The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045661	Klebsiella pneumoniae strain SMU18037509 chromosome, complete genome	5365096	1641614	1648519	5365096	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1641614_1642478_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004180550.1|1642488_1643262_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_032447988.1|1643502_1644396_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	1.6e-15
WP_032447732.1|1644641_1646003_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1646321_1647044_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_032447731.1|1647040_1648519_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 2
NZ_CP045661	Klebsiella pneumoniae strain SMU18037509 chromosome, complete genome	5365096	2155371	2171786	5365096	integrase,transposase	Salmonella_phage(44.44%)	21	2149499:2149513	2162106:2162120
2149499:2149513	attL	CTGCGCCAGCAGCTG	NA	NA	NA	NA
WP_004184554.1|2155371_2156619_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	48.4	2.7e-114
WP_012967855.1|2156618_2156834_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	54.9	7.7e-17
WP_004184543.1|2156898_2157138_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	73.1	2.9e-25
WP_004184542.1|2157145_2157454_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	4.2e-24
WP_040217603.1|2157450_2158062_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	77.3	8.3e-40
WP_004184539.1|2158054_2158408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019704421.1|2158442_2159531_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	53.0	8.0e-102
WP_117116830.1|2159543_2162585_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	60.9	2.4e-297
2162106:2162120	attR	CTGCGCCAGCAGCTG	NA	NA	NA	NA
WP_023282477.1|2162722_2162878_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
WP_117116831.1|2162886_2163078_-	YebW family protein	NA	NA	NA	NA	NA
WP_023313093.1|2163470_2164031_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	38.3	2.0e-08
WP_023313094.1|2164171_2164402_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	63.5	4.7e-20
WP_048324700.1|2164404_2164941_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	69.5	4.4e-61
WP_117116833.1|2165069_2165864_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.0	1.8e-63
WP_117116835.1|2165929_2166769_+	hypothetical protein	NA	Q8HA96	Salmonella_phage	51.3	1.5e-23
WP_153517866.1|2166771_2167521_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	81.5	1.3e-116
WP_041937617.1|2167528_2167897_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	39.0	2.2e-11
WP_110185435.1|2167893_2168097_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	86.6	9.1e-28
WP_153517867.1|2168412_2168727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019441.1|2169242_2170223_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_110185434.1|2170673_2171786_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	31.4	8.9e-32
>prophage 3
NZ_CP045661	Klebsiella pneumoniae strain SMU18037509 chromosome, complete genome	5365096	2730652	2741539	5365096		Escherichia_phage(87.5%)	9	NA	NA
WP_023313136.1|2730652_2733760_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2733814_2735080_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2735110_2736199_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|2736285_2736546_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004176269.1|2736843_2737704_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2737724_2738486_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2738746_2739649_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|2739660_2740926_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|2740918_2741539_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
NZ_CP045661	Klebsiella pneumoniae strain SMU18037509 chromosome, complete genome	5365096	2776830	2882591	5365096	tail,capsid,integrase,terminase,protease,head,holin,portal	Salmonella_phage(27.12%)	109	2803056:2803072	2892062:2892078
WP_032429517.1|2776830_2777568_+|protease	serine protease	protease	NA	NA	NA	NA
WP_004224649.1|2777581_2777698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903683.1|2777741_2778071_-	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
WP_002903681.1|2778057_2778420_-	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
WP_002903679.1|2778862_2779897_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004176297.1|2780121_2781777_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_021469330.1|2781776_2782619_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_004143106.1|2782636_2782936_+	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_032105170.1|2782928_2783762_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_032447538.1|2783761_2784562_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_032447537.1|2785677_2786295_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_032447535.1|2786294_2787197_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_002903632.1|2787186_2788113_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004190310.1|2788270_2789926_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_004179719.1|2790189_2791110_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_004179716.1|2791273_2791630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004183910.1|2791785_2793402_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004176303.1|2793398_2794118_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_153517882.1|2794098_2795049_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_004152245.1|2795116_2797894_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.1	6.2e-66
WP_004148278.1|2798535_2800047_+	anion permease	NA	NA	NA	NA	NA
WP_004152246.1|2800101_2801754_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_032447533.1|2801916_2803533_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
2803056:2803072	attL	GATTGGCGTGCTGGCGA	NA	NA	NA	NA
WP_004143067.1|2804609_2804999_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_004151556.1|2804991_2805756_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_032447532.1|2805745_2807098_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_004179693.1|2807107_2808310_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_004151559.1|2808320_2808977_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_002903522.1|2808987_2809674_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_004143057.1|2809843_2810650_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_009760676.1|2810646_2811210_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_032447972.1|2811311_2812220_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032414878.1|2812386_2813697_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_023283652.1|2813696_2815142_+	amidohydrolase	NA	NA	NA	NA	NA
WP_074421941.1|2815261_2816380_+	aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_064155873.1|2816508_2817606_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	57.3	3.5e-113
WP_153517883.1|2817615_2818452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153517884.1|2818733_2819411_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	4.5e-79
WP_153517885.1|2819867_2821133_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.4	5.1e-209
WP_153517886.1|2821134_2821554_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	8.5e-36
WP_004152765.1|2821633_2823118_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_032422722.1|2824012_2824435_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	43.8	8.9e-25
WP_063266881.1|2824485_2825064_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	97.3	3.0e-92
WP_153517887.1|2826986_2827664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135689293.1|2827874_2828609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153517888.1|2828621_2830772_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.0	1.1e-89
WP_153517889.1|2830848_2833917_-	kinase	NA	A0A286S259	Klebsiella_phage	96.4	0.0e+00
WP_004104210.1|2833913_2834294_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	96.8	2.8e-70
WP_153517890.1|2834303_2834786_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	94.4	6.9e-82
WP_153517891.1|2834966_2835437_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	97.4	6.7e-90
WP_023343208.1|2835436_2837872_-|tail	lambda family phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	88.9	0.0e+00
WP_042346245.1|2837941_2838334_-	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	42.2	3.6e-20
WP_112293585.1|2838397_2838661_-|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	89.7	7.9e-40
WP_153517892.1|2838663_2839047_-|tail	phage tail protein	tail	A0A286S1N4	Klebsiella_phage	85.5	5.9e-52
WP_023343205.1|2839093_2839624_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	90.3	8.7e-86
WP_023343204.1|2839803_2840286_-	hypothetical protein	NA	Q9MCU9	Escherichia_phage	58.9	7.5e-52
WP_023343203.1|2840350_2840713_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	78.5	1.3e-48
WP_023343202.1|2840709_2841195_-	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	65.2	8.9e-53
WP_060598764.1|2841187_2841538_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	62.1	6.6e-34
WP_072122458.1|2841539_2841752_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	67.1	2.5e-12
WP_072122459.1|2841823_2842150_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	57.4	1.1e-25
WP_153517893.1|2842146_2843517_-|portal	phage portal protein	portal	S4TNN1	Salmonella_phage	83.3	7.8e-70
WP_117095359.1|2843513_2844872_-|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	83.2	2.1e-221
WP_080819801.1|2845077_2847012_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	90.8	0.0e+00
WP_049009200.1|2847070_2848729_-|terminase	terminase large subunit	terminase	Q3HQS7	Burkholderia_phage	70.9	2.7e-234
WP_060598770.1|2848732_2849245_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	67.3	1.0e-51
WP_048290404.1|2849424_2849793_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	79.8	1.8e-50
WP_112293582.1|2849785_2850373_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	66.5	4.5e-75
WP_153517939.1|2850534_2851992_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	87.2	1.1e-258
WP_110226811.1|2852450_2852990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100751201.1|2853067_2853313_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	1.2e-34
WP_032735910.1|2854587_2854947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139015922.1|2855500_2855620_+	small membrane protein	NA	NA	NA	NA	NA
WP_110227683.1|2855927_2856200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012967895.1|2856667_2856850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153517894.1|2857055_2857682_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	76.3	3.4e-89
WP_012967892.1|2857681_2857963_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	72.0	3.8e-32
WP_004213330.1|2857949_2858345_-	membrane protein	NA	G8C7V8	Escherichia_phage	73.1	1.5e-45
WP_110226810.1|2859428_2860718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142669431.1|2860714_2861155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110226809.1|2861508_2862558_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	76.5	8.1e-168
WP_153517895.1|2862707_2862899_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	82.5	1.6e-21
WP_060598778.1|2863108_2863939_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.9	2.2e-59
WP_153517896.1|2863957_2864944_-	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	49.8	1.5e-91
WP_153517897.1|2865025_2865847_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	65.4	5.3e-90
WP_153517898.1|2865936_2866335_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	69.7	8.0e-44
WP_153517899.1|2866331_2866808_-|protease	SOS-response repressor and protease LexA	protease	U5P451	Shigella_phage	60.3	6.1e-14
WP_153517900.1|2866804_2868655_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.6	2.7e-198
WP_153517901.1|2868647_2870030_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	48.8	2.3e-106
WP_088661490.1|2870017_2870476_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_064175908.1|2870472_2871384_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	73.8	1.3e-52
WP_023322342.1|2871373_2871553_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
WP_008806043.1|2871725_2872277_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	69.9	2.2e-68
WP_023343174.1|2872321_2872522_-	hypothetical protein	NA	U5P445	Shigella_phage	80.0	4.3e-22
WP_008806042.1|2872609_2873269_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	86.3	4.7e-113
WP_153517902.1|2873466_2873700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048999619.1|2874814_2875186_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	79.5	7.0e-50
WP_116961320.1|2875238_2876069_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	81.3	6.0e-126
WP_153517903.1|2876204_2876732_+	HD family hydrolase	NA	A0A192Y8M4	Salmonella_phage	70.5	1.3e-62
WP_102015530.1|2876731_2876932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102015529.1|2876924_2877710_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.7	5.6e-65
WP_153517904.1|2877837_2878254_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	40.0	2.7e-10
WP_153517905.1|2878247_2878454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153517906.1|2878450_2878855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040227357.1|2879303_2879729_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	81.5	5.5e-59
WP_153517907.1|2880179_2880746_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	63.0	4.8e-66
WP_017880203.1|2880753_2881017_+	pyocin activator PrtN family protein	NA	A0A1L5C290	Pseudoalteromonas_phage	44.1	7.7e-11
WP_002903398.1|2881624_2881783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032447531.1|2882075_2882591_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	46.6	1.2e-18
2892062:2892078	attR	TCGCCAGCACGCCAATC	NA	NA	NA	NA
>prophage 5
NZ_CP045661	Klebsiella pneumoniae strain SMU18037509 chromosome, complete genome	5365096	3459983	3549969	5365096	tail,capsid,lysis,tRNA,plate,integrase,terminase,protease,head,portal	Salmonella_phage(51.79%)	88	3515559:3515579	3550707:3550727
WP_002898139.1|3459983_3461276_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_004224013.1|3461366_3462710_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	5.6e-81
WP_002898132.1|3462718_3463330_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_058343169.1|3463452_3467706_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3467841_3468336_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|3468841_3469837_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|3469951_3471718_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_153517918.1|3471718_3473440_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	9.0e-15
WP_002898014.1|3473484_3474186_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3474539_3474758_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3474876_3477156_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3477186_3477504_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3477829_3478051_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3478127_3480068_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_004191152.1|3480064_3481180_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004176693.1|3481326_3482985_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3483404_3484100_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004183530.1|3484215_3485115_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_004183528.1|3485258_3486911_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_032447455.1|3486921_3487890_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3488101_3488536_-	DoxX family protein	NA	NA	NA	NA	NA
WP_004176700.1|3488687_3490406_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_004209683.1|3490444_3491446_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_021313342.1|3491456_3492899_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3492986_3494000_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032447453.1|3493996_3494827_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004176708.1|3494858_3495998_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3496875_3497391_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3497617_3498346_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3498366_3499098_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3499104_3499821_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004141917.1|3499820_3500489_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3500672_3501404_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3501490_3502963_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_032447452.1|3502959_3503676_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	1.2e-34
WP_002896378.1|3503754_3504882_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3504923_3505412_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896371.1|3506250_3507204_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3507214_3508348_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3508511_3509624_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3509972_3510452_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_009484278.1|3510540_3511443_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.9	7.7e-34
WP_004141950.1|3511557_3512280_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_008805812.1|3512263_3512551_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3512753_3513017_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3513023_3513407_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3513673_3515359_+	transporter	NA	NA	NA	NA	NA
3515559:3515579	attL	TGGCGACAAAGTGGCGACAGC	NA	NA	NA	NA
WP_004223962.1|3515580_3515799_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	66.2	8.3e-19
WP_085855784.1|3515885_3516983_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	82.0	1.3e-168
WP_004223957.1|3516979_3517465_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	5.0e-64
WP_004223954.1|3517461_3520092_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.9	6.8e-115
WP_002896220.1|3520084_3520204_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004223950.1|3520218_3520518_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	77.0	1.4e-32
WP_004150986.1|3520570_3521086_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004223947.1|3521095_3522268_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.8	5.4e-205
WP_032458718.1|3522406_3523567_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	50.0	1.2e-44
WP_004223943.1|3523644_3523920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004223940.1|3523933_3526159_-	hypothetical protein	NA	K4I5E8	Salmonella_phage	41.3	3.0e-10
WP_004223933.1|3526164_3526761_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	56.0	1.8e-55
WP_004223930.1|3526753_3527662_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	3.4e-106
WP_004174325.1|3527648_3528011_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	9.9e-49
WP_004223927.1|3528007_3528580_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	2.1e-77
WP_014599113.1|3528683_3529346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004223923.1|3529358_3529811_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.4	6.5e-50
WP_004223921.1|3529803_3530235_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_004223918.1|3530330_3530759_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	5.6e-51
WP_004223915.1|3530763_3531273_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	9.5e-82
WP_004223911.1|3531253_3531469_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	85.9	1.5e-28
WP_002896155.1|3531472_3531676_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_004223908.1|3531675_3532140_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	84.4	6.7e-74
WP_004174300.1|3532236_3532887_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	86.6	9.6e-103
WP_004223906.1|3532890_3533943_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	89.1	2.1e-171
WP_004223903.1|3533959_3534793_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	74.4	2.2e-99
WP_032448015.1|3534932_3536696_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	92.6	0.0e+00
WP_004223897.1|3536695_3537724_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	90.3	6.2e-173
WP_032448014.1|3537770_3539435_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.9	4.5e-11
WP_004152765.1|3539991_3541476_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004223883.1|3544341_3544569_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	80.0	7.8e-28
WP_004223882.1|3544568_3544805_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	55.4	8.2e-12
WP_004223879.1|3544872_3545214_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	80.5	1.3e-45
WP_004223870.1|3545177_3545378_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	80.3	1.2e-24
WP_004223868.1|3545385_3545895_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	82.1	1.4e-72
WP_004223867.1|3545927_3546149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004223865.1|3546274_3546835_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	44.8	2.0e-40
WP_004223864.1|3546846_3547431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004223862.1|3547441_3548515_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	40.0	1.1e-68
WP_004223857.1|3548492_3548864_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	52.4	6.2e-30
WP_004223856.1|3548943_3549969_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	5.2e-103
3550707:3550727	attR	TGGCGACAAAGTGGCGACAGC	NA	NA	NA	NA
>prophage 6
NZ_CP045661	Klebsiella pneumoniae strain SMU18037509 chromosome, complete genome	5365096	4020527	4027490	5365096	integrase,tRNA	Moraxella_phage(16.67%)	8	4022034:4022048	4024529:4024543
WP_004177036.1|4020527_4021337_-	hypothetical protein	NA	A0A0R6PJV6	Moraxella_phage	56.8	3.5e-30
WP_004177037.1|4021350_4021782_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.6	8.2e-26
WP_029602956.1|4021781_4021994_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	47.2	3.2e-07
4022034:4022048	attL	AGTAGACTTCAGGAG	NA	NA	NA	NA
WP_004177038.1|4022105_4023038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117071181.1|4023182_4024397_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.6	2.1e-127
WP_004143017.1|4024978_4025845_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4024529:4024543	attR	AGTAGACTTCAGGAG	NA	NA	NA	NA
WP_004143016.1|4025846_4026059_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004191607.1|4026104_4027490_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 1
NZ_CP045662	Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence	143263	4243	58546	143263	transposase	Enterobacteria_phage(22.73%)	42	NA	NA
WP_153517945.1|4243_5167_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	6.6e-166
WP_048985180.1|5882_6347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153517946.1|8484_9366_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.6	7.7e-164
WP_153517941.1|11819_12728_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.3	9.4e-165
WP_023288328.1|12783_13521_-	hypothetical protein	NA	K4HZD4	Acidithiobacillus_phage	48.1	1.3e-55
WP_032720733.1|13537_15082_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	48.6	4.3e-133
WP_048984487.1|15758_17630_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_048984486.1|17687_18197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021567410.1|18248_19004_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_048984483.1|19000_22285_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.4	4.3e-66
WP_048984481.1|22354_24139_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_048984479.1|24161_24845_-	YecA family protein	NA	NA	NA	NA	NA
WP_048984478.1|24841_26047_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_048984476.1|26036_27560_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	1.4e-88
WP_153517947.1|27828_28752_-|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	7.8e-175
WP_053090837.1|28818_29127_-	hypothetical protein	NA	A0A222YY57	Escherichia_phage	49.4	1.6e-15
WP_011251286.1|29196_29616_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011251285.1|29612_29924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023288266.1|30679_31018_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	81.0	2.3e-47
WP_004114612.1|31014_31362_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
WP_064188805.1|31410_32949_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	93.8	1.4e-277
WP_017900720.1|33539_33974_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152084.1|34189_35590_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_048985687.1|35586_36267_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	33.9	1.5e-29
WP_004118344.1|36321_37251_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|37255_37636_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_153517948.1|37675_38572_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|38571_40389_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_000019441.1|41085_42066_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
WP_000287501.1|42561_43299_+	peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
WP_000843497.1|43332_43530_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004187133.1|43570_46018_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	4.4e-84
WP_048985692.1|46144_46585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048985694.1|46671_49818_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.6	6.1e-62
WP_004098959.1|49828_51121_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098961.1|51234_51588_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004098962.1|51616_53002_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697969.1|53191_53872_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_000555737.1|53864_55340_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000790483.1|55590_56022_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_048985700.1|56165_56516_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.4	3.2e-20
WP_153517949.1|57622_58546_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	7.3e-173
>prophage 2
NZ_CP045662	Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence	143263	66542	73705	143263		uncultured_Caudovirales_phage(57.14%)	10	NA	NA
WP_004152282.1|66542_67310_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|67408_67702_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_071526715.1|68032_68275_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_007898882.1|68424_68850_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.9e-51
WP_007898880.1|68862_70152_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.1	4.4e-168
WP_004206577.1|70196_70517_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	2.9e-20
WP_016151343.1|70602_71301_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	4.5e-90
WP_004206574.1|71429_71735_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004206572.1|71745_72951_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_004206571.1|73126_73705_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	37.7	3.9e-23
>prophage 3
NZ_CP045662	Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence	143263	135847	142534	143263	transposase	Stx2-converting_phage(33.33%)	6	NA	NA
WP_004902302.1|135847_137440_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004189161.1|137470_137821_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004189163.1|137817_138258_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_004902307.1|138454_138637_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_004117790.1|140396_141368_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_023287153.1|141367_142534_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	7.5e-223
