45452_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017925019.1|45494_45704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124837551.1|45919_46603_+|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	32.8	8.2e-20
WP_039203083.1|47009_49517_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_085962421.1|50006_50812_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	35.1	3.9e-29
WP_017924909.1|53348_53885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012735336.1|53897_54149_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_012732753.1|56126_56477_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_012734051.1|56452_56929_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_153479165.1|57534_58772_-|transposase	IS3-like element IS1416 family transposase	transposase	Q8W6R2	Burkholderia_virus	94.4	9.2e-155
>prophage 2
NZ_CP045089	Burkholderia glumae strain GX plasmid pWSGX1, complete sequence	201571	94751	169284	201571	transposase,holin,integrase	Pseudomonas_phage(15.38%)	55	121328:121343	169294:169309
WP_124837732.1|94751_95988_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	63.9	1.8e-102
WP_153479167.1|96155_97478_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_017923352.1|100182_101100_-	phenol degradation protein	NA	NA	NA	NA	NA
WP_051071153.1|101593_103252_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_012732753.1|105085_105436_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_039203908.1|105411_105888_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012732755.1|106116_107169_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012732756.1|107313_108735_+	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012732757.1|108761_110462_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	5.9e-59
WP_012732758.1|110448_112914_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_039203994.1|113445_114912_-	AAA family ATPase	NA	A0A126DN25	Acinetobacter_phage	32.4	3.5e-60
WP_085962346.1|115306_116123_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	34.6	4.5e-25
WP_085967323.1|117314_117644_+	H-NS histone family protein	NA	F8TUP5	EBPR_podovirus	32.0	3.6e-05
WP_017432678.1|117652_117916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017432679.1|118587_119613_+	ParA family protein	NA	Q56VQ0	Pseudomonas_phage	60.8	5.0e-106
WP_039203079.1|119618_120227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017432681.1|120656_121043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153479169.1|121042_121519_-	hypothetical protein	NA	NA	NA	NA	NA
121328:121343	attL	CGGCGCGCGGGCCTGG	NA	NA	NA	NA
WP_153479171.1|121968_124890_+	conjugative relaxase	NA	A0A1P8DII4	Virus_Rctr197k	28.8	3.1e-07
WP_080942737.1|124979_125450_-	ProQ activator of osmoprotectant transporter prop	NA	NA	NA	NA	NA
WP_080942736.1|125542_126037_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_045678699.1|126033_126315_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_042967384.1|127210_127492_+	virulence factor	NA	NA	NA	NA	NA
WP_017432519.1|127648_128728_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_045678698.1|128774_129494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153479173.1|129515_131741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042967381.1|131758_132937_-	metallohydrolase	NA	NA	NA	NA	NA
WP_012732871.1|133930_134797_-	ATPase AAA	NA	U5N3V8	Enterobacteria_phage	44.1	2.8e-49
WP_017432522.1|134793_136050_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	33.0	7.7e-48
WP_127913919.1|137015_137342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153479174.1|137338_142024_-	sugar-binding protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	49.8	3.6e-50
WP_012732846.1|142337_143045_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080569434.1|143228_144263_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_012732844.1|144288_146145_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_148271072.1|146134_146485_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_012732842.1|146644_147538_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043226181.1|148657_149152_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_153479176.1|149734_149962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153479195.1|154795_155236_+	hypothetical protein	NA	A9YWZ0	Burkholderia_phage	63.0	1.6e-24
WP_153479178.1|156090_156990_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_012734037.1|158669_159527_-	TrfA family protein	NA	NA	NA	NA	NA
WP_012734036.1|160281_161247_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_012734035.1|161246_161918_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	30.7	1.4e-16
WP_043308437.1|163233_163428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012734113.1|163580_163826_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_012734112.1|163815_164118_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_043308436.1|164277_164520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012734111.1|164727_165183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043308454.1|165186_165468_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_148271069.1|165651_165969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017924445.1|166225_166510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017924444.1|166522_166762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153479180.1|166758_167004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039204389.1|167104_167446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153479182.1|167448_169284_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
169294:169309	attR	CGGCGCGCGGGCCTGG	NA	NA	NA	NA
>prophage 1
NZ_CP045090	Burkholderia glumae strain GX plasmid pWSGX2, complete sequence	105587	17524	53706	105587	transposase,integrase	Leptospira_phage(50.0%)	37	14436:14452	30225:30241
14436:14452	attL	TGCTGCTCGCCGCGCTC	NA	NA	NA	NA
WP_124837684.1|17524_19360_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012732713.1|19444_19870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153479207.1|21244_21922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012732716.1|22068_22518_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_012732718.1|23661_25014_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_012732719.1|25384_25795_-	Mn-containing catalase	NA	NA	NA	NA	NA
WP_153479209.1|26302_26746_+	response regulator	NA	NA	NA	NA	NA
WP_153479210.1|27031_27442_+	low affinity iron permease family protein	NA	NA	NA	NA	NA
WP_153479211.1|29476_31192_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.9	6.6e-10
30225:30241	attR	TGCTGCTCGCCGCGCTC	NA	NA	NA	NA
WP_153479212.1|31384_31873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153479213.1|32524_33061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153479214.1|33071_33440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012734062.1|33455_33698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153479215.1|33798_34086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153479217.1|34098_37248_-	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	27.7	8.2e-91
WP_153479218.1|37254_38733_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_153479220.1|38650_39370_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_153479221.1|39896_40184_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015875269.1|40135_41692_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.0	5.9e-66
WP_012732753.1|41723_42074_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_039203908.1|42049_42526_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153479222.1|43701_43989_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_153479223.1|44018_44294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153479224.1|44414_44951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153479225.1|45098_45497_+	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	51.1	5.6e-13
WP_153479226.1|45501_45999_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	46.0	4.4e-23
WP_153479227.1|45991_46459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051071122.1|46346_46949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043224898.1|46956_47682_+	LysR family transcriptional regulator	NA	A4PE26	Ralstonia_virus	43.5	1.2e-32
WP_153479228.1|47718_48261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153479230.1|48458_48971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153479231.1|49086_49563_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_012732753.1|49538_49889_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	39.4	2.1e-16
WP_153479232.1|51426_51936_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153479234.1|52061_52337_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.3	3.6e-11
WP_153479234.1|52912_53188_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.3	3.6e-11
WP_059531437.1|53163_53706_-|transposase	transposase	transposase	NA	NA	NA	NA
