The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041337	Escherichia coli strain CCUG 73778 chromosome, complete genome	5076638	400430	459344	5076638	capsid,lysis,protease,terminase,head,tail,portal	Enterobacteria_phage(52.08%)	71	NA	NA
WP_000849214.1|400430_400919_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000686738.1|401326_401821_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000557384.1|401810_402074_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778067.1|402070_404557_+	periplasmic nitrate reductase subunit alpha	NA	NA	NA	NA	NA
WP_000091291.1|404563_405259_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013499.1|405245_406109_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835174.1|406105_406555_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000528376.1|406564_407167_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888560.1|407185_407803_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
WP_000971730.1|407799_408462_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_001296242.1|408503_409241_+	heme exporter protein CcmC	NA	NA	NA	NA	NA
WP_000186540.1|409237_409447_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001026418.1|409443_409923_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982445.1|409919_411863_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000824439.1|411859_412417_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001211575.1|412413_413466_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001113641.1|413500_414148_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001136067.1|416005_416773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145023.1|416762_417146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183538.1|417629_418586_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000741304.1|418723_419902_-	recombinase	NA	A0A2D1GN00	Marinobacter_phage	30.6	2.7e-31
WP_001096409.1|419904_420114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021548839.1|420175_420391_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	92.1	3.7e-27
WP_001242718.1|420387_420750_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.2	3.6e-67
WP_021548838.1|420740_421277_-	5'-deoxynucleotidase	NA	A0A0P0ZCH9	Stx2-converting_phage	98.3	5.3e-99
WP_000081280.1|421404_422229_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_000135680.1|422293_422656_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000141752.1|423093_423339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450737.1|423927_424554_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.9e-47
WP_000205494.1|424651_424852_+	cell division protein	NA	NA	NA	NA	NA
WP_000515869.1|424889_425447_+	protein YmfL	NA	U5P4K1	Shigella_phage	96.8	8.8e-97
WP_001250272.1|425622_425802_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_063611918.1|425791_426733_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.0	1.8e-142
WP_074171257.1|426729_427224_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	5.6e-87
WP_001305610.1|427223_427877_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_000210154.1|427873_428200_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_000767115.1|428196_428586_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
WP_001061404.1|428605_429403_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
WP_001360050.1|429410_430400_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001047106.1|430413_431166_+	antitermination protein	NA	Q8SBE4	Shigella_phage	99.6	1.1e-137
WP_000917724.1|431418_431622_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|431772_432825_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|432892_433108_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000193265.1|433112_433463_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	9.3e-36
WP_000992100.1|433526_434060_+	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_001377819.1|434056_434524_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	1.6e-75
WP_001139679.1|434511_434664_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000240372.1|435407_435812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453600.1|436211_436757_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.1e-94
WP_001027268.1|436731_438657_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|438653_438860_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001355837.1|438856_440458_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.7e-308
WP_000123309.1|440438_441758_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	7.4e-235
WP_001338090.1|441767_442100_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_021514934.1|442155_443181_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	3.4e-187
WP_021514935.1|443222_443618_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	91.7	3.5e-55
WP_000752960.1|443629_443983_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_064673877.1|443994_444573_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.4	4.3e-78
WP_000683138.1|444569_444965_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_061360918.1|444972_445713_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	8.0e-130
WP_000479193.1|445728_446151_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459457.1|446132_446567_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_153435615.1|446559_449121_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	96.8	0.0e+00
WP_000847379.1|449117_449447_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152632.1|449446_450145_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	9.5e-133
WP_074171255.1|450150_450894_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	7.0e-150
WP_000090917.1|450830_451463_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_064673847.1|451523_455006_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.5	0.0e+00
WP_001619152.1|455072_455672_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.8e-109
WP_074171254.1|455736_458760_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	81.4	2.1e-67
WP_063611903.1|458759_459344_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	2.4e-105
>prophage 2
NZ_CP041337	Escherichia coli strain CCUG 73778 chromosome, complete genome	5076638	530137	539582	5076638		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569347.1|530137_531064_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783109.1|531068_531800_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|531780_531888_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|531947_532679_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|532900_534586_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|534582_535302_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|535348_535819_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|535859_536321_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001296230.1|536445_538449_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001292786.1|538445_539582_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
>prophage 3
NZ_CP041337	Escherichia coli strain CCUG 73778 chromosome, complete genome	5076638	633758	640061	5076638		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001116066.1|633758_635153_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
WP_000183040.1|635327_636221_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_000699407.1|636593_637679_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_001023641.1|637678_638578_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000857525.1|638635_639514_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001100793.1|639518_640061_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 4
NZ_CP041337	Escherichia coli strain CCUG 73778 chromosome, complete genome	5076638	663208	716364	5076638	transposase	Stx2-converting_phage(18.75%)	54	NA	NA
WP_001531805.1|663208_663667_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
WP_000980556.1|663777_665205_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001296209.1|665413_666580_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_001105368.1|666698_667172_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200889.1|667369_668428_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|668599_668929_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001296208.1|669029_669212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|669700_669814_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|669826_670021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854815.1|670017_670392_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001280918.1|670480_670849_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086752.1|670864_671509_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_000692345.1|671527_671749_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186200.1|671811_672288_-	RadC family protein	NA	NA	NA	NA	NA
WP_001542276.1|672303_672777_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001164966.1|672870_673116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|673115_673934_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_000846703.1|674154_674565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|675013_675760_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|675774_677316_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001542273.1|677430_677844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102633.1|677979_679050_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203551.1|679046_679952_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_001531797.1|679948_682333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069649.1|682550_682985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000856948.1|683413_685579_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000778018.1|685589_686579_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000217077.1|686597_687656_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000016207.1|687652_688420_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_001163787.1|688473_688731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296206.1|689261_690407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089438313.1|691606_691786_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000255956.1|691931_692954_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_072093906.1|692950_693646_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	2.3e-118
WP_000813432.1|694671_695274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304240.1|695367_695646_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001296203.1|695769_696966_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001336659.1|697729_697906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000221519.1|698545_699115_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271042.1|699280_699682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221618.1|699669_700080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000656349.1|702394_703429_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_000739817.1|703431_704397_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001066372.1|704450_705209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000667429.1|705222_706437_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000589885.1|707438_708212_-	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_077249421.1|708213_708795_-	acetyltransferase	NA	NA	NA	NA	NA
WP_000854360.1|708772_709969_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_001297930.1|709982_710636_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_001542270.1|711683_712907_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	2.0e-61
WP_000502870.1|712891_713536_+	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
WP_000422741.1|713947_714373_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|714369_714720_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|714750_716364_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 5
NZ_CP041337	Escherichia coli strain CCUG 73778 chromosome, complete genome	5076638	821457	909703	5076638	portal,tRNA,integrase,tail,terminase,transposase,holin,plate,capsid	Escherichia_phage(22.73%)	103	821272:821331	863884:864008
821272:821331	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
WP_001531780.1|821457_822474_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
WP_000833838.1|822442_822706_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_000916334.1|822915_823098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000100753.1|823097_823667_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000151806.1|823663_825880_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000388260.1|825910_826231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296165.1|827241_827655_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000360804.1|827753_827984_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_000431205.1|828042_828519_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000943914.1|828558_828783_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_001023813.1|828779_829535_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000609322.1|829524_830940_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_000214056.1|830978_831389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918616.1|831390_831627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|831623_831935_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000661082.1|831931_832156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531776.1|832837_833626_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_001237642.1|833800_834724_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000536231.1|835912_836611_+	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001138663.1|837073_837679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|837688_838177_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_000536919.1|838575_838809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|839052_839694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025459.1|839845_840025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057010.1|840102_840699_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_000717783.1|840695_840989_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000064384.1|840988_841660_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_001294589.1|841772_842156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172496.1|842155_842428_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_000131873.1|842427_842907_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000734931.1|842914_843109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531775.1|843168_843414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168117.1|843782_844349_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_000148195.1|844335_846198_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000203897.1|846197_846431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126513.1|846427_848002_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_001145892.1|848001_849309_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000206292.1|849308_849638_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001283997.1|849696_850731_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000105179.1|850765_851185_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001531773.1|851181_851562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|851593_852274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015612.1|852270_852807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000079174.1|852787_853690_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000901289.1|853692_854034_+|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000633314.1|854030_854951_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000203868.1|854953_855580_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000829621.1|855572_856757_+|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000626358.1|856756_857146_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000117510.1|857142_858645_+|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000785563.1|858662_859175_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000444667.1|859187_859469_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001018353.1|859577_861218_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_001531768.1|861253_861643_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001531767.1|861804_862029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296152.1|863243_863663_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_000847882.1|864134_864800_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
863884:864008	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
WP_000797555.1|864850_866062_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377224.1|866252_866492_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|866529_867027_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237881.1|867198_867522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723106.1|867785_867872_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082127.1|867986_868238_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|868315_868819_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000548680.1|869613_870603_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001187827.1|870672_872187_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000100203.1|872201_873188_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_064673865.1|873354_874155_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001296148.1|874129_875554_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000122413.1|875560_875989_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295647.1|876768_877119_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291603.1|877121_877700_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000906342.1|877826_878714_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795641.1|878710_879637_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_001531763.1|879641_881606_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000147302.1|881626_882130_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001296146.1|882274_883936_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000204320.1|884226_885087_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|885089_886139_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|886153_886543_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000983600.1|886553_887198_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001278946.1|887386_888535_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000066973.1|888527_890606_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001202076.1|890605_890998_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001025326.1|891050_892784_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001490174.1|892999_893566_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185734.1|893579_894326_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214293.1|894713_895814_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176764.1|895838_898268_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_000564759.1|898303_899275_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|899271_900015_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|900055_900451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639277.1|900503_901322_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000891625.1|901318_901885_-	hydrolase	NA	NA	NA	NA	NA
WP_001258676.1|902194_903967_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077249130.1|903959_904412_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|904440_905181_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|905215_905737_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024911.1|905738_906341_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|906411_906477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|906615_907227_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568520.1|907235_908246_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_099156422.1|908355_909703_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
>prophage 6
NZ_CP041337	Escherichia coli strain CCUG 73778 chromosome, complete genome	5076638	1401732	1471447	5076638	capsid,holin,protease,integrase,transposase,terminase,head,tail,portal	Stx2-converting_phage(25.0%)	79	1430618:1430632	1472411:1472425
WP_000422062.1|1401732_1402782_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559273.1|1403001_1403760_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001278898.1|1403756_1404347_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001000715.1|1404403_1404712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023141019.1|1404721_1405708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291206.1|1405913_1406789_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001296033.1|1407001_1408897_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|1408924_1409545_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285702.1|1409541_1410423_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|1410560_1410605_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194644.1|1410696_1412259_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763535.1|1412258_1413854_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001195273.1|1413857_1415216_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000209513.1|1415227_1416421_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443082.1|1416420_1417227_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_001296031.1|1417602_1417878_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_001348267.1|1417874_1418432_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_000937495.1|1418843_1419113_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|1419169_1419838_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001421220.1|1420036_1420219_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_001513292.1|1420344_1421313_+	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
WP_001164137.1|1421328_1421856_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_000972097.1|1421886_1422420_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_023363168.1|1422421_1425247_-|tail	tail protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
WP_001016257.1|1425708_1426455_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|1426469_1428011_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000514710.1|1428651_1432125_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
1430618:1430632	attL	CGGGTGGCAGCATCA	NA	NA	NA	NA
WP_061089814.1|1432467_1433100_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000194730.1|1433045_1433789_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_001296027.1|1433799_1434498_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000807937.1|1434497_1434839_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_000212991.1|1434831_1438074_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_001513217.1|1438121_1438331_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|1438426_1438801_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275441.1|1438815_1439532_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|1439598_1439943_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|1439939_1440386_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|1440382_1440733_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|1440742_1441069_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_000267294.1|1441065_1443651_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|1443596_1443818_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173031.1|1443862_1445800_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_063611971.1|1445863_1447525_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.6	0.0e+00
WP_000958366.1|1447521_1448085_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_000829185.1|1448375_1448741_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000095741.1|1448782_1448983_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000736382.1|1449181_1449397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1449482_1449668_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_032140280.1|1449889_1449976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|1450530_1451064_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_000369850.1|1451169_1451442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|1451407_1451752_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|1451756_1451972_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_016230612.1|1452122_1453976_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000871291.1|1454236_1454572_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_023142244.1|1454852_1454984_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000024331.1|1455785_1456835_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_000917751.1|1456986_1457184_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_001513213.1|1457410_1458232_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000140014.1|1458228_1458609_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001265085.1|1458609_1459665_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_001329966.1|1459666_1459939_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|1460106_1460319_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|1460499_1461165_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151161.1|1461339_1461765_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000450998.1|1461780_1462551_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788950.1|1462572_1463319_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095675.1|1463325_1464288_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693845.1|1464310_1464736_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|1464732_1464948_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103687.1|1464997_1465714_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000379589.1|1465986_1466142_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171951.1|1466301_1466520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023142248.1|1466568_1466736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449179.1|1467085_1467274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|1467270_1467462_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_016230610.1|1467554_1470026_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
WP_000113189.1|1470090_1470339_+	excisionase	NA	NA	NA	NA	NA
WP_000113700.1|1470316_1471447_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
1472411:1472425	attR	TGATGCTGCCACCCG	NA	NA	NA	NA
>prophage 7
NZ_CP041337	Escherichia coli strain CCUG 73778 chromosome, complete genome	5076638	1609526	1655235	5076638	capsid,tRNA,lysis,holin,integrase,terminase,head,tail,portal	Enterobacteria_phage(56.0%)	58	1628310:1628324	1656904:1656918
WP_000654172.1|1609526_1609805_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000290538.1|1609801_1611823_-	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_001531667.1|1611881_1615364_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_023149564.1|1615424_1616027_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_023146277.1|1615963_1616707_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_001152626.1|1616711_1617410_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847375.1|1617409_1617739_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_000840216.1|1617735_1620297_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000459457.1|1620289_1620724_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479203.1|1620705_1621128_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_001295979.1|1621143_1621884_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000683150.1|1621891_1622287_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_000985120.1|1622283_1622862_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000753018.1|1622873_1623227_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000158908.1|1623238_1623637_-	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000063293.1|1623678_1624704_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_001295978.1|1624759_1625092_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123268.1|1625101_1626421_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295977.1|1626401_1628003_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000198149.1|1627999_1628206_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027261.1|1628202_1630128_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
1628310:1628324	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_000453620.1|1630102_1630648_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_000881610.1|1631211_1631394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|1631600_1631927_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|1632407_1632701_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|1632791_1632974_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180486.1|1633190_1633667_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_000544528.1|1633653_1633959_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097224.1|1634280_1634970_-	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000971096.1|1634966_1635107_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001099488.1|1635103_1635466_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774479.1|1635462_1635753_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224914.1|1635745_1635916_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053005.1|1635915_1636371_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_072147164.1|1636367_1636469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|1636818_1637862_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022645049.1|1637898_1642164_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000788794.1|1642413_1643115_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_001435464.1|1643111_1644041_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_001182900.1|1644127_1644667_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001067458.1|1644736_1644967_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|1645071_1645761_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|1646356_1646563_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995418.1|1646638_1646935_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000100847.1|1646940_1647726_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|1647722_1648403_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|1648399_1648582_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|1648554_1648746_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_021533932.1|1648756_1649038_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000763374.1|1649136_1649358_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|1649357_1649684_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|1649667_1649907_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|1650046_1650283_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|1650272_1651415_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|1651528_1652779_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248677.1|1652950_1653604_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|1653613_1654075_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|1654128_1655235_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
1656904:1656918	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
>prophage 8
NZ_CP041337	Escherichia coli strain CCUG 73778 chromosome, complete genome	5076638	1852343	1939629	5076638	portal,tRNA,lysis,holin,integrase,plate,transposase,terminase,head,tail,capsid	Burkholderia_virus(25.35%)	104	1870566:1870582	1933096:1933112
WP_001295930.1|1852343_1853129_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|1853264_1854044_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436917.1|1854020_1854914_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011610.1|1855067_1855814_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350057.1|1855810_1855993_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056492.1|1856044_1857277_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570547.1|1857313_1858300_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551259.1|1858296_1860045_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705731.1|1860081_1862346_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|1862551_1862836_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|1862995_1864669_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|1864779_1865463_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_029364556.1|1865635_1866418_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001281701.1|1866561_1866951_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
WP_001170114.1|1866922_1867372_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_000206212.1|1867373_1867580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631813.1|1867569_1867800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|1867796_1868480_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000763554.1|1868476_1868692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|1868706_1869003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632576.1|1869012_1869285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|1869573_1870104_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|1870131_1870401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960679.1|1870403_1871570_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
1870566:1870582	attL	CACTGCACCGGCGTCCA	NA	NA	NA	NA
WP_063611941.1|1871580_1873350_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.2e-227
WP_063611942.1|1873365_1873683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533817.1|1873682_1874603_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_000047759.1|1874613_1874922_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000123378.1|1874974_1875163_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000031013.1|1875256_1875613_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000783854.1|1875729_1876494_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_001069611.1|1876684_1876900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|1876898_1877303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194951.1|1877278_1878007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793146.1|1878137_1878488_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|1878490_1879231_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264665.1|1879214_1879865_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_000175099.1|1879861_1880188_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000227701.1|1880187_1880499_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|1880498_1881044_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000167500.1|1881040_1882636_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.5e-185
WP_000090684.1|1882635_1884132_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000117548.1|1884112_1884934_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000135514.1|1884936_1885395_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273074.1|1885609_1886725_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|1886739_1887693_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|1887702_1888041_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|1888042_1888489_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|1888488_1888953_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_012602372.1|1888949_1889204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|1889193_1890621_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000034294.1|1890620_1891142_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000110114.1|1891144_1891426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|1891523_1891859_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|1891782_1891941_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000016538.1|1892016_1894968_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_000458387.1|1894967_1895852_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_012602373.1|1895848_1896064_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000808007.1|1896051_1897206_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000148266.1|1897202_1897799_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000859111.1|1897853_1898201_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001219098.1|1898191_1899295_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000138756.1|1899287_1899866_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_000527461.1|1899868_1901200_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	4.8e-40
WP_000072165.1|1901199_1901814_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_023142129.1|1901820_1902282_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_064767240.1|1902292_1902733_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_000904922.1|1902792_1903365_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_000445240.1|1903620_1904904_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057158.1|1904974_1906063_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000642852.1|1906261_1906954_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000194832.1|1907083_1908844_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_001295917.1|1909249_1910107_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292822.1|1910161_1912444_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000468308.1|1912763_1912982_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001576679.1|1913063_1914227_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.4	5.9e-204
WP_000978911.1|1914226_1914706_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000785970.1|1917159_1917279_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|1917311_1917587_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|1917643_1918162_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001576673.1|1918174_1919365_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	3.1e-224
WP_001576672.1|1919676_1920153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576671.1|1920593_1920971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|1922024_1922771_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|1922785_1924327_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001576667.1|1924586_1927211_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	95.7	0.0e+00
WP_001576666.1|1927221_1927752_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	2.3e-102
WP_001121498.1|1927744_1928653_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	1.7e-161
WP_000127163.1|1928657_1929005_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001576664.1|1929001_1929637_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	1.2e-113
WP_001001786.1|1929703_1930156_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_000917151.1|1930148_1930616_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
WP_001576659.1|1930723_1931149_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	93.6	1.5e-64
WP_001576658.1|1931136_1931562_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	96.5	1.0e-57
WP_001576656.1|1931576_1932074_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
WP_000123124.1|1932073_1932355_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|1932358_1932562_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|1932561_1933071_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_001576654.1|1933170_1933914_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	1.6e-125
1933096:1933112	attR	TGGACGCCGGTGCAGTG	NA	NA	NA	NA
WP_001576652.1|1933917_1934991_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
WP_001085955.1|1935049_1935904_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	98.2	5.2e-133
WP_000156861.1|1936077_1937850_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001576650.1|1937849_1938884_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	98.8	7.9e-200
WP_001576649.1|1939209_1939629_-	hypothetical protein	NA	Q6K1E9	Salmonella_virus	76.3	5.7e-56
>prophage 9
NZ_CP041337	Escherichia coli strain CCUG 73778 chromosome, complete genome	5076638	1942945	2002336	5076638	portal,tRNA,holin,integrase,plate,terminase,head,tail,capsid	Enterobacteria_phage(69.49%)	71	1956024:1956043	1994681:1994700
WP_001576643.1|1942945_1945225_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_001576641.1|1945214_1945490_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	98.9	1.9e-44
WP_001576640.1|1945486_1945711_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	97.3	1.5e-34
WP_001576638.1|1945710_1946013_-	hypothetical protein	NA	Q7Y4C1	Escherichia_virus	96.0	1.6e-44
WP_001576637.1|1946012_1946237_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	5.2e-32
WP_000217677.1|1946300_1946801_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001576635.1|1946978_1947335_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	98.3	2.0e-62
WP_000072552.1|1947439_1947751_+	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000023390.1|1947844_1948840_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_000067979.1|1948871_1949669_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000109283.1|1949765_1950914_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|1951227_1951854_+	hydrolase	NA	NA	NA	NA	NA
WP_000534666.1|1951889_1952753_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213098.1|1952754_1953372_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|1953382_1955827_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
1956024:1956043	attL	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000023739.1|1956126_1957119_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_001368591.1|1957188_1957530_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_001204236.1|1957634_1958156_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000856387.1|1958160_1958583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287828.1|1958589_1958781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776267.1|1958918_1959269_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_000159455.1|1959279_1959558_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000514277.1|1959569_1959812_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021715.1|1959808_1959922_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000543036.1|1960015_1960426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|1960449_1960653_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|1960649_1960916_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104290.1|1960912_1961212_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000013455.1|1961534_1961765_+	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	97.4	9.1e-32
WP_000599382.1|1961837_1962203_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_021526466.1|1962209_1965032_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.3	0.0e+00
WP_000686485.1|1965108_1966068_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000211282.1|1966072_1966387_+	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000193205.1|1966470_1967313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|1967352_1967850_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000236495.1|1968573_1969098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000087814.1|1969112_1970159_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000613780.1|1970158_1971910_-|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262655.1|1972064_1972901_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_001055083.1|1972924_1973977_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_000632309.1|1974022_1974823_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_000063100.1|1974924_1975419_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000864901.1|1975418_1975619_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_001342221.1|1975621_1975945_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072341.1|1975941_1976334_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_000780577.1|1976330_1976726_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000202148.1|1976864_1978742_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000921127.1|1978765_1979233_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000356366.1|1979225_1979861_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_001271941.1|1979857_1980439_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000213444.1|1980435_1980786_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001111954.1|1980789_1981686_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000071703.1|1981678_1982209_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_021538277.1|1982211_1984197_+|tail	phage tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	86.0	3.2e-173
WP_000972134.1|1984199_1984733_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_001554335.1|1984761_1985289_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_023363133.1|1985290_1986076_-	hypothetical protein	NA	Q858V4	Yersinia_virus	76.6	1.1e-108
WP_000905061.1|1986303_1986903_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|1986931_1987420_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853410.1|1987432_1990240_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000333503.1|1990226_1990382_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651577.1|1990390_1990765_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_064673892.1|1990820_1991333_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	96.5	4.3e-90
WP_000005447.1|1991332_1992517_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000132830.1|1992674_1993784_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488106.1|1993824_1994085_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|1994276_1994417_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000886683.1|1994722_1996015_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
1994681:1994700	attR	AAAGCGCCCGCAGGCGCTTT	NA	NA	NA	NA
WP_000067797.1|1996105_1997449_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|1997459_1998071_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077041.1|1998229_2002336_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
>prophage 10
NZ_CP041337	Escherichia coli strain CCUG 73778 chromosome, complete genome	5076638	4638547	4685516	5076638	protease,transposase	Stx2-converting_phage(33.33%)	33	NA	NA
WP_000997995.1|4638547_4640086_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000624646.1|4641213_4641564_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|4641560_4641986_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_085949591.1|4642357_4642495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001149834.1|4642646_4643564_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|4643597_4644473_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|4644521_4645994_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948500.1|4645997_4646828_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|4646873_4647584_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|4647596_4648706_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001030790.1|4648767_4649691_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|4649726_4650461_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|4650560_4651547_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_096928816.1|4651698_4652926_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|4653426_4655517_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001305021.1|4656348_4656621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296382.1|4656911_4657271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|4657274_4657490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|4662270_4663422_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001034083.1|4664018_4667906_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_000973516.1|4668849_4671051_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|4671132_4672410_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_021526487.1|4672406_4674149_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287500.1|4674148_4675096_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|4675096_4676821_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074472.1|4676956_4678150_+	MFS transporter	NA	NA	NA	NA	NA
WP_001296373.1|4678867_4679296_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109147.1|4679335_4679896_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|4679937_4680198_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|4682031_4682145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099156432.1|4682235_4683361_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
WP_023146305.1|4683330_4683546_-	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	85.2	1.7e-27
WP_000080195.1|4683902_4685516_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 11
NZ_CP041337	Escherichia coli strain CCUG 73778 chromosome, complete genome	5076638	4976169	4983309	5076638		Escherichia_phage(83.33%)	6	NA	NA
WP_001279004.1|4976169_4976808_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590411.1|4976804_4978067_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847996.1|4978063_4978972_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_001296319.1|4979167_4979935_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141293.1|4979985_4980642_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_000103863.1|4980747_4983309_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 1
NZ_CP041338	Escherichia coli strain CCUG 73778 plasmid pSUH-1, complete sequence	161372	0	7782	161372	integrase	Macacine_betaherpesvirus(100.0%)	5	2248:2261	15015:15028
WP_001348615.1|952_1855_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
2248:2261	attL	CTGATAGTCTGATC	NA	NA	NA	NA
WP_000817036.1|2721_3693_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|3692_4859_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|5446_6202_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016982.1|6975_7782_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
15015:15028	attR	GATCAGACTATCAG	NA	NA	NA	NA
>prophage 2
NZ_CP041338	Escherichia coli strain CCUG 73778 plasmid pSUH-1, complete sequence	161372	20648	76362	161372	transposase,integrase	Escherichia_phage(45.0%)	53	63705:63764	76366:77186
WP_001553854.1|20648_23765_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
WP_001553855.1|23886_25170_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.9e-10
WP_001553856.1|25166_26723_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
WP_001190712.1|26905_27127_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|27126_27507_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|27511_27691_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|27718_28078_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513659.1|28364_28682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012372828.1|28909_29926_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001373486.1|30133_31537_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|31523_32456_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000361612.1|35609_36587_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_001066942.1|36871_37612_-	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_032156742.1|37732_37858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|39057_40227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105060.1|40422_40716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421272.1|40821_41097_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001387467.1|41096_41381_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000562172.1|41985_42738_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001022265.1|42783_43749_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000710783.1|43781_44162_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_001077068.1|44186_45077_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_001403365.1|46060_46927_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_001271561.1|46916_47804_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_000922702.1|47814_48639_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_000950177.1|48644_49718_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
WP_000476108.1|49710_51021_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001067855.1|52940_53645_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000874189.1|54354_54840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267177.1|54864_55350_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|55336_56032_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729220.1|56036_57167_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|57156_58440_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|58442_59822_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|59925_60453_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|60493_62380_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|62726_63542_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
63705:63764	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067834.1|63767_64472_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000219391.1|64593_65499_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|65495_66734_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|66733_67318_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|67810_68575_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|68801_69107_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|69117_70323_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|70478_70682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|70809_71649_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|71642_71990_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|72195_72984_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|73114_73588_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|73745_74759_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|74961_75312_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001553864.1|75437_75767_+	transposon Tn21 resolvase	NA	M9Q1K0	Clostridium_phage	55.6	6.9e-09
WP_001067834.1|75657_76362_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
76366:77186	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCATCGGCGTAGTAGTGGATGTGGTCGATGACAAAGCCGGTGCGGGTCAGCGTGCGCCGGAGGATCGGCAGAAAATCGACCAGGAACGAAGTAGCGCGTGTGACGACGGCCGGTACGCCGACACGCGCCACGGCCTCGGCCCAGCGCGCGGCCGGCGGTTGGAGCAGGCCGTTGTGCACCGAACCGTGGTAGGTGCCGACCGCCAATGTGAGCCAGCGCTCTAGCTCGCGCAGCGTCAGGGCGGCCTTGTTTTCGGAATCGTAGTCGCCGCGCTGGTCAGGGTTGGAGAAGGTCGTTCCCGGCAGTTCGTCGTGAATCATCTGCATCGCCGTGCCGATGATCCGTTCCACGATGCCGCCATAGTGCGGCTGTCCCAGCGGGCGATAGTCCAGCCGGATGCCATGCTGCTCGCAACCCCGGCGCAGGGCCTCGCTCTTGAACTCGGCCGCGTTGTCTAGGTAGAGCAGCAAGGGCTTGCCGCTCATCTGCCAATCCATTTCCACGTTCAGTCCTTCCAGCCAAGGGCGCTTGTCGCAGGCGACATGCACGAGGCACAGGCCAACCGAAACGGCAGACGGCGCTTCCAGCGTGACGACCATGCCGAGCACGCAGCGGGTGAACACGTCGATGGCGAGGGTCAGGTACGGGCGGCCAATAGGTTGCCGGTCGCGGTCATCGACCACGATCAGGTCGATGACCGTATGGTCTATCTGCACCTGCTCCAGCGGCGCGGTCACGGCAGGAGGCTCGCCGCCCACACCT	NA	NA	NA	NA
>prophage 3
NZ_CP041338	Escherichia coli strain CCUG 73778 plasmid pSUH-1, complete sequence	161372	79726	84496	161372	transposase	Enterobacteria_phage(100.0%)	3	NA	NA
WP_000027057.1|79726_80587_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|80769_81327_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001143760.1|81490_84496_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
>prophage 4
NZ_CP041338	Escherichia coli strain CCUG 73778 plasmid pSUH-1, complete sequence	161372	93291	94001	161372		Enterobacteria_phage(50.0%)	2	NA	NA
WP_059330006.1|93291_93654_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	88.5	9.0e-34
WP_000624725.1|93650_94001_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
>prophage 5
NZ_CP041338	Escherichia coli strain CCUG 73778 plasmid pSUH-1, complete sequence	161372	105101	105848	161372		Xanthomonas_phage(100.0%)	1	NA	NA
WP_000205701.1|105101_105848_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.0	9.3e-09
>prophage 6
NZ_CP041338	Escherichia coli strain CCUG 73778 plasmid pSUH-1, complete sequence	161372	129480	129702	161372		Vibrio_virus(100.0%)	1	NA	NA
WP_001278692.1|129480_129702_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	39.4	4.4e-07
>prophage 7
NZ_CP041338	Escherichia coli strain CCUG 73778 plasmid pSUH-1, complete sequence	161372	137753	138575	161372		Yersinia_phage(100.0%)	1	NA	NA
WP_001234465.1|137753_138575_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	37.8	1.7e-43
>prophage 8
NZ_CP041338	Escherichia coli strain CCUG 73778 plasmid pSUH-1, complete sequence	161372	144799	146230	161372		Bacillus_phage(100.0%)	1	NA	NA
WP_000813680.1|144799_146230_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	24.5	1.2e-28
>prophage 9
NZ_CP041338	Escherichia coli strain CCUG 73778 plasmid pSUH-1, complete sequence	161372	149791	155535	161372	transposase	Enterobacteria_phage(33.33%)	5	NA	NA
WP_153435661.1|149791_150802_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.8	1.4e-15
WP_087523611.1|151763_153036_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	1.8e-174
WP_089634947.1|153021_153591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047605447.1|154691_154946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348621.1|154971_155535_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
>prophage 1
NZ_CP041339	Escherichia coli strain CCUG 73778 plasmid pSUH-2, complete sequence	79945	23879	56277	79945	transposase	Escherichia_phage(38.46%)	35	NA	NA
WP_000080195.1|23879_25493_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|25523_25874_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|25870_26296_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001312861.1|26653_26812_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001309233.1|26891_27071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276217.1|27091_27811_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845953.1|27807_28242_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000006003.1|30394_30628_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000290834.1|30685_31213_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_001298559.1|32061_32625_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
WP_000170695.1|32671_34033_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|34084_34315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027493.1|35352_35544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001763816.1|35540_35963_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001671341.1|36009_36312_-	antirestriction protein	NA	NA	NA	NA	NA
WP_011161242.1|36407_36980_-	YubH family protein	NA	NA	NA	NA	NA
WP_000274503.1|37679_38114_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104881.1|38127_38349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|38349_39033_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_032146011.1|39109_39403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000959884.1|39549_40512_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_000361389.1|40514_40865_+	protein stbB	NA	NA	NA	NA	NA
WP_001333089.1|40987_41269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071557810.1|43079_43220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|43210_43915_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000608644.1|44063_45326_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|45581_46457_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|46503_46836_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|49157_49862_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002063889.1|51055_51598_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|51610_52471_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_001067855.1|52577_53282_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|53913_54744_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|54874_55429_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|55572_56277_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
