The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	0	16111	4030371	integrase	Acinetobacter_phage(45.45%)	28	3221:3235	18284:18298
WP_002029044.1|1238_1625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000606801.1|1630_2605_-	phosphoadenosine phosphosulfate reductase family protein	NA	A4JX51	Burkholderia_virus	48.5	8.8e-76
WP_000218432.1|2601_3249_-	hypothetical protein	NA	R9VWB9	Serratia_phage	38.6	2.0e-31
3221:3235	attL	GAATTAAATAAAATT	NA	NA	NA	NA
WP_000575725.1|3245_3701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000200039.1|3697_3883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114213685.1|3879_4080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818521.1|4113_4488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114189613.1|4523_4727_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001108434.1|4862_5627_+	S24 family peptidase	NA	A0A0P0I8E0	Acinetobacter_phage	63.0	1.6e-77
WP_114189612.1|5630_5915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105905.1|6108_6441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114213686.1|6481_7285_+	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	32.3	8.1e-27
WP_000350172.1|7369_7630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072362.1|7688_8018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260063.1|8014_8386_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	38.8	2.2e-11
WP_000644001.1|8556_9237_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_114213687.1|9249_10278_+	ead/Ea22-like family protein	NA	A0A2I7QY11	Vibrio_phage	29.0	3.8e-13
WP_000986115.1|10418_10709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464381.1|10709_10889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000609004.1|10881_11418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000578497.1|11414_11924_+	phage protein	NA	A0A0P0I8H3	Acinetobacter_phage	87.8	1.6e-33
WP_000028957.1|11920_12130_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	94.2	6.3e-32
WP_001292077.1|12126_12342_+	hypothetical protein	NA	I2GUB6	Acinetobacter_phage	92.9	8.5e-32
WP_000119264.1|12342_12513_+	hypothetical protein	NA	A0A2H4JBW6	uncultured_Caudovirales_phage	69.2	2.4e-13
WP_000527288.1|12519_13512_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000549863.1|13626_14082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076477.1|14072_14957_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000947475.1|14953_16111_-|integrase	site-specific integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	63.0	4.9e-134
18284:18298	attR	GAATTAAATAAAATT	NA	NA	NA	NA
>prophage 2
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	29020	32617	4030371		Lactobacillus_virus(100.0%)	1	NA	NA
WP_000698785.1|29020_32617_+	AAA family ATPase	NA	Q5ULP4	Lactobacillus_virus	27.4	3.4e-08
>prophage 3
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	41926	46061	4030371		Bacillus_phage(66.67%)	3	NA	NA
WP_001102845.1|41926_43345_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.4	1.3e-40
WP_000868152.1|43544_43997_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	57.5	2.0e-46
WP_000093035.1|44021_46061_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.7	3.2e-112
>prophage 4
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	53455	57705	4030371		Mycobacterium_phage(50.0%)	2	NA	NA
WP_000127823.1|53455_56488_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	45.0	8.5e-77
WP_001276144.1|56757_57705_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	3.2e-62
>prophage 5
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	62195	65619	4030371		Cedratvirus(50.0%)	2	NA	NA
WP_001029610.1|62195_63386_-	elongation factor Tu	NA	A0A1M7XUR5	Cedratvirus	31.3	8.1e-15
WP_000113824.1|63480_65619_-	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	25.1	2.1e-50
>prophage 6
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	72391	74017	4030371		Agrobacterium_phage(100.0%)	1	NA	NA
WP_000834616.1|72391_74017_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.9	6.6e-92
>prophage 7
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	78993	81632	4030371		Acanthamoeba_polyphaga_moumouvirus(50.0%)	2	NA	NA
WP_000214723.1|78993_79968_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	29.1	7.3e-30
WP_001984224.1|79979_81632_-	BCCT family carnitine transporter	NA	A0A2I7QNT1	Vibrio_phage	23.4	1.6e-08
>prophage 8
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	85758	87127	4030371		uncultured_Mediterranean_phage(66.67%)	3	NA	NA
WP_001979799.1|85758_86022_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.0	2.4e-20
WP_000047853.1|86023_86515_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.3	3.7e-30
WP_001029798.1|86650_87127_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.3	4.2e-23
>prophage 9
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	91128	92994	4030371		Caulobacter_phage(100.0%)	1	NA	NA
WP_001007229.1|91128_92994_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	31.1	7.1e-58
>prophage 10
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	97981	98932	4030371		Tupanvirus(100.0%)	1	NA	NA
WP_001133287.1|97981_98932_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	38.9	3.3e-43
>prophage 11
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	103256	107285	4030371		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000096538.1|103256_103916_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.9	2.8e-41
WP_000985175.1|103980_104655_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_001247938.1|104752_105520_+	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_000522216.1|105565_106039_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_001279871.1|106229_106466_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	1.1e-11
WP_000191300.1|106550_107285_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.0	2.2e-18
>prophage 12
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	111723	117179	4030371		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_000093856.1|111723_112320_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.2	4.2e-20
WP_001291248.1|112361_113285_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_000016597.1|113348_113993_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000055843.1|113993_114743_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000054334.1|114739_115897_-	8-amino-7-oxononanoate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	25.5	4.6e-31
WP_000131430.1|115898_117179_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.2	7.6e-19
>prophage 13
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	122902	124939	4030371		Ralstonia_phage(100.0%)	1	NA	NA
WP_001018842.1|122902_124939_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	38.3	6.0e-119
>prophage 14
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	144668	145238	4030371		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000985728.1|144668_145238_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.0	3.3e-75
>prophage 15
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	180656	189923	4030371		Bacillus_phage(40.0%)	8	NA	NA
WP_001147032.1|180656_182078_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.6	2.5e-15
WP_011858483.1|182224_182524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000226704.1|182546_184139_-	sensor histidine kinase BfmS	NA	Q8QKV4	Ectocarpus_siliculosus_virus	23.6	1.2e-05
WP_000076440.1|184228_184945_-	response regulator transcription factor BfmR	NA	W8CYM9	Bacillus_phage	37.7	3.1e-38
WP_000143214.1|184941_185148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111540.1|185477_188312_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	46.4	7.7e-181
WP_000465010.1|188367_188502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000025829.1|188639_189923_+	ribonucleotide-diphosphate reductase subunit beta	NA	M1IA80	Paramecium_bursaria_Chlorella_virus	33.4	5.4e-41
>prophage 16
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	194985	195828	4030371		uncultured_marine_virus(100.0%)	1	NA	NA
WP_000134740.1|194985_195828_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0F7L647	uncultured_marine_virus	34.2	2.0e-23
>prophage 17
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	236105	237416	4030371		Burkholderia_virus(100.0%)	1	NA	NA
WP_000383637.1|236105_237416_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.9	1.5e-49
>prophage 18
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	253385	253865	4030371		Streptococcus_phage(100.0%)	1	NA	NA
WP_000927482.1|253385_253865_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.9	4.5e-25
>prophage 19
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	260633	260906	4030371		uncultured_virus(100.0%)	1	NA	NA
WP_000843456.1|260633_260906_+	DUF2218 domain-containing protein	NA	A0A218MNG7	uncultured_virus	45.3	8.3e-08
>prophage 20
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	303353	306125	4030371		uncultured_virus(100.0%)	1	NA	NA
WP_001134660.1|303353_306125_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	1.1e-65
>prophage 21
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	311563	320283	4030371	tRNA	Streptomyces_phage(25.0%)	10	NA	NA
WP_001276875.1|311563_311890_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	43.2	2.0e-16
WP_001054522.1|312211_313480_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_002127429.1|313674_313800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000897685.1|313894_314140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126166.1|314309_314606_-	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	39.3	3.5e-12
WP_000703074.1|314602_316984_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000050953.1|317017_317998_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.8	1.5e-35
WP_001207245.1|318155_319157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803551.1|319163_319667_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000650943.1|319725_320283_-	NADAR family protein	NA	A0A1S6UAJ7	Serratia_phage	45.3	1.1e-33
>prophage 22
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	323784	328304	4030371	tRNA	Agrobacterium_phage(33.33%)	3	NA	NA
WP_012297364.1|323784_324336_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.6	1.9e-11
WP_001121792.1|324341_326264_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	38.0	9.1e-125
WP_000253052.1|326675_328304_+	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	3.9e-28
>prophage 23
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	332230	333664	4030371		Bacillus_virus(100.0%)	1	NA	NA
WP_169538972.1|332230_333664_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	31.1	3.5e-20
>prophage 24
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	338270	344406	4030371		Streptococcus_phi-m46.1-like_phage(50.0%)	3	NA	NA
WP_000813062.1|338270_339662_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	26.6	1.4e-29
WP_001212164.1|339671_340490_-	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_000064534.1|341598_344406_+	response regulator	NA	A0A1V0SGX0	Hokovirus	29.4	2.2e-50
>prophage 25
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	357538	358303	4030371	tRNA	Pandoravirus(100.0%)	1	NA	NA
WP_001281716.1|357538_358303_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	29.6	2.0e-14
>prophage 26
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	364655	366248	4030371		Tupanvirus(100.0%)	1	NA	NA
WP_000008538.1|364655_366248_-	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	32.9	1.5e-11
>prophage 27
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	369604	383890	4030371	tRNA	Bacillus_phage(20.0%)	10	NA	NA
WP_000510213.1|369604_371659_-	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.9	2.6e-21
WP_001165443.1|371989_373006_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_001215920.1|373038_373530_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_000422094.1|373529_375254_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.2	5.4e-52
WP_001054470.1|375758_376088_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_000155773.1|376274_378899_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	41.4	6.9e-176
WP_000549819.1|378926_379436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762831.1|379455_380445_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001124214.1|380552_381893_+	MacA family efflux pump subunit	NA	A0A140XAI1	Dickeya_phage	50.0	9.7e-17
WP_000165904.1|381895_383890_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	1.3e-36
>prophage 28
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	387202	389736	4030371		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	4	NA	NA
WP_000099436.1|387202_387769_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.0	2.0e-27
WP_001174001.1|387894_388953_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_000443006.1|389050_389467_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000729828.1|389478_389736_+	glutaredoxin 3	NA	A0A248SKD6	Salicola_phage	39.7	1.2e-08
>prophage 29
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	400245	401781	4030371		Catovirus(100.0%)	1	NA	NA
WP_001265376.1|400245_401781_-	aromatic amino acid lyase	NA	A0A1V0S940	Catovirus	30.6	1.3e-57
>prophage 30
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	411262	412555	4030371	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000095264.1|411262_412555_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	5.3e-20
>prophage 31
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	416641	421683	4030371		Powai_lake_megavirus(50.0%)	5	NA	NA
WP_000963851.1|416641_417073_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.5	6.7e-20
WP_000524329.1|417186_417387_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000669567.1|417486_418038_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000348500.1|418062_419361_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_000776304.1|419499_421683_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	48.8	2.0e-184
>prophage 32
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	425489	426755	4030371		Streptococcus_phage(100.0%)	1	NA	NA
WP_001154159.1|425489_426755_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.9	3.6e-98
>prophage 33
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	441920	443941	4030371	protease	Bacillus_virus(50.0%)	2	NA	NA
WP_001289250.1|441920_443234_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.0e-127
WP_000289452.1|443335_443941_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	60.6	1.2e-62
>prophage 34
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	448218	448902	4030371		Cyanophage(100.0%)	1	NA	NA
WP_001984475.1|448218_448902_+	Fe2+-dependent dioxygenase	NA	A0A127KM56	Cyanophage	30.1	4.3e-21
>prophage 35
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	453647	454274	4030371		Cassava_brown_streak_virus(100.0%)	1	NA	NA
WP_000106708.1|453647_454274_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	D2KCJ6	Cassava_brown_streak_virus	30.8	8.9e-13
>prophage 36
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	464591	465988	4030371		Geobacillus_virus(50.0%)	2	NA	NA
WP_001203168.1|464591_465434_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	61.8	9.2e-98
WP_000312553.1|465478_465988_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	45.1	1.8e-24
>prophage 37
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	477113	489591	4030371		Bacillus_phage(25.0%)	11	NA	NA
WP_000050352.1|477113_479093_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	28.2	6.0e-63
WP_000859452.1|479209_479782_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_000265777.1|479919_480678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000024261.1|480765_483402_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	33.5	2.0e-90
WP_000368721.1|483437_483887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029768.1|484034_484412_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000648652.1|484511_485522_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000165735.1|485569_485815_-	SlyX family protein	NA	NA	NA	NA	NA
WP_000323476.1|485847_487758_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	1.3e-46
WP_000886284.1|487903_488536_+	LysE family translocator	NA	NA	NA	NA	NA
WP_000078878.1|488655_489591_+	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	33.3	1.8e-41
>prophage 38
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	510421	512716	4030371		Hokovirus(100.0%)	1	NA	NA
WP_000069129.1|510421_512716_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	29.2	4.7e-19
>prophage 39
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	536476	543004	4030371		Ostreococcus_lucimarinus_virus(33.33%)	9	NA	NA
WP_001096918.1|536476_537775_+	ABC transporter	NA	G9E4X0	Ostreococcus_lucimarinus_virus	31.1	2.2e-29
WP_001224256.1|537875_538130_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000046495.1|538382_538715_+	HopJ type III effector protein	NA	NA	NA	NA	NA
WP_000291738.1|539143_539524_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.3	3.0e-24
WP_000075984.1|539759_540170_-	GFA family protein	NA	NA	NA	NA	NA
WP_000066760.1|540247_541453_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_014466029.1|541442_542081_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001138289.1|542168_542363_+	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_000942274.1|542359_543004_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	31.6	5.3e-21
>prophage 40
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	560742	561699	4030371		Megavirus(100.0%)	1	NA	NA
WP_001107921.1|560742_561699_+	DnaJ domain-containing protein	NA	K7YGN1	Megavirus	49.4	6.7e-12
>prophage 41
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	568423	573964	4030371		Brevibacillus_phage(50.0%)	2	NA	NA
WP_000369435.1|568423_570175_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.1	2.6e-17
WP_002000661.1|570283_573964_-	UvrD-helicase domain-containing protein	NA	S5MMD7	Bacillus_phage	23.1	4.4e-11
>prophage 42
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	582443	587939	4030371		Ostreococcus_mediterraneus_virus(50.0%)	3	NA	NA
WP_000612218.1|582443_584063_+	2-octaprenylphenol hydroxylase	NA	A0A0P0C0S7	Ostreococcus_mediterraneus_virus	25.7	1.6e-29
WP_001066569.1|585653_586427_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_000065138.1|586436_587939_+	AAA family ATPase	NA	A0A075DXT4	Acinetobacter_phage	36.0	2.4e-80
>prophage 43
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	596361	599061	4030371		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_114213690.1|596361_599061_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.4	7.2e-27
>prophage 44
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	619495	620350	4030371		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001178150.1|619495_620350_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	53.3	3.6e-17
>prophage 45
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	625416	626331	4030371		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000598899.1|625416_626331_-	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.3	4.0e-38
>prophage 46
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	637186	639106	4030371		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001294942.1|637186_639106_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	2.0e-119
>prophage 47
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	642183	653177	4030371		uncultured_virus(33.33%)	6	NA	NA
WP_001987811.1|642183_643062_-	alpha/beta fold hydrolase	NA	A0A218MNI3	uncultured_virus	30.9	7.8e-07
WP_000996189.1|643179_643677_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_001034851.1|643705_644062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000738603.1|644275_644641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000653927.1|644808_649002_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.9	1.2e-68
WP_000331899.1|649088_653177_-	DNA-directed RNA polymerase subunit beta	NA	A0A2P0VMZ3	Tetraselmis_virus	26.0	3.6e-22
>prophage 48
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	657151	658342	4030371		Cedratvirus(100.0%)	1	NA	NA
WP_001029610.1|657151_658342_-	elongation factor Tu	NA	A0A1M7XUR5	Cedratvirus	31.3	8.1e-15
>prophage 49
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	662026	664303	4030371		Vibrio_phage(100.0%)	1	NA	NA
WP_001196426.1|662026_664303_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	35.2	2.0e-30
>prophage 50
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	684353	748732	4030371	transposase,integrase,tRNA	Brevibacillus_phage(14.29%)	61	721278:721337	757209:758327
WP_000216739.1|684353_685286_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000907680.1|685335_686532_-	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_000908243.1|686556_687903_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_000942498.1|688063_688315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278225.1|688335_690189_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_001991212.1|690185_690449_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_000608730.1|690592_691513_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	6.7e-33
WP_000011159.1|691659_692475_+	DsbC family protein	NA	NA	NA	NA	NA
WP_000805827.1|692719_694021_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000063593.1|694076_695216_+	threonine synthase	NA	NA	NA	NA	NA
WP_003384760.1|695322_696369_-	D-alanyl-D-alanine endopeptidase PBP7/8	NA	NA	NA	NA	NA
WP_000633799.1|696581_697217_+	response regulator	NA	NA	NA	NA	NA
WP_002001070.1|697272_698796_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.3	2.3e-06
WP_000840549.1|698820_700242_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_000128749.1|701444_702992_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_000881094.1|703117_704188_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000586912.1|704187_705288_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000673449.1|705431_706880_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	5.5e-50
WP_001151592.1|706872_707280_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_001988710.1|707318_707957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354154.1|708087_708306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493866.1|708365_709025_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.6	1.5e-34
WP_001083669.1|709067_710360_-	DNA adenine methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.6	2.5e-38
WP_001292506.1|710356_711442_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	5.1e-48
WP_000543541.1|711457_711916_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_000738520.1|712073_713471_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	5.4e-34
WP_000780326.1|713528_713867_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_000894500.1|714146_714374_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_000010465.1|714439_715297_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001144971.1|715379_717167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082319.1|717549_718353_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|718352_719189_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000743213.1|719308_719533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|719743_721237_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
721278:721337	attL	CACAGCGCCGCGGCAGGGATCCGCCGTGCTGGTTGTCGGAAAAGGAGCCGCTAGTGGGAA	NA	NA	NA	NA
WP_000512977.1|721474_721879_+	hypothetical protein	NA	NA	NA	NA	NA
721278:721337	attL	CACAGCGCCGCGGCAGGGATCCGCCGTGCTGGTTGTCGGAAAAGGAGCCGCTAGTGGGAA	NA	NA	NA	NA
WP_000088605.1|721856_722480_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089073.1|722561_723779_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_001144964.1|723861_725658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139024810.1|726015_727106_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001046004.1|727211_728033_+	carbapenem-hydrolyzing class D beta-lactamase OXA-23	NA	NA	NA	NA	NA
WP_001992510.1|728697_729252_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000262332.1|729259_729592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947913.1|729693_730783_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001277980.1|730787_732254_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.6	2.3e-213
WP_000034564.1|732266_733118_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
WP_001095006.1|733185_733485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529372.1|733557_733929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002017214.1|734303_735734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081835.1|735726_736842_-	TniQ family protein	NA	NA	NA	NA	NA
WP_000417085.1|736871_737792_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000573060.1|737796_739707_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000736396.1|739707_740418_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
WP_071543477.1|740622_740916_+	hypothetical protein	NA	NA	NA	NA	NA
740675:740871	attR	CACAGCGCCGCGGCAGGGATCCGCCGTGCTGGTTGTCGGAAAAGGAGCCGCTAGTGGGAAAGAGGAGGGTAAATTTTCAGCGTTGCTGGCTCCCCGTCAGCCGGATTGGGTTGCATCGCAGGGGTGTCGAAAGAGTCAACTGCGGTCCAAAGCTGTTGGACTTGGGTGAAAAGGGCGTTTATTCTTCCTATACGTTG	NA	NA	NA	NA
WP_000251875.1|740809_741112_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
740675:740871	attR	CACAGCGCCGCGGCAGGGATCCGCCGTGCTGGTTGTCGGAAAAGGAGCCGCTAGTGGGAAAGAGGAGGGTAAATTTTCAGCGTTGCTGGCTCCCCGTCAGCCGGATTGGGTTGCATCGCAGGGGTGTCGAAAGAGTCAACTGCGGTCCAAAGCTGTTGGACTTGGGTGAAAAGGGCGTTTATTCTTCCTATACGTTG	NA	NA	NA	NA
WP_085940413.1|742105_743195_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000573066.1|743617_745528_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000736393.1|745528_746239_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	5.3e-06
WP_000168733.1|746550_746820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000798673.1|746873_747230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001006517.1|747275_747593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886984.1|747799_748732_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	28.8	1.7e-23
757209:758327	attR	TATGAATACGATGTTAATAAGCCCAACTCTAAATGTTTCTTGTTCCGAAAATGTGCTGTTAAAAATATCCTCATACTTTGGTGTATCTCATGAACAAGCTTATCGAAAAGGCGTAGATTCTCTTTTAAAATTAACAGAGATGGTTATAGCAAATAATGAACATTCTGAAATTATTAAACTTTTTTTGTGTGATTGTCATTTAAGAACATCTATCAATTTAGATGATATATCCGATATGCCTACTCAATTGATAGGCGATTGCCTTAATGTGATTGTTCTACGTTATGCATTTGTAGTTTGACAATCAGGTCGTAAACTAGACATTAATGTTCTAAACTTAAACAATATATTTGTAAACCAAAAGGTTGAATAAATGGGACAAGCTAAACAAAGGGGTACACTTGAGCAAAGAGTAAAGCAAGCTCAAGAACAAAAAGATGATTTTTATGGAACTGAAAGAAGTGTAGCAGAAGTTCTAGCTGAACTAGGCTTACCAAAAGAAAGTACAGTAAAAGGTTATGTTATCCATCTACCTGAAAAAGATGAATTTGTAGCTGCAATTAATGACAATAATATTTCTTTTTCAGTTGCTTATGCTCGGACACCTGAATTAGCGATGATATATGATGAACCACAAAAAGCGATTTCAGACGCTAAAAAGATTTCAAAACATAAGCTATTGGTTTGTGTTTTATTTGAAACTTCAAACCAATACATGATTAATGATATTTGGGCTAATTATTAGTCTGAGTTTAAATCTATTATGTCAAAAATTGCATATAGTTCTAAACTTATGTTTGATTGAGTTTAGAACTATAATGTAAATCTATTCAATTGTTTTTGTTATAAGTTATTGATTTTCATCTTTATGAGTTTAAAACTTTATTGTGTAAACACAGCATTTAAAGCTTCATTAGGTGACTTTTTAGGTGGTGGTGATAACTTAATTAACACATGGAAATCTACTCTATAAAGGTCTCACATACTACTATCTCAGAATTTTCAGCGCGTCTTTTAATATTTCATTAATGATCGGTGTGACAATTACTAAAATAATCTGCTGAAATCTCAATAATAATGATCAGCTAACTCGCTGATCATTATTTTAAGTGCTTCAAC	NA	NA	NA	NA
>prophage 51
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	754790	757142	4030371		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_000953322.1|754790_756278_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.4	8.3e-219
WP_000034564.1|756290_757142_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
>prophage 52
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	760881	761592	4030371	transposase	Vibriophage(100.0%)	1	NA	NA
WP_000736396.1|760881_761592_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
>prophage 53
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	768833	779939	4030371		uncultured_Caudovirales_phage(33.33%)	10	NA	NA
WP_000122443.1|768833_769361_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.2	9.6e-61
WP_001985514.1|769488_769899_-	MAPEG family protein	NA	A0A2H4J146	uncultured_Caudovirales_phage	43.8	2.4e-14
WP_001187001.1|769993_770377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411991.1|770415_772095_-	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	1.7e-34
WP_000202252.1|772392_774612_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.9	3.2e-81
WP_000364292.1|774765_776085_-	MFS transporter	NA	NA	NA	NA	NA
WP_000927792.1|776167_776812_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000193996.1|776857_777325_-	YchJ family protein	NA	NA	NA	NA	NA
WP_000575778.1|777396_778989_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.1	8.8e-41
WP_001986939.1|779333_779939_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.8	2.5e-12
>prophage 54
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	785065	787444	4030371		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000102049.1|785065_787444_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	79.2	2.8e-115
>prophage 55
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	791589	792516	4030371		Lactococcus_phage(100.0%)	1	NA	NA
WP_162520283.1|791589_792516_-	cysteine synthase A	NA	A0A1W6JHY1	Lactococcus_phage	52.4	9.6e-72
>prophage 56
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	804222	807801	4030371		Synechococcus_phage(33.33%)	4	NA	NA
WP_001196539.1|804222_804753_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.6	3.8e-17
WP_000755281.1|804875_806030_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002017176.1|806050_807181_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	40.0	2.8e-25
WP_000633612.1|807231_807801_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	26.4	5.1e-07
>prophage 57
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	822252	823041	4030371		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001112013.1|822252_823041_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	2.8e-16
>prophage 58
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	828580	830371	4030371	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_001090284.1|828580_830371_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	21.5	1.3e-16
>prophage 59
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	835452	837021	4030371		Hokovirus(100.0%)	1	NA	NA
WP_000210750.1|835452_837021_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.8	4.3e-24
>prophage 60
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	841168	842011	4030371		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000957992.1|841168_842011_-	ParA family protein	NA	V5UP47	Mycobacterium_phage	26.5	1.0e-11
>prophage 61
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	856990	863463	4030371		Catovirus(33.33%)	5	NA	NA
WP_000279945.1|856990_858880_-	fatty acyl-AMP ligase	NA	A0A1V0SBX8	Catovirus	22.7	1.7e-11
WP_000446790.1|859495_860212_-	LuxR family transcriptional regulator	NA	A0A1I9KF49	Aeromonas_phage	28.2	7.3e-19
WP_000253662.1|860971_861388_+	DUF4902 domain-containing protein	NA	NA	NA	NA	NA
WP_002000467.1|861451_862018_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001193290.1|862110_863463_-	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.7	2.2e-53
>prophage 62
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	866554	868204	4030371		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000969574.1|866554_868204_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	39.6	2.6e-80
>prophage 63
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	907876	908893	4030371		Tupanvirus(100.0%)	1	NA	NA
WP_001062913.1|907876_908893_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	45.5	2.8e-80
>prophage 64
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	911930	914292	4030371		Bacillus_phage(50.0%)	3	NA	NA
WP_000591437.1|911930_912806_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.5	3.2e-61
WP_000826957.1|912831_913452_-	sugar transferase	NA	NA	NA	NA	NA
WP_000493223.1|913464_914292_-	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	31.6	7.3e-15
>prophage 65
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	920932	928965	4030371		Moumouvirus(33.33%)	7	NA	NA
WP_000564782.1|920932_922012_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2P1ELT3	Moumouvirus	28.4	4.4e-28
WP_000011809.1|922013_922592_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000712680.1|922588_923539_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001175092.1|923569_924865_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	28.0	1.5e-22
WP_000872592.1|925225_926326_+	polysaccharide biosynthesis/export family protein	NA	NA	NA	NA	NA
WP_001165988.1|926330_926759_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_001075970.1|926778_928965_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	33.7	1.2e-19
>prophage 66
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	951662	952463	4030371		Bacillus_virus(100.0%)	1	NA	NA
WP_000183286.1|951662_952463_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.9	4.3e-28
>prophage 67
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	956430	959268	4030371	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001281041.1|956430_959268_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.9	1.0e-76
>prophage 68
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	967193	968965	4030371		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_014538288.1|967193_967679_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	37.7	3.3e-15
WP_000123594.1|967894_968965_-	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	27.3	9.8e-12
>prophage 69
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	973038	976227	4030371	protease	Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_001062604.1|973038_974979_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	48.3	2.2e-147
WP_000714225.1|975309_976227_+|protease	matrixin family metalloprotease	protease	W6JIV8	Anomala_cuprea_entomopoxvirus	46.9	7.6e-05
>prophage 70
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	980908	981421	4030371		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000994663.1|980908_981421_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.9	1.0e-19
>prophage 71
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	985952	992116	4030371		Escherichia_phage(33.33%)	6	NA	NA
WP_000447698.1|985952_986909_+	TerC family protein	NA	A0A1D7XFL1	Escherichia_phage	32.8	1.3e-31
WP_001256727.1|987097_987463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823200.1|987484_988645_+	glutathionylspermidine synthase family protein	NA	E5E3Y5	Acinetobacter_phage	44.5	2.6e-95
WP_000991547.1|988936_989992_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_000052269.1|990048_991374_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000214980.1|991588_992116_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.5	3.6e-15
>prophage 72
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	997957	1009029	4030371		Staphylococcus_phage(20.0%)	10	NA	NA
WP_000251652.1|997957_998278_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	49.4	6.3e-15
WP_001240374.1|998288_998681_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831329.1|998710_998845_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000964768.1|999514_1000912_+	chromosomal replication initiator protein DnaA	NA	A0A1B1IPE6	uncultured_Mediterranean_phage	31.0	5.2e-05
WP_001237348.1|1001009_1002158_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.6	1.0e-46
WP_000550810.1|1002172_1003255_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000093729.1|1003307_1005776_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.1	7.6e-116
WP_000987632.1|1005813_1006206_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001009202.1|1006289_1006847_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_000613985.1|1007097_1009029_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.3	1.6e-65
>prophage 73
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1013024	1013360	4030371		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_000993572.1|1013024_1013360_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.5	1.2e-24
>prophage 74
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1028114	1029077	4030371	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000691201.1|1028114_1029077_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.1	2.9e-07
>prophage 75
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1034646	1035942	4030371		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000073454.1|1034646_1035942_-	pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	64.8	4.2e-150
>prophage 76
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1044720	1045833	4030371		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_001119029.1|1044720_1045833_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.3	1.9e-29
>prophage 77
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1049244	1053975	4030371		Indivirus(50.0%)	6	NA	NA
WP_001025223.1|1049244_1050048_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.3	7.8e-38
WP_000843085.1|1050168_1051071_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000770104.1|1051054_1051429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001985074.1|1051436_1051559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000143934.1|1051519_1052944_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000069845.1|1052946_1053975_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	30.7	6.5e-45
>prophage 78
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1058075	1066318	4030371		Moraxella_phage(20.0%)	10	NA	NA
WP_000490267.1|1058075_1058234_-	DUF1328 domain-containing protein	NA	A0A0R6PJ30	Moraxella_phage	60.8	6.2e-08
WP_000102819.1|1058428_1058887_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_075873895.1|1059047_1060169_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_001285411.1|1060274_1061540_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.0e-79
WP_000349494.1|1061555_1062395_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	36.7	4.6e-41
WP_000418559.1|1062680_1062884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917863.1|1063076_1063796_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	35.8	3.1e-38
WP_001177091.1|1063832_1064435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193600.1|1064450_1065344_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_002017318.1|1065673_1066318_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	40.2	1.9e-26
>prophage 79
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1078569	1079682	4030371		Gordonia_phage(100.0%)	1	NA	NA
WP_001246956.1|1078569_1079682_-	acyltransferase	NA	A0A166XZF2	Gordonia_phage	25.9	4.7e-09
>prophage 80
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1083373	1084912	4030371		Catovirus(100.0%)	1	NA	NA
WP_000421600.1|1083373_1084912_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.2	8.4e-89
>prophage 81
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1092304	1099019	4030371		Staphylococcus_phage(50.0%)	7	NA	NA
WP_000334189.1|1092304_1094143_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.5	8.4e-128
WP_000108584.1|1094155_1095520_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.6	1.7e-32
WP_000380673.1|1095536_1096052_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_000807406.1|1096029_1096947_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_000084188.1|1096962_1097412_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_001007829.1|1097415_1097886_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.3	5.2e-34
WP_001131393.1|1097897_1099019_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	34.7	1.2e-52
>prophage 82
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1103978	1108689	4030371		Agrobacterium_phage(50.0%)	4	NA	NA
WP_000074561.1|1103978_1105193_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	5.7e-48
WP_000174479.1|1105343_1106192_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_000011216.1|1106188_1107040_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000921706.1|1107468_1108689_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	29.2	2.8e-18
>prophage 83
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1123209	1133386	4030371		uncultured_Caudovirales_phage(75.0%)	6	NA	NA
WP_001987787.1|1123209_1126572_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	75.4	0.0e+00
WP_000036939.1|1126581_1128606_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	76.5	2.7e-297
WP_001223885.1|1128586_1129318_+	hypothetical protein	NA	A0A2H4JCF6	uncultured_Caudovirales_phage	61.3	3.0e-76
WP_001139636.1|1129350_1130694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001021718.1|1130906_1131488_+	esterase	NA	NA	NA	NA	NA
WP_000195974.1|1131502_1133386_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.6	1.7e-99
>prophage 84
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1145713	1147994	4030371		Bacillus_phage(50.0%)	2	NA	NA
WP_042782585.1|1145713_1146796_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.3	3.6e-22
WP_001025107.1|1147082_1147994_-	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	28.7	1.1e-08
>prophage 85
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1163659	1164352	4030371		Bacillus_virus(100.0%)	1	NA	NA
WP_000557460.1|1163659_1164352_+	M23 family metallopeptidase	NA	G3MBP9	Bacillus_virus	39.3	4.5e-18
>prophage 86
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1174379	1182000	4030371		Klosneuvirus(33.33%)	6	NA	NA
WP_000956023.1|1174379_1175846_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	1.9e-90
WP_000119870.1|1175995_1177333_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_169538932.1|1177334_1178000_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_000161616.1|1178000_1179701_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.3	2.1e-64
WP_000731728.1|1179745_1180513_-	putative porin	NA	NA	NA	NA	NA
WP_096640204.1|1180905_1182000_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	4.4e-07
>prophage 87
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1187697	1192065	4030371	transposase	Staphylococcus_phage(50.0%)	4	NA	NA
WP_001002960.1|1187697_1189647_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.9	1.1e-93
WP_000806360.1|1189693_1190236_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001019415.1|1190341_1190755_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000343018.1|1190856_1192065_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
>prophage 88
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1196297	1199795	4030371		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_001089744.1|1196297_1199795_-	hybrid sensor histidine kinase/response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	24.0	1.0e-12
>prophage 89
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1203054	1213263	4030371	holin	Vibrio_phage(25.0%)	5	NA	NA
WP_001139472.1|1203054_1205022_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.2	9.9e-26
WP_000733005.1|1205080_1205980_-	porin Omp33-36	NA	NA	NA	NA	NA
WP_000016117.1|1206972_1208679_+	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	31.9	3.7e-13
WP_000865808.1|1208761_1210417_+	AAA family ATPase	NA	X2KLG0	Campylobacter_phage	24.4	8.1e-21
WP_000083356.1|1210431_1213263_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.4	0.0e+00
>prophage 90
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1216941	1220168	4030371		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000680210.1|1216941_1218024_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.2	2.6e-89
WP_000980460.1|1218170_1219535_+	MFS transporter	NA	NA	NA	NA	NA
WP_001215082.1|1219586_1220168_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	57.6	9.6e-38
>prophage 91
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1223653	1226602	4030371		Streptococcus_phage(50.0%)	2	NA	NA
WP_001987724.1|1223653_1225198_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.7	6.6e-17
WP_000380901.1|1225309_1226602_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	4.2e-25
>prophage 92
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1248390	1252102	4030371		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001181667.1|1248390_1250268_+	potassium transporter Kup	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	32.9	8.7e-72
WP_000581864.1|1250323_1250767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001985820.1|1250998_1252102_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	37.0	5.0e-27
>prophage 93
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1267508	1269748	4030371		Bacillus_phage(100.0%)	2	NA	NA
WP_000051217.1|1267508_1268966_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.4	2.0e-15
WP_000060753.1|1268983_1269748_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.2	2.8e-29
>prophage 94
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1276475	1279713	4030371		Pandoravirus(50.0%)	2	NA	NA
WP_000221160.1|1276475_1277753_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	26.3	5.3e-12
WP_000090021.1|1278051_1279713_+	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	27.4	5.8e-43
>prophage 95
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1286148	1289307	4030371		Leptospira_phage(100.0%)	1	NA	NA
WP_000353977.1|1286148_1289307_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VL66	Leptospira_phage	21.0	2.7e-25
>prophage 96
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1325208	1325799	4030371		Lactococcus_phage(100.0%)	1	NA	NA
WP_000846931.1|1325208_1325799_+	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	32.7	8.9e-15
>prophage 97
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1332994	1336288	4030371		Salmonella_phage(50.0%)	3	NA	NA
WP_001117590.1|1332994_1335100_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	35.3	5.3e-09
WP_000135049.1|1335307_1335586_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000015937.1|1335658_1336288_-	guanylate kinase	NA	A0A240FAU9	Liberibacter_phage	30.6	6.8e-13
>prophage 98
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1354079	1355312	4030371		Catovirus(100.0%)	1	NA	NA
WP_000077814.1|1354079_1355312_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	6.3e-103
>prophage 99
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1359484	1363670	4030371		Salmonella_phage(100.0%)	3	NA	NA
WP_000790119.1|1359484_1360714_+	MFS transporter	NA	S4TR35	Salmonella_phage	22.3	4.6e-13
WP_001061828.1|1360750_1362901_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001143890.1|1363094_1363670_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	58.4	9.2e-41
>prophage 100
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1374084	1375299	4030371		Klosneuvirus(100.0%)	1	NA	NA
WP_000437496.1|1374084_1375299_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.4	1.4e-25
>prophage 101
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1401909	1402512	4030371		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001121174.1|1401909_1402512_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.4	8.7e-42
>prophage 102
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1406082	1409125	4030371		Catovirus(50.0%)	3	NA	NA
WP_000047385.1|1406082_1407903_+	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	27.6	8.8e-45
WP_000471151.1|1407994_1408180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002019647.1|1408306_1409125_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	1.5e-23
>prophage 103
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1412785	1413367	4030371		Orpheovirus(100.0%)	1	NA	NA
WP_001084310.1|1412785_1413367_+	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	27.2	9.1e-12
>prophage 104
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1426929	1428477	4030371		Klebsiella_phage(100.0%)	1	NA	NA
WP_000537113.1|1426929_1428477_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	40.9	1.2e-74
>prophage 105
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1453875	1458496	4030371		Klosneuvirus(50.0%)	2	NA	NA
WP_000266465.1|1453875_1455930_-	M3 family metallopeptidase	NA	A0A1V0SIU1	Klosneuvirus	20.8	3.3e-32
WP_000803911.1|1456063_1458496_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	35.7	3.3e-71
>prophage 106
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1473139	1477949	4030371	tRNA	Pseudomonas_phage(50.0%)	3	NA	NA
WP_001986628.1|1473139_1474183_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	44.9	1.1e-47
WP_000218140.1|1474265_1475717_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_000792523.1|1476005_1477949_+	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	39.7	7.5e-10
>prophage 107
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1496679	1497582	4030371		Mollivirus(100.0%)	1	NA	NA
WP_000344603.1|1496679_1497582_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	22.3	3.1e-06
>prophage 108
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1503979	1504408	4030371	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000003709.1|1503979_1504408_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	50.0	2.9e-31
>prophage 109
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1527815	1529150	4030371		Archaeal_BJ1_virus(50.0%)	2	NA	NA
WP_000543478.1|1527815_1528712_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	28.8	6.7e-22
WP_000587647.1|1528712_1529150_+	thioredoxin TrxC	NA	A0A1V0SD63	Indivirus	39.0	1.3e-10
>prophage 110
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1537116	1542922	4030371	tRNA	uncultured_Mediterranean_phage(66.67%)	5	NA	NA
WP_000006958.1|1537116_1538370_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	3.8e-39
WP_001984787.1|1538433_1539399_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.1	1.7e-31
WP_001270222.1|1539407_1541309_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000051669.1|1541360_1541690_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_000667231.1|1541788_1542922_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.5	1.3e-94
>prophage 111
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1546777	1548046	4030371		Feldmannia_species_virus(100.0%)	1	NA	NA
WP_000194116.1|1546777_1548046_+	HAMP domain-containing histidine kinase	NA	B5LWN0	Feldmannia_species_virus	25.2	4.6e-08
>prophage 112
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1560593	1562372	4030371	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_000986451.1|1560593_1562372_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	21.9	6.2e-19
>prophage 113
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1576923	1580402	4030371		Bacillus_phage(33.33%)	3	NA	NA
WP_000680577.1|1576923_1577610_+	response regulator	NA	W8CYM9	Bacillus_phage	33.8	2.5e-29
WP_001160208.1|1577673_1579116_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	31.9	2.6e-44
WP_000199593.1|1579229_1580402_-	acyl-CoA desaturase	NA	F2NZ38	Diadromus_pulchellus_ascovirus	32.3	2.5e-32
>prophage 114
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1618106	1618460	4030371		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000457787.1|1618106_1618460_+	quaternary ammonium transporter	NA	I3WVW1	Acinetobacter_phage	59.8	6.1e-27
>prophage 115
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1622609	1632349	4030371		Bordetella_phage(25.0%)	9	NA	NA
WP_000512707.1|1622609_1623815_-	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	58.4	1.4e-126
WP_000004971.1|1624091_1625552_-	amino acid permease	NA	NA	NA	NA	NA
WP_000371518.1|1625573_1626587_-	methyltransferase	NA	NA	NA	NA	NA
WP_000070856.1|1626649_1628008_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.0	2.2e-24
WP_001280092.1|1628186_1630022_+	translational GTPase TypA	NA	A0A2K9L2P9	Tupanvirus	39.4	2.3e-21
WP_000022555.1|1630277_1630709_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_001984816.1|1630850_1631204_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001192454.1|1631214_1631505_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_001114558.1|1631524_1632349_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	30.1	2.4e-26
>prophage 116
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1645150	1658522	4030371		Leptospira_phage(20.0%)	8	NA	NA
WP_000264364.1|1645150_1648249_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	27.6	1.9e-95
WP_001260821.1|1648264_1649383_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000110261.1|1649442_1650042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389061.1|1650363_1650747_+	response regulator	NA	Q8QKV4	Ectocarpus_siliculosus_virus	27.9	5.4e-05
WP_000101096.1|1650770_1651133_+	response regulator	NA	A0A220YL79	Alteromonas_virus	31.3	8.7e-13
WP_000729757.1|1651193_1651730_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_000505931.1|1651776_1653855_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.0	1.6e-18
WP_000658903.1|1654001_1658522_+	Hpt domain-containing protein	NA	W8CYM9	Bacillus_phage	39.3	4.3e-16
>prophage 117
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1670159	1671374	4030371		Salmonella_phage(100.0%)	1	NA	NA
WP_000003701.1|1670159_1671374_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	27.9	1.3e-28
>prophage 118
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1674922	1675858	4030371		Klosneuvirus(100.0%)	1	NA	NA
WP_002027092.1|1674922_1675858_+	patatin-like phospholipase family protein	NA	A0A1V0SKV5	Klosneuvirus	29.4	1.5e-08
>prophage 119
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1711204	1712059	4030371		Pandoravirus(100.0%)	1	NA	NA
WP_001143941.1|1711204_1712059_-	SPFH/Band 7/PHB domain protein	NA	S4VVY8	Pandoravirus	29.3	4.0e-08
>prophage 120
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1722224	1723412	4030371		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_002001094.1|1722224_1723412_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	36.3	4.9e-44
>prophage 121
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1727510	1730390	4030371	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_000128713.1|1727510_1730390_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.5	3.7e-146
>prophage 122
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1746263	1747535	4030371	tRNA	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000566837.1|1746263_1747535_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.2	6.9e-97
>prophage 123
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1755345	1757232	4030371		Vibrio_phage(100.0%)	1	NA	NA
WP_001281941.1|1755345_1757232_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.3e-38
>prophage 124
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1771621	1775274	4030371		Erysipelothrix_phage(50.0%)	3	NA	NA
WP_000082613.1|1771621_1773055_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.7	9.4e-42
WP_001048573.1|1773202_1774369_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000114637.1|1774383_1775274_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.6	2.9e-17
>prophage 125
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1778997	1780500	4030371		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000526259.1|1778997_1780500_+	cation:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	32.2	2.6e-18
>prophage 126
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1808488	1811169	4030371		Marsac_virus(50.0%)	2	NA	NA
WP_000235573.1|1808488_1809139_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	A0A140HEP8	Marsac_virus	25.1	4.1e-05
WP_001286662.1|1809273_1811169_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	46.4	1.4e-106
>prophage 127
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1815492	1819143	4030371		Enterococcus_phage(50.0%)	4	NA	NA
WP_001229847.1|1815492_1816341_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.4	1.2e-25
WP_001278011.1|1816581_1817250_+	methyltransferase	NA	NA	NA	NA	NA
WP_001043188.1|1817272_1817695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001984607.1|1817811_1819143_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.8	3.1e-39
>prophage 128
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1836995	1838979	4030371		uncultured_virus(100.0%)	2	NA	NA
WP_000065579.1|1836995_1837286_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	51.1	2.3e-16
WP_001274623.1|1837344_1838979_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	60.9	8.1e-175
>prophage 129
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1847004	1849277	4030371	tRNA	Geobacillus_virus(50.0%)	2	NA	NA
WP_002063109.1|1847004_1847781_-	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	53.0	7.1e-36
WP_000271249.1|1848371_1849277_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.6	6.2e-92
>prophage 130
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1853334	1857333	4030371		Tupanvirus(100.0%)	1	NA	NA
WP_001071463.1|1853334_1857333_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	33.3	3.0e-69
>prophage 131
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1864016	1865174	4030371		Streptococcus_phage(100.0%)	1	NA	NA
WP_000869504.1|1864016_1865174_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	35.3	3.0e-38
>prophage 132
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1869463	1871501	4030371		Streptococcus_phage(50.0%)	2	NA	NA
WP_064713901.1|1869463_1870561_+	4-phosphoerythronate dehydrogenase	NA	M1NSB9	Streptococcus_phage	29.2	9.4e-18
WP_000059537.1|1870526_1871501_+	EF-P lysine aminoacylase GenX	NA	A0A2K9KZX5	Tupanvirus	29.3	2.6e-27
>prophage 133
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1879265	1888436	4030371		Escherichia_phage(33.33%)	7	NA	NA
WP_002000102.1|1879265_1880153_+	tyrosine recombinase XerC	NA	A0A2L1IV36	Escherichia_phage	32.4	2.7e-15
WP_000646179.1|1880588_1881338_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_000025985.1|1881355_1882288_+	electron transfer flavoprotein subunit alpha	NA	NA	NA	NA	NA
WP_000116444.1|1882653_1885368_+	DNA gyrase subunit A	NA	A0A172JHV7	Bacillus_phage	29.4	8.7e-97
WP_001188108.1|1885419_1887066_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_000494036.1|1887075_1887456_-	GtrA family protein	NA	NA	NA	NA	NA
WP_001022410.1|1887455_1888436_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	45.9	1.5e-67
>prophage 134
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1894714	1895794	4030371		Streptococcus_phage(100.0%)	1	NA	NA
WP_001203182.1|1894714_1895794_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	49.7	4.1e-90
>prophage 135
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1900109	1907991	4030371		Planktothrix_phage(20.0%)	7	NA	NA
WP_000049403.1|1900109_1900796_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	35.2	7.6e-34
WP_000472705.1|1900881_1903314_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	31.4	1.3e-27
WP_001984639.1|1903266_1904250_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_001286615.1|1904386_1905403_+	signal peptide peptidase SppA	NA	A0A2I6UH21	Salinibacter_virus	26.5	7.1e-12
WP_000114076.1|1905421_1906231_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000975536.1|1906294_1906924_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.9	1.4e-26
WP_000071984.1|1906920_1907991_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	47.9	6.5e-80
>prophage 136
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1918231	1919203	4030371		Klosneuvirus(100.0%)	1	NA	NA
WP_000067971.1|1918231_1919203_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	36.9	9.4e-46
>prophage 137
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1929628	1940091	4030371		Burkholderia_phage(20.0%)	10	NA	NA
WP_000471081.1|1929628_1933462_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	55.0	6.3e-109
WP_050674945.1|1933583_1934750_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	28.8	3.1e-27
WP_000916029.1|1935144_1935462_+	NIF3 1	NA	A0A1E1EXH0	Acanthamoeba_castellanii_mimivirus	29.4	6.5e-12
WP_000175547.1|1935458_1936259_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002017037.1|1936368_1936959_+	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	A0A292GDD2	Xanthomonas_phage	36.3	3.7e-21
WP_001050713.1|1937029_1937599_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_001293534.1|1937720_1938182_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_001153972.1|1938199_1938886_-	diphthine--ammonia ligase	NA	NA	NA	NA	NA
WP_000771345.1|1938977_1939394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001984660.1|1939407_1940091_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	38.4	6.7e-30
>prophage 138
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1943847	1944909	4030371		Bacillus_virus(100.0%)	1	NA	NA
WP_000027499.1|1943847_1944909_-	sulfate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.1	9.7e-28
>prophage 139
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1950519	1959502	4030371		Streptococcus_phage(50.0%)	8	NA	NA
WP_000470763.1|1950519_1951119_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	42.1	1.1e-33
WP_000842540.1|1951256_1951673_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_000367539.1|1951727_1953371_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_002000087.1|1953586_1954978_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.4	4.7e-22
WP_000035781.1|1955724_1957542_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	1.7e-19
WP_000344900.1|1957612_1958440_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001224039.1|1958463_1958838_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_000160699.1|1958809_1959502_+	ribonuclease III	NA	M1H9B8	Acanthocystis_turfacea_Chlorella_virus	37.0	2.6e-21
>prophage 140
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1969203	1972877	4030371		Pseudomonas_phage(50.0%)	3	NA	NA
WP_000222200.1|1969203_1969995_-	hypothetical protein	NA	A0A127KNK1	Pseudomonas_phage	48.7	8.8e-26
WP_001004983.1|1970174_1972196_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_000885644.1|1972289_1972877_+	lipocalin family protein	NA	A0A2K9L4H1	Tupanvirus	33.5	2.5e-17
>prophage 141
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1978577	1979711	4030371		Streptococcus_phage(100.0%)	1	NA	NA
WP_000573844.1|1978577_1979711_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.1	1.6e-68
>prophage 142
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1986055	1987192	4030371		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000718061.1|1986055_1987192_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	29.6	1.1e-24
>prophage 143
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	1992995	1997865	4030371		Bodo_saltans_virus(50.0%)	4	NA	NA
WP_000063728.1|1992995_1994438_-	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	33.1	6.5e-59
WP_000123995.1|1994541_1995024_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_000193163.1|1995159_1996446_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000667917.1|1996545_1997865_-	D-alanyl-D-alanine carboxypeptidase PBP6B	NA	B6DZZ7	Stx2-converting_phage	39.2	1.4e-36
>prophage 144
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2003485	2004742	4030371		Phage_21(100.0%)	1	NA	NA
WP_000542119.1|2003485_2004742_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	81.5	2.4e-17
>prophage 145
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2012115	2014878	4030371		Tupanvirus(100.0%)	1	NA	NA
WP_000480989.1|2012115_2014878_+	insulinase family protein	NA	A0A2K9LA15	Tupanvirus	26.3	3.7e-18
>prophage 146
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2021853	2024691	4030371		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000413587.1|2021853_2024691_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	5.6e-22
>prophage 147
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2031417	2032791	4030371		Klosneuvirus(100.0%)	1	NA	NA
WP_000117540.1|2031417_2032791_+	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.7	2.2e-24
>prophage 148
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2036724	2052302	4030371	protease,transposase	Bodo_saltans_virus(33.33%)	11	NA	NA
WP_000469457.1|2036724_2038446_+	alpha-keto acid decarboxylase family protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	24.1	4.6e-27
WP_000339846.1|2038586_2039966_+	amino acid permease	NA	NA	NA	NA	NA
WP_001238909.1|2040421_2041453_+	substrate-binding domain-containing protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	39.2	5.0e-61
WP_001050723.1|2041553_2042933_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_000372632.1|2042956_2044327_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_002000060.1|2044385_2045243_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	7.6e-15
WP_000897185.1|2045389_2046352_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	27.8	5.9e-24
WP_000196844.1|2046627_2048730_+	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_000343018.1|2048754_2049963_-|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_000570322.1|2050189_2050831_-	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_000993080.1|2050913_2052302_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.2	9.5e-100
>prophage 149
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2055495	2059527	4030371		Stx2-converting_phage(33.33%)	5	NA	NA
WP_000197256.1|2055495_2056644_-	D-alanyl-D-alanine carboxypeptidase PBP5/6	NA	B6DZZ7	Stx2-converting_phage	36.8	1.0e-62
WP_000480885.1|2056770_2057193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000846423.1|2057340_2057712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023216.1|2057814_2058582_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	45.3	2.0e-54
WP_000550750.1|2058696_2059527_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	45.7	7.6e-12
>prophage 150
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2088026	2092726	4030371		Vibrio_phage(66.67%)	3	NA	NA
WP_000695007.1|2088026_2088953_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	37.0	1.2e-53
WP_001202883.1|2089121_2090786_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-25
WP_001202896.1|2091052_2092726_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	27.0	1.3e-31
>prophage 151
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2102891	2103098	4030371		Escherichia_phage(100.0%)	1	NA	NA
WP_000816060.1|2102891_2103098_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	50.0	2.4e-07
>prophage 152
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2114503	2121739	4030371		Tupanvirus(33.33%)	5	NA	NA
WP_000910253.1|2114503_2116351_+	acinetobactin non-ribosomal peptide synthetase subunit BasA	NA	A0A2K9KZV5	Tupanvirus	24.7	2.1e-38
WP_000939834.1|2116421_2118452_-	acinetobactin non-ribosomal peptide synthetase subunit BasB	NA	NA	NA	NA	NA
WP_085916975.1|2119041_2120025_+	ferric acinetobactin ABC transporter permease subunit BauD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	41.6	1.1e-62
WP_001223274.1|2120024_2120972_+	ferric acinetobactin ABC transporter permease subunit BauC	NA	NA	NA	NA	NA
WP_000582115.1|2120968_2121739_+	ferric acinetobactin ABC transporter ATP-binding protein BauE	NA	A0A2R8FG22	Brazilian_cedratvirus	32.5	1.1e-17
>prophage 153
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2132242	2136841	4030371		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_000603876.1|2132242_2133394_+	acinetobactin biosynthesis histidine decarboxylase BasG	NA	A7J7V4	Paramecium_bursaria_Chlorella_virus	33.7	6.1e-52
WP_001176134.1|2133490_2133646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031967279.1|2133665_2135249_+	acinetobactin export ABC transporter permease/ATP-binding subunit BarA	NA	G9BWD6	Planktothrix_phage	31.8	1.7e-12
WP_001095752.1|2135245_2136841_+	acinetobactin export ABC transporter permease/ATP-binding subunit BarB	NA	W8CYL7	Bacillus_phage	44.8	4.4e-24
>prophage 154
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2148389	2217619	4030371	integrase,terminase,capsid	Acinetobacter_phage(94.44%)	85	2163179:2163195	2213966:2213982
WP_001187844.1|2148389_2148938_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
WP_000893683.1|2149200_2150700_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	100.0	6.1e-286
WP_001076817.1|2150701_2153077_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	100.0	0.0e+00
WP_001164226.1|2153083_2154067_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	100.0	2.0e-189
WP_000066126.1|2154077_2154773_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_000608304.1|2154782_2155589_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	100.0	7.9e-147
WP_001982145.1|2155598_2156648_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000281127.1|2157003_2159736_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
WP_000960548.1|2159815_2162515_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
WP_000566784.1|2162610_2163186_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	3.2e-110
2163179:2163195	attL	TCGATCATTAGAAGCAT	NA	NA	NA	NA
WP_000529848.1|2163309_2163579_-	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	100.0	8.7e-42
WP_000877062.1|2163579_2163915_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	62.4	3.7e-34
WP_000004577.1|2163911_2164307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000418203.1|2164303_2164627_-	hypothetical protein	NA	I2GUB3	Acinetobacter_phage	57.5	4.7e-18
WP_000132009.1|2164655_2165024_-	hypothetical protein	NA	A0A1B1P9I4	Acinetobacter_phage	98.3	1.7e-64
WP_000210281.1|2165033_2165549_-	siphovirus Gp157 family protein	NA	A0A0A8WFY3	Clostridium_phage	27.0	6.6e-06
WP_000528927.1|2165603_2166263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020435.1|2166275_2166944_-	AAA family ATPase	NA	K7PMI2	Enterobacteria_phage	56.2	1.0e-62
WP_000454828.1|2167005_2167212_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_034118812.1|2167211_2167592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034118814.1|2167661_2167955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034118816.1|2167954_2168146_-	hypothetical protein	NA	A0A1B1P9G9	Acinetobacter_phage	63.6	5.4e-14
WP_000560785.1|2168341_2168557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000923284.1|2168985_2169495_-	hypothetical protein	NA	A0A127KNL4	Pseudomonas_phage	36.5	1.3e-17
WP_000370482.1|2169640_2169844_-	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.5	9.1e-28
WP_000105769.1|2169858_2170641_-	helix-turn-helix domain-containing protein	NA	J7I4M9	Acinetobacter_phage	77.1	3.7e-101
WP_001217698.1|2170768_2170945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051086.1|2170941_2171208_+	hypothetical protein	NA	A0A1B1P9I3	Acinetobacter_phage	77.3	6.2e-32
WP_000047869.1|2171303_2171471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000061204.1|2171467_2172361_+	GntR family transcriptional regulator	NA	A0A068C8G6	Acinetobacter_phage	46.8	3.5e-47
WP_034118821.1|2172360_2173686_+	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	91.6	1.5e-232
WP_001068421.1|2173682_2173934_+	hypothetical protein	NA	A0A0P0IE39	Acinetobacter_phage	88.0	5.6e-35
WP_001001967.1|2173930_2174107_+	hypothetical protein	NA	A0A0P0IRH7	Acinetobacter_phage	86.2	1.7e-17
WP_000826377.1|2174103_2174760_+	hypothetical protein	NA	A0A0N7IRF9	Acinetobacter_phage	100.0	2.1e-129
WP_000801876.1|2174756_2175131_+	hypothetical protein	NA	A0A0P0I8J0	Acinetobacter_phage	69.2	1.9e-34
WP_095357150.1|2175180_2175543_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	99.2	3.3e-68
WP_001278405.1|2176045_2176231_+	hypothetical protein	NA	A0A0D4DCN1	Acinetobacter_phage	96.4	2.5e-24
WP_001204257.1|2176223_2176556_+	hypothetical protein	NA	E2GLW0	Acinetobacter_phage	44.7	2.0e-11
WP_033503127.1|2176559_2176919_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	84.7	4.1e-23
WP_000100185.1|2176918_2177314_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	100.0	1.6e-68
WP_000783470.1|2177310_2177811_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	100.0	3.1e-93
WP_002001437.1|2178006_2178657_+	hypothetical protein	NA	A0A0P0IKQ5	Acinetobacter_phage	99.5	2.1e-94
WP_000134363.1|2178846_2179038_+	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	85.7	5.8e-24
WP_000341071.1|2179050_2179479_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	67.6	2.4e-46
WP_002001438.1|2179447_2180089_+	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	99.5	6.1e-126
WP_000212566.1|2180147_2180618_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_000102080.1|2180607_2182035_+|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	100.0	7.6e-270
WP_001286355.1|2182031_2183483_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	100.0	1.0e-285
WP_000179763.1|2183484_2184588_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	100.0	2.7e-206
WP_000965231.1|2184596_2185025_+	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
WP_000004363.1|2185123_2185366_+	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	100.0	3.6e-39
WP_001139861.1|2185583_2185775_+	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_000214198.1|2186682_2187639_+	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	97.5	4.8e-175
WP_000692540.1|2187704_2188370_+	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	96.8	2.6e-111
WP_000008496.1|2188374_2188764_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	98.4	7.3e-66
WP_094078962.1|2188765_2189134_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	97.5	5.0e-64
WP_002047124.1|2189142_2189547_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	91.0	3.8e-65
WP_031985076.1|2189518_2189887_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	92.6	2.5e-60
WP_039270718.1|2189888_2190287_+	hypothetical protein	NA	A0A0P0IRA6	Acinetobacter_phage	97.7	5.9e-71
WP_001277696.1|2190288_2190507_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_000749909.1|2190615_2191137_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000064593.1|2191233_2191587_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_000002408.1|2191586_2192765_+	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	66.3	1.2e-103
WP_000094278.1|2192817_2193735_+	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
WP_153227858.1|2193804_2194320_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	3.2e-77
WP_001258718.1|2194870_2195581_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000065059.1|2195695_2196625_-	ORF6N domain-containing protein	NA	A0A0P0J0J7	Acinetobacter_phage	86.5	4.7e-87
WP_000453244.1|2196833_2197070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094078963.1|2197156_2197681_+	DUF4468 domain-containing protein	NA	A0A0P0I8L3	Acinetobacter_phage	96.6	7.7e-95
WP_000725052.1|2197745_2198129_+	hypothetical protein	NA	A0A0D4DBP2	Acinetobacter_phage	67.7	2.2e-46
WP_000599538.1|2198190_2198934_+	hypothetical protein	NA	A0A0N7IRG5	Acinetobacter_phage	91.5	5.6e-123
WP_000041780.1|2198947_2199259_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000538615.1|2199374_2199545_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835375.1|2199541_2200543_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	42.2	6.4e-21
WP_000130334.1|2200873_2201221_+	hypothetical protein	NA	A0A0N7IRG4	Acinetobacter_phage	97.4	1.6e-59
WP_000046172.1|2201281_2206177_+	tape measure protein	NA	J7I4Q7	Acinetobacter_phage	95.7	0.0e+00
WP_000277443.1|2206226_2206625_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	100.0	1.3e-73
WP_000368375.1|2206624_2207131_+	hypothetical protein	NA	J7HXQ5	Acinetobacter_phage	100.0	1.2e-92
WP_000835168.1|2207127_2207490_+	hypothetical protein	NA	J7I4R1	Acinetobacter_phage	100.0	5.2e-66
WP_000590505.1|2207482_2210929_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	100.0	0.0e+00
WP_039263280.1|2211427_2211970_+	N-acetylmuramidase	NA	A0A0D4DCJ5	Acinetobacter_phage	96.7	7.7e-98
WP_000098296.1|2212403_2212598_+	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	100.0	3.8e-31
WP_000947611.1|2212594_2213791_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0D4DBR3	Acinetobacter_phage	100.0	2.5e-226
WP_000999148.1|2214278_2216081_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	100.0	0.0e+00
2213966:2213982	attR	TCGATCATTAGAAGCAT	NA	NA	NA	NA
WP_000872622.1|2216077_2217619_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	100.0	3.9e-288
>prophage 155
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2225943	2228407	4030371		Pithovirus(50.0%)	2	NA	NA
WP_001254962.1|2225943_2227119_+	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	29.6	8.0e-07
WP_001198539.1|2227168_2228407_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.3	1.6e-90
>prophage 156
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2235638	2237021	4030371		Pandoravirus(100.0%)	1	NA	NA
WP_000994841.1|2235638_2237021_-	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	30.4	1.5e-41
>prophage 157
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2254797	2255367	4030371		Synechococcus_phage(100.0%)	1	NA	NA
WP_002000723.1|2254797_2255367_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	45.5	1.9e-22
>prophage 158
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2258671	2271406	4030371		Vibrio_phage(20.0%)	10	NA	NA
WP_000110166.1|2258671_2259484_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A126HHM5	Vibrio_phage	37.2	5.0e-40
WP_001010536.1|2259480_2260254_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000128669.1|2260250_2261186_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	8.3e-23
WP_017897439.1|2261479_2262115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001147934.1|2262259_2262946_-	DUF3820 family protein	NA	A0A059VJT9	Pseudomonas_phage	41.6	1.8e-35
WP_000782592.1|2263195_2264425_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000523677.1|2264484_2265312_-	DUF695 domain-containing protein	NA	NA	NA	NA	NA
WP_000457893.1|2265471_2266725_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.3	2.3e-97
WP_000633124.1|2266765_2268214_-	multidrug efflux RND transporter outer membrane subunit AdeH	NA	NA	NA	NA	NA
WP_001027056.1|2268226_2271406_-	multidrug efflux RND transporter permease subunit AdeG	NA	S5VTK5	Leptospira_phage	21.5	3.3e-63
>prophage 159
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2276322	2279373	4030371	tRNA	Planktothrix_phage(33.33%)	4	NA	NA
WP_000438614.1|2276322_2277099_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	3.1e-23
WP_000121131.1|2277170_2277500_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_001196299.1|2277736_2278000_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	49.4	1.5e-17
WP_000845862.1|2278002_2279373_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	62.9	2.6e-126
>prophage 160
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2287068	2289553	4030371		Bacillus_phage(66.67%)	3	NA	NA
WP_000783090.1|2287068_2287428_+	NirD/YgiW/YdeI family stress tolerance protein	NA	A0A1I9LJU6	Stx_converting_phage	48.1	3.3e-12
WP_001221447.1|2287535_2288198_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.1	5.0e-22
WP_001257360.1|2288194_2289553_+	GHKL domain-containing protein	NA	W8CYF6	Bacillus_phage	24.8	7.6e-17
>prophage 161
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2295379	2296393	4030371		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001093417.1|2295379_2296393_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	46.7	2.2e-77
>prophage 162
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2311366	2314454	4030371		Salicola_phage(33.33%)	4	NA	NA
WP_001285359.1|2311366_2312233_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.3	2.1e-44
WP_000108398.1|2312366_2312612_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_000126912.1|2312986_2313199_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	50.0	1.5e-12
WP_002000703.1|2313284_2314454_+	ATP-dependent RNA helicase RhlB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.7	3.4e-50
>prophage 163
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2320625	2329372	4030371	protease,tRNA	Mollivirus(25.0%)	8	NA	NA
WP_000334670.1|2320625_2322167_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.8	1.5e-85
WP_000665946.1|2322245_2324135_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000580181.1|2324235_2324886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000758326.1|2324897_2325863_+	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	28.3	3.8e-15
WP_002000697.1|2326009_2327437_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000209410.1|2327527_2327974_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	40.8	1.9e-17
WP_001136722.1|2328000_2328216_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000636263.1|2328361_2329372_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	66.3	2.1e-125
>prophage 164
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2333136	2333940	4030371		Iragoides_fasciata_nucleopolyhedrovirus(100.0%)	1	NA	NA
WP_000912073.1|2333136_2333940_+	protein kinase	NA	B6VC32	Iragoides_fasciata_nucleopolyhedrovirus	33.9	1.0e-05
>prophage 165
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2375387	2384305	4030371	transposase	Leptospira_phage(40.0%)	7	NA	NA
WP_002001451.1|2375387_2376572_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_000052512.1|2376970_2378446_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|2378501_2379386_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000753551.1|2380029_2381589_-|transposase	IS66-like element ISAba24 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	4.0e-70
WP_000781558.1|2381681_2382038_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.9	1.6e-22
WP_000555098.1|2382040_2382325_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|2383600_2384305_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 166
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2390474	2395677	4030371		Planktothrix_phage(50.0%)	4	NA	NA
WP_000614025.1|2390474_2391500_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	9.1e-31
WP_000733779.1|2391575_2392442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024112.1|2392690_2393977_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000153210.1|2394102_2395677_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.6	7.1e-67
>prophage 167
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2407151	2408597	4030371		Escherichia_phage(100.0%)	1	NA	NA
WP_000075891.1|2407151_2408597_-	replicative DNA helicase	NA	O80281	Escherichia_phage	51.7	5.6e-119
>prophage 168
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2416086	2418474	4030371		Hokovirus(100.0%)	1	NA	NA
WP_000853480.1|2416086_2418474_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	6.3e-176
>prophage 169
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2433016	2433856	4030371		Bacillus_virus(100.0%)	1	NA	NA
WP_001285156.1|2433016_2433856_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.9	1.4e-24
>prophage 170
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2438418	2447794	4030371		Staphylococcus_phage(33.33%)	8	NA	NA
WP_000853316.1|2438418_2440062_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	37.5	1.8e-76
WP_000083685.1|2440106_2440685_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_000137905.1|2440854_2441631_+	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_000739369.1|2441689_2442988_+	AarF/ABC1/UbiB kinase family protein	NA	A0A0R6PEF3	Moraxella_phage	49.3	7.5e-107
WP_000338780.1|2443003_2443384_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000993387.1|2443340_2443778_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_000891197.1|2444036_2445746_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_014462729.1|2445754_2447794_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	28.4	3.6e-39
>prophage 171
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2477109	2479062	4030371		Wolbachia_phage(100.0%)	1	NA	NA
WP_000129009.1|2477109_2479062_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	33.1	3.5e-84
>prophage 172
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2483406	2485812	4030371	tRNA	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000009660.1|2483406_2483916_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	34.0	9.4e-13
WP_000803945.1|2484084_2485812_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.2	1.2e-187
>prophage 173
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2496416	2498129	4030371		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000808295.1|2496416_2498129_+	AAA family ATPase	NA	A0A172Q090	Acinetobacter_phage	40.0	1.7e-77
>prophage 174
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2516943	2517414	4030371		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001123845.1|2516943_2517414_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.4	4.9e-32
>prophage 175
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2525167	2533093	4030371		Hokovirus(33.33%)	8	NA	NA
WP_000193592.1|2525167_2526751_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	25.3	1.7e-20
WP_001109442.1|2527010_2527454_-	universal stress protein	NA	NA	NA	NA	NA
WP_000774578.1|2527742_2527970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001139332.1|2528148_2528322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000221474.1|2528594_2529038_+	RDD family protein	NA	NA	NA	NA	NA
WP_001983688.1|2529339_2529501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000675125.1|2529601_2532358_+	magnesium-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.2	6.4e-39
WP_000775740.1|2532373_2533093_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.8	2.3e-12
>prophage 176
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2542558	2548348	4030371		Tupanvirus(33.33%)	4	NA	NA
WP_000588786.1|2542558_2543818_+	serine hydrolase	NA	A0A2K9L1U3	Tupanvirus	23.6	2.8e-13
WP_000323808.1|2543865_2544444_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001170321.1|2544569_2546048_+	multidrug efflux MFS transporter AmvA	NA	A0A0M3UL24	Mycobacterium_phage	26.4	7.9e-28
WP_000285265.1|2546221_2548348_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	30.6	1.2e-40
>prophage 177
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2564118	2587673	4030371	capsid,integrase,terminase	Acinetobacter_phage(85.37%)	41	2558822:2558835	2579893:2579906
2558822:2558835	attL	TTGAATGCTTCGCA	NA	NA	NA	NA
WP_000773619.1|2564118_2565381_+|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	100.0	3.8e-249
WP_000910238.1|2565386_2565656_-	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
WP_016062494.1|2565656_2566010_-	hypothetical protein	NA	J7I0Y4	Acinetobacter_phage	100.0	1.2e-62
WP_050514046.1|2566006_2566345_-	hypothetical protein	NA	J7HXR6	Acinetobacter_phage	74.4	3.4e-27
WP_033503087.1|2566345_2566597_-	hypothetical protein	NA	A0A0P0I475	Acinetobacter_phage	98.7	1.1e-38
WP_075703273.1|2566598_2567675_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	72.3	6.4e-136
WP_004793763.1|2567671_2568793_-	ATP-binding protein	NA	A0A0D4DBX7	Acinetobacter_phage	99.7	1.3e-211
WP_000064466.1|2568804_2569128_-	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	98.1	7.4e-56
WP_057048852.1|2569120_2569411_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	2.3e-48
WP_001101038.1|2569410_2569854_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
WP_094327873.1|2570346_2570637_-	hypothetical protein	NA	A0A0D4DBS2	Acinetobacter_phage	99.0	2.6e-44
WP_001169164.1|2570687_2570903_-	KTSC domain-containing protein	NA	A0A0D4DBY2	Acinetobacter_phage	100.0	5.0e-32
WP_001037047.1|2570960_2571251_-	hypothetical protein	NA	A0A0D4DCB9	Acinetobacter_phage	100.0	7.9e-49
WP_000562174.1|2571290_2571590_-	hypothetical protein	NA	A0A0D4DCL0	Acinetobacter_phage	100.0	1.5e-47
WP_000605245.1|2571629_2572355_-	LexA family transcriptional regulator	NA	A0A0D4DBI5	Acinetobacter_phage	100.0	1.8e-134
WP_001068174.1|2572481_2572712_+	hypothetical protein	NA	A0A0D4DBS7	Acinetobacter_phage	100.0	6.1e-36
WP_071211250.1|2572748_2573015_+	hypothetical protein	NA	A0A0D4DBY7	Acinetobacter_phage	98.9	1.0e-42
WP_094327875.1|2573062_2573335_+	hypothetical protein	NA	A0A0D4DCC3	Acinetobacter_phage	94.4	5.9e-38
WP_001084140.1|2573331_2573628_+	hypothetical protein	NA	A0A0P0HSJ2	Acinetobacter_phage	98.0	8.9e-48
WP_004834286.1|2573624_2573981_+	hypothetical protein	NA	A0A0D4DBI9	Acinetobacter_phage	98.3	9.7e-57
WP_033503110.1|2574039_2574933_+	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	97.6	3.5e-156
WP_000993074.1|2574929_2575700_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	99.6	1.2e-147
WP_002053068.1|2575696_2575831_+	putative phage replication protein	NA	A0A0D4DCC7	Acinetobacter_phage	95.5	8.1e-17
WP_033503114.1|2575817_2576165_+	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	59.7	4.6e-35
WP_002037443.1|2576214_2576577_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	99.2	6.6e-69
WP_001278405.1|2577079_2577265_+	hypothetical protein	NA	A0A0D4DCN1	Acinetobacter_phage	96.4	2.5e-24
WP_001204257.1|2577257_2577590_+	hypothetical protein	NA	E2GLW0	Acinetobacter_phage	44.7	2.0e-11
WP_033503127.1|2577593_2577953_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	84.7	4.1e-23
WP_094327763.1|2577952_2578357_+	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	94.7	1.2e-66
WP_043041588.1|2578356_2578833_+	hypothetical protein	NA	A0A0P0I4C3	Acinetobacter_phage	100.0	1.2e-86
WP_043041586.1|2578893_2579223_+	hypothetical protein	NA	A0A0N7IRG0	Acinetobacter_phage	100.0	3.6e-58
WP_043041584.1|2579356_2579743_+	hypothetical protein	NA	A0A0P0IL19	Acinetobacter_phage	100.0	8.6e-67
WP_057691265.1|2580159_2580627_+	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	94.2	1.3e-80
2579893:2579906	attR	TGCGAAGCATTCAA	NA	NA	NA	NA
WP_057045695.1|2580595_2581237_+	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	99.1	8.8e-125
WP_017402944.1|2581295_2581772_+	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	45.8	4.2e-31
WP_153227860.1|2581749_2583276_+|terminase	phage terminase large subunit	terminase	I3PGT7	Xanthomonas_phage	42.2	7.3e-93
WP_038405917.1|2583284_2584619_+	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	38.9	2.2e-85
WP_005068140.1|2584563_2585376_+|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	41.4	1.3e-51
WP_033502645.1|2585427_2585913_+	DUF1643 domain-containing protein	NA	A0A0U2UUT5	Pseudomonas_phage	39.3	1.2e-25
WP_153227861.1|2585990_2587184_+	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	41.1	5.1e-25
WP_000060044.1|2587202_2587673_+	hypothetical protein	NA	M4T3R5	Psychrobacter_phage	43.1	8.1e-19
>prophage 178
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2592821	2607692	4030371	tail,transposase	Acinetobacter_phage(63.64%)	13	NA	NA
WP_171500528.1|2592821_2595857_+|tail	phage tail protein	tail	A0A1Q1PW43	Pseudoalteromonas_phage	45.8	2.6e-41
WP_033502657.1|2595867_2596521_+	DUF2460 domain-containing protein	NA	NA	NA	NA	NA
WP_016802927.1|2596517_2597375_+	DUF2163 domain-containing protein	NA	A0A2D1GNT2	Pseudomonas_phage	24.5	1.5e-10
WP_041172386.1|2597435_2599667_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_041172387.1|2599719_2600157_+	DUF1833 family protein	NA	A0A2H5BHF6	Acinetobacter_phage	83.6	1.2e-19
WP_000792725.1|2600197_2600620_+	C40 family peptidase	NA	A0A0B5A615	Paracoccus_phage	31.9	5.8e-08
WP_042052162.1|2600620_2603110_+	hypothetical protein	NA	A0A1I9L2F3	Xanthomonas_phage	23.4	6.9e-08
WP_000433918.1|2603176_2603566_+	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	2.5e-66
WP_001019712.1|2603608_2604154_+	N-acetylmuramidase	NA	A0A0P0IW03	Acinetobacter_phage	97.2	9.2e-99
WP_000999701.1|2604342_2605023_+	hypothetical protein	NA	A0A0P0IKS6	Acinetobacter_phage	100.0	4.6e-116
WP_001109862.1|2605033_2605681_+	hypothetical protein	NA	J7I4R4	Acinetobacter_phage	100.0	3.6e-118
WP_000151893.1|2605687_2606281_+	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	100.0	5.1e-103
WP_085942227.1|2606526_2607692_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
>prophage 179
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2612550	2613879	4030371		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000652023.1|2612550_2613879_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	44.3	1.4e-100
>prophage 180
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2633853	2636323	4030371		uncultured_Caudovirales_phage(66.67%)	5	NA	NA
WP_001047539.1|2633853_2634165_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	43.1	2.0e-18
WP_000194629.1|2634184_2634469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000859778.1|2634486_2634837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105719.1|2634881_2635250_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	37.0	8.9e-13
WP_000604791.1|2635315_2636323_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A2K9L5H6	Tupanvirus	31.9	9.5e-49
>prophage 181
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2651016	2651769	4030371		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000132219.1|2651016_2651769_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	42.2	4.3e-22
>prophage 182
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2662508	2663558	4030371		Bacillus_phage(100.0%)	1	NA	NA
WP_000344169.1|2662508_2663558_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.4	5.7e-113
>prophage 183
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2671996	2675553	4030371		Tupanvirus(33.33%)	3	NA	NA
WP_001026393.1|2671996_2673175_+	S8 family peptidase	NA	A0A2K9L570	Tupanvirus	40.6	3.2e-32
WP_000957160.1|2673222_2674677_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	69.3	1.0e-181
WP_000332536.1|2674914_2675553_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	54.5	2.7e-57
>prophage 184
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2685393	2688252	4030371		Hokovirus(100.0%)	1	NA	NA
WP_000880346.1|2685393_2688252_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	32.2	5.1e-15
>prophage 185
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2724321	2728870	4030371	protease	uncultured_Mediterranean_phage(25.0%)	4	NA	NA
WP_001260032.1|2724321_2724735_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.0	2.9e-12
WP_000952702.1|2724744_2727021_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.3	4.0e-164
WP_000904308.1|2727024_2727387_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	62.6	1.3e-27
WP_000993015.1|2727814_2728870_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A1Z1LZD8	Serratia_phage	45.8	1.4e-82
>prophage 186
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2736754	2740616	4030371		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
WP_000148660.1|2736754_2738392_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.7	8.2e-151
WP_000080538.1|2738423_2739281_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.4	1.5e-50
WP_000078452.1|2739326_2740616_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.8	1.0e-135
>prophage 187
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2751420	2752248	4030371		Streptococcus_phage(100.0%)	1	NA	NA
WP_014462804.1|2751420_2752248_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.8	1.1e-18
>prophage 188
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2808328	2809963	4030371		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000181290.1|2808328_2809963_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	24.2	2.2e-18
>prophage 189
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2815974	2822130	4030371		Mycobacterium_phage(33.33%)	5	NA	NA
WP_000542600.1|2815974_2816805_+	alpha/beta hydrolase	NA	A0A1B1SFC9	Mycobacterium_phage	29.8	4.8e-14
WP_000997200.1|2816881_2818402_+	catalase	NA	A0A2K9L0T1	Tupanvirus	45.1	5.4e-96
WP_000482354.1|2818870_2819914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049441.1|2820113_2820920_-	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000685011.1|2821119_2822130_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	38.2	4.9e-61
>prophage 190
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2841406	2843152	4030371		Moraxella_phage(100.0%)	1	NA	NA
WP_000956372.1|2841406_2843152_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	29.7	1.3e-69
>prophage 191
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2862121	2863099	4030371		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000824433.1|2862121_2863099_-	hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	31.2	1.2e-29
>prophage 192
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2886056	2898281	4030371		Bacillus_virus(33.33%)	12	NA	NA
WP_000206303.1|2886056_2887109_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	45.1	2.8e-88
WP_000770288.1|2887539_2888559_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002001037.1|2888561_2889572_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000614432.1|2889568_2890333_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.2e-16
WP_000177605.1|2890335_2890824_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001244448.1|2890818_2891607_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000965123.1|2891705_2892515_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001007527.1|2892696_2893581_+	ribose-phosphate pyrophosphokinase	NA	A0A076G6G0	Escherichia_phage	39.0	1.2e-34
WP_000152964.1|2893592_2895086_+	nicotinate phosphoribosyltransferase	NA	A0A1W6DY18	Aeromonas_phage	51.1	6.3e-142
WP_000155202.1|2895146_2895914_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	32.2	1.5e-25
WP_000959831.1|2896029_2897382_+	methylenetetrahydrofolate reductase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000675786.1|2897936_2898281_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	39.3	2.0e-14
>prophage 193
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2916989	2917430	4030371		Vibrio_phage(100.0%)	1	NA	NA
WP_000193121.1|2916989_2917430_-	HD domain-containing protein	NA	A0A0B5H2U9	Vibrio_phage	35.5	6.2e-13
>prophage 194
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2920681	2921176	4030371		Haemophilus_phage(100.0%)	1	NA	NA
WP_001987702.1|2920681_2921176_+	phage antirepressor KilAC domain-containing protein	NA	Q7Y5W2	Haemophilus_phage	54.9	3.5e-28
>prophage 195
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2929791	2934978	4030371		Leptospira_phage(66.67%)	3	NA	NA
WP_000459542.1|2929791_2930535_-	efflux system response regulator transcription factor AdeR	NA	W8CYM9	Bacillus_phage	30.2	7.5e-27
WP_001169094.1|2930680_2931871_+	multidrug efflux RND transporter periplasmic adaptor subunit AdeA	NA	S5VL44	Leptospira_phage	22.4	8.1e-07
WP_000987613.1|2931867_2934978_+	multidrug efflux RND transporter permease subunit AdeB	NA	S5VTK5	Leptospira_phage	24.4	6.1e-62
>prophage 196
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2955283	2961563	4030371		Prochlorococcus_phage(33.33%)	5	NA	NA
WP_000842122.1|2955283_2956393_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.5	6.8e-32
WP_064851197.1|2956622_2958317_-	hypothetical protein	NA	A0A076G822	Escherichia_phage	37.5	2.0e-104
WP_000040089.1|2958676_2959840_+	catalase family protein	NA	NA	NA	NA	NA
WP_001127336.1|2959917_2960283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001136790.1|2961095_2961563_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	52.4	2.3e-37
>prophage 197
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2977121	2977742	4030371		Planktothrix_phage(100.0%)	1	NA	NA
WP_000904336.1|2977121_2977742_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.9	7.7e-17
>prophage 198
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	2987330	2988116	4030371		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_001024687.1|2987330_2988116_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.2	1.4e-10
>prophage 199
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3011413	3014839	4030371		Burkholderia_virus(50.0%)	4	NA	NA
WP_000222732.1|3011413_3012700_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.6	8.1e-37
WP_001167102.1|3012739_3013021_-	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_000011848.1|3013004_3014003_-	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000117516.1|3013999_3014839_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	9.0e-37
>prophage 200
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3020192	3021542	4030371		Ochrobactrum_phage(100.0%)	1	NA	NA
WP_001186395.1|3020192_3021542_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	66.7	1.2e-30
>prophage 201
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3043661	3044753	4030371		Pandoravirus(100.0%)	1	NA	NA
WP_000918448.1|3043661_3044753_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.1	1.4e-77
>prophage 202
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3067241	3068999	4030371		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000567280.1|3067241_3068999_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.2	2.8e-19
>prophage 203
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3077632	3081236	4030371		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000572403.1|3077632_3078742_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.5	5.5e-82
WP_000035228.1|3078817_3079561_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001023028.1|3079667_3081236_-	histidine-type phosphatase	NA	A0A218MNG5	uncultured_virus	65.5	2.4e-115
>prophage 204
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3103519	3108976	4030371		Acanthocystis_turfacea_Chlorella_virus(50.0%)	4	NA	NA
WP_000070798.1|3103519_3104893_+	AarF/ABC1/UbiB kinase family protein	NA	M1HE59	Acanthocystis_turfacea_Chlorella_virus	25.7	5.5e-07
WP_002000226.1|3105122_3106406_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001053235.1|3106427_3107633_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000993538.1|3107752_3108976_-	alkane 1-monooxygenase	NA	A0A1V0SBK9	Catovirus	36.6	7.2e-51
>prophage 205
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3112149	3112422	4030371		Burkholderia_phage(100.0%)	1	NA	NA
WP_001043034.1|3112149_3112422_-	HU family DNA-binding protein	NA	Q6QIE5	Burkholderia_phage	65.2	1.3e-24
>prophage 206
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3115774	3120887	4030371		Lake_Baikal_phage(50.0%)	6	NA	NA
WP_000331712.1|3115774_3116161_+	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	79.0	6.0e-52
WP_000581594.1|3116191_3116512_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	2.0e-24
WP_001015254.1|3116597_3117116_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196572.1|3117154_3119014_+	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	40.4	8.0e-102
WP_001137383.1|3119032_3119371_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001175670.1|3119417_3120887_-	guanylate cyclase	NA	A0A218MLZ2	uncultured_virus	29.3	5.5e-21
>prophage 207
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3131596	3138241	4030371		uncultured_virus(33.33%)	5	NA	NA
WP_001117472.1|3131596_3132331_-	SOS response-associated peptidase family protein	NA	A0A218MNF5	uncultured_virus	41.3	1.2e-48
WP_001295038.1|3132363_3134094_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	6.7e-18
WP_000953840.1|3134106_3135249_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000881926.1|3135256_3136195_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000719393.1|3136207_3138241_-	Zn-dependent oligopeptidase	NA	A0A1V0SID3	Klosneuvirus	29.7	3.1e-75
>prophage 208
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3142730	3145316	4030371		Acinetobacter_phage(100.0%)	1	NA	NA
WP_138140468.1|3142730_3145316_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.6	4.0e-43
>prophage 209
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3158403	3158706	4030371		Burkholderia_phage(100.0%)	1	NA	NA
WP_000205997.1|3158403_3158706_-	integration host factor subunit beta	NA	B5TA87	Burkholderia_phage	42.9	5.6e-13
>prophage 210
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3161847	3164192	4030371	tRNA	Pandoravirus(50.0%)	3	NA	NA
WP_000033178.1|3161847_3162351_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	31.3	6.5e-06
WP_001983908.1|3162357_3163482_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_001177528.1|3163478_3164192_-	uracil-DNA glycosylase	NA	A0A0B4Q626	Equid_gammaherpesvirus	47.6	1.1e-51
>prophage 211
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3172229	3176749	4030371		Bacillus_phage(33.33%)	5	NA	NA
WP_001070734.1|3172229_3173957_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.6	5.0e-58
WP_000669684.1|3173953_3174382_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_000264037.1|3174397_3175033_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_000023433.1|3175082_3175970_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.6	7.4e-13
WP_000057212.1|3175966_3176749_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	26.7	5.7e-17
>prophage 212
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3194307	3200841	4030371		Bacillus_phage(33.33%)	6	NA	NA
WP_000922240.1|3194307_3196155_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	9.0e-29
WP_000966086.1|3196154_3196595_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_000705521.1|3196703_3197729_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001016343.1|3197767_3198142_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000164254.1|3198244_3198943_+	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	43.1	1.9e-32
WP_000119795.1|3199350_3200841_+	sodium/proline symporter PutP	NA	A0A240F3J2	Aeromonas_phage	23.7	2.4e-08
>prophage 213
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3212868	3214035	4030371		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001209544.1|3212868_3214035_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.6	1.4e-125
>prophage 214
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3235409	3236642	4030371	integrase	Moraxella_phage(100.0%)	1	3228658:3228672	3237074:3237088
3228658:3228672	attL	CAAAATTTAGCTTAA	NA	NA	NA	NA
WP_000108020.1|3235409_3236642_-|integrase	integrase family protein	integrase	A0A0R6PHM8	Moraxella_phage	43.3	6.5e-84
WP_000108020.1|3235409_3236642_-|integrase	integrase family protein	integrase	A0A0R6PHM8	Moraxella_phage	43.3	6.5e-84
3237074:3237088	attR	TTAAGCTAAATTTTG	NA	NA	NA	NA
>prophage 215
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3242629	3243373	4030371		Planktothrix_phage(100.0%)	1	NA	NA
WP_001132006.1|3242629_3243373_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	8.0e-29
>prophage 216
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3253125	3254202	4030371		Planktothrix_phage(100.0%)	1	NA	NA
WP_001986595.1|3253125_3254202_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.8	1.7e-35
>prophage 217
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3266952	3267438	4030371		Fowlpox_virus(100.0%)	1	NA	NA
WP_000066032.1|3266952_3267438_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	39.6	3.0e-24
>prophage 218
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3273264	3276828	4030371		Streptomyces_phage(100.0%)	1	NA	NA
WP_001160989.1|3273264_3276828_+	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	34.6	6.7e-174
>prophage 219
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3281711	3283298	4030371		Lactococcus_phage(100.0%)	1	NA	NA
WP_000558747.1|3281711_3283298_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.8	1.4e-25
>prophage 220
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3286769	3287612	4030371		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_000610147.1|3286769_3287099_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.2	5.8e-24
WP_000138008.1|3287183_3287612_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	59.1	2.6e-40
>prophage 221
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3296868	3297663	4030371		Bacillus_virus(100.0%)	1	NA	NA
WP_000114460.1|3296868_3297663_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.1	9.8e-33
>prophage 222
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3321972	3323463	4030371		Streptococcus_phage(100.0%)	1	NA	NA
WP_000113406.1|3321972_3323463_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	29.4	4.2e-21
>prophage 223
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3331030	3333899	4030371		Tupanvirus(50.0%)	2	NA	NA
WP_001107594.1|3331030_3331963_+	hypothetical protein	NA	A0A2K9L2D2	Tupanvirus	35.7	2.2e-44
WP_000211582.1|3331937_3333899_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.3	1.2e-92
>prophage 224
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3338118	3345303	4030371		Planktothrix_phage(50.0%)	7	NA	NA
WP_001130362.1|3338118_3338850_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.5	5.6e-35
WP_000418064.1|3338852_3339518_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000937460.1|3339507_3340143_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002017921.1|3340231_3340345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025680.1|3340454_3340739_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000107128.1|3340882_3341842_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000115408.1|3341838_3345303_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.5	8.6e-33
>prophage 225
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3348467	3358960	4030371		uncultured_Caudovirales_phage(20.0%)	12	NA	NA
WP_001124846.1|3348467_3349079_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.9	2.2e-48
WP_000795915.1|3349361_3349598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000371197.1|3349658_3350765_-	stress-induced protein	NA	NA	NA	NA	NA
WP_000983628.1|3351315_3351729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000432330.1|3351870_3352749_+	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	41.4	3.8e-54
WP_001990041.1|3352805_3354950_-	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	47.1	5.2e-137
WP_001145693.1|3355004_3356414_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_000482091.1|3356729_3357209_+	CinA family protein	NA	A0A218MNG4	uncultured_virus	50.3	1.8e-34
WP_000108365.1|3357493_3357715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132044.1|3357820_3358138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000498477.1|3358222_3358444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001136759.1|3358531_3358960_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.8	2.1e-26
>prophage 226
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3365204	3374286	4030371		Staphylococcus_phage(33.33%)	7	NA	NA
WP_001183739.1|3365204_3366899_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	2.2e-26
WP_001990034.1|3367010_3367604_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001053639.1|3367772_3368945_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_001072761.1|3368969_3370571_+	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	69.4	3.9e-20
WP_000121720.1|3370580_3371384_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_000461798.1|3371395_3373387_+	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_001288905.1|3373383_3374286_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	39.6	7.9e-47
>prophage 227
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3390388	3391150	4030371		Bacillus_phage(100.0%)	1	NA	NA
WP_000101935.1|3390388_3391150_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	45.2	3.2e-09
>prophage 228
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3408522	3409725	4030371		Bacillus_virus(100.0%)	1	NA	NA
WP_001166815.1|3408522_3409725_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.6	6.4e-28
>prophage 229
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3470009	3473135	4030371		Pandoravirus(50.0%)	4	NA	NA
WP_000646729.1|3470009_3470492_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	40.6	8.3e-19
WP_085916981.1|3470507_3471155_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000460184.1|3471327_3472179_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000972583.1|3472181_3473135_-	M15 family metallopeptidase	NA	A0A0H4TGB9	Bacillus_phage	33.3	2.8e-10
>prophage 230
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3477080	3479762	4030371		Salicola_phage(100.0%)	1	NA	NA
WP_002001416.1|3477080_3479762_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.8	1.3e-81
>prophage 231
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3496407	3497289	4030371		Bacillus_virus(100.0%)	1	NA	NA
WP_001000091.1|3496407_3497289_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	1.1e-37
>prophage 232
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3507898	3509062	4030371		Synechococcus_phage(100.0%)	1	NA	NA
WP_001202390.1|3507898_3509062_-	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.7	5.3e-11
>prophage 233
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3513044	3514265	4030371		Streptococcus_phage(100.0%)	1	NA	NA
WP_000698627.1|3513044_3514265_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	29.7	1.2e-32
>prophage 234
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3523606	3531700	4030371		uncultured_Caudovirales_phage(100.0%)	2	NA	NA
WP_000015582.1|3523606_3528514_-	RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	52.4	9.3e-49
WP_000934999.1|3528523_3531700_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	64.1	9.7e-257
>prophage 235
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3535063	3535522	4030371		Acinetobacter_phage(100.0%)	1	NA	NA
WP_001127331.1|3535063_3535522_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.1	6.9e-31
>prophage 236
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3542930	3543863	4030371		Morganella_phage(100.0%)	1	NA	NA
WP_000165398.1|3542930_3543863_-	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	34.7	1.0e-41
>prophage 237
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3547570	3578911	4030371	capsid,tRNA	Acinetobacter_phage(37.5%)	35	NA	NA
WP_001083258.1|3547570_3550216_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.9	1.5e-32
WP_049081181.1|3550280_3550811_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000144889.1|3551155_3551479_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_000232555.1|3551659_3552331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001186835.1|3552470_3553139_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	42.5	7.5e-26
WP_001082436.1|3553255_3554098_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	2.6e-36
WP_000132359.1|3554253_3554865_-	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	55.6	1.6e-11
WP_000885988.1|3554857_3555457_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.6	5.0e-21
WP_000003555.1|3555549_3556740_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000988402.1|3556736_3558878_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.7	2.7e-29
WP_015451474.1|3558874_3560098_-	TolC family protein	NA	NA	NA	NA	NA
WP_001183458.1|3560615_3561362_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
WP_000554244.1|3561361_3561910_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_000381220.1|3561893_3562442_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000179338.1|3562479_3563019_-	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_001133555.1|3563022_3564000_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	9.5e-38
WP_001182287.1|3564213_3565635_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.6	3.3e-55
WP_000248356.1|3566135_3566765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000644342.1|3567149_3567743_-	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_000157563.1|3568322_3568469_-	hypothetical protein	NA	A0A0B5KTG2	Acinetobacter_phage	100.0	3.4e-08
WP_001210983.1|3568482_3568812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001133965.1|3568898_3569345_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000648017.1|3569456_3570671_+	MFS transporter	NA	NA	NA	NA	NA
WP_000790417.1|3570665_3571772_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	66.9	4.5e-145
WP_001004676.1|3571869_3572214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001127325.1|3572505_3572964_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.8	3.5e-27
WP_001982898.1|3573448_3573568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000932369.1|3573724_3574540_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000350297.1|3574819_3575044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072673.1|3575247_3575463_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.0	7.7e-17
WP_000015964.1|3575982_3576600_+	LysE family translocator	NA	NA	NA	NA	NA
WP_001019691.1|3576666_3577212_-	N-acetylmuramidase	NA	A0A0N7IRF5	Acinetobacter_phage	72.9	7.8e-74
WP_000427184.1|3577249_3577639_-	hypothetical protein	NA	A0A0P0IVR6	Acinetobacter_phage	74.4	1.1e-48
WP_000016214.1|3577806_3578004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001185374.1|3578239_3578911_+	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	55.2	3.1e-64
>prophage 238
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3582783	3587925	4030371		Acinetobacter_phage(50.0%)	5	NA	NA
WP_000980495.1|3582783_3583113_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	63.8	3.1e-33
WP_001088962.1|3583592_3583949_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_000331914.1|3584541_3584949_-	GFA family protein	NA	NA	NA	NA	NA
WP_001020651.1|3584976_3585378_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000377582.1|3585453_3587925_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	34.4	1.0e-96
>prophage 239
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3599040	3606956	4030371		Catovirus(50.0%)	6	NA	NA
WP_000931785.1|3599040_3602898_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	28.1	6.4e-45
WP_001987180.1|3603238_3603814_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_000024050.1|3604006_3604222_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_001133994.1|3604286_3604874_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_000058246.1|3604910_3605129_-	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_170832522.1|3605369_3606956_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.8	3.0e-25
>prophage 240
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3620845	3625078	4030371		uncultured_virus(33.33%)	3	NA	NA
WP_000941316.1|3620845_3621334_+	CinA family protein	NA	A0A218MNG4	uncultured_virus	43.3	4.0e-29
WP_001210050.1|3621390_3623970_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	32.4	1.3e-123
WP_001237344.1|3624271_3625078_+	peptidoglycan DD-metalloendopeptidase family protein	NA	G9BW84	Planktothrix_phage	35.9	9.0e-18
>prophage 241
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3630954	3652154	4030371	holin,integrase,tRNA	Acinetobacter_phage(22.22%)	15	3623553:3623568	3640597:3640612
3623553:3623568	attL	TATTTTCAATTACTTT	NA	NA	NA	NA
WP_000517792.1|3630954_3632274_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.0	4.8e-69
WP_000155680.1|3632338_3633505_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_001188823.1|3633780_3634806_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000199457.1|3635075_3637712_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
WP_094320740.1|3637998_3639201_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A0R6PHZ3	Moraxella_phage	48.7	2.2e-100
WP_094914337.1|3639415_3640603_+	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	30.1	3.1e-22
WP_094320738.1|3640748_3641129_-	hypothetical protein	NA	NA	NA	NA	NA
3640597:3640612	attR	AAAGTAATTGAAAATA	NA	NA	NA	NA
WP_094320737.1|3641128_3641674_-	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	51.9	9.3e-43
WP_042052159.1|3641657_3641933_-|holin	holin	holin	NA	NA	NA	NA
WP_000792725.1|3644486_3644909_-	C40 family peptidase	NA	A0A0B5A615	Paracoccus_phage	31.9	5.8e-08
WP_042052165.1|3644949_3645729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042052167.1|3645732_3647553_-	hypothetical protein	NA	A0A0S1S0B7	Acinetobacter_phage	49.7	1.8e-114
WP_001248148.1|3647613_3648471_-	DUF2163 domain-containing protein	NA	A0A2D1GNT2	Pseudomonas_phage	26.0	8.7e-11
WP_001286154.1|3648467_3649121_-	DUF2460 domain-containing protein	NA	NA	NA	NA	NA
WP_002070526.1|3649130_3652154_-	hypothetical protein	NA	A0A1Q1PW43	Pseudoalteromonas_phage	45.8	2.6e-41
>prophage 242
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3657301	3703459	4030371	transposase,terminase,capsid	Acinetobacter_phage(42.86%)	56	NA	NA
WP_000060044.1|3657301_3657772_-	hypothetical protein	NA	M4T3R5	Psychrobacter_phage	43.1	8.1e-19
WP_000790539.1|3657790_3658984_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	40.0	1.6e-23
WP_019204867.1|3659080_3660454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207475.1|3660534_3661344_-|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	41.0	1.6e-51
WP_042052181.1|3661288_3662623_-	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	37.8	2.4e-84
WP_042052183.1|3662631_3664158_-|terminase	phage terminase large subunit	terminase	A0A291LBL3	Klebsiella_phage	41.0	4.7e-92
WP_042052184.1|3664135_3664612_-	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	53.6	4.5e-33
WP_042052185.1|3664670_3665312_-	hypothetical protein	NA	J7I4N9	Acinetobacter_phage	89.2	7.7e-113
WP_000378504.1|3665280_3665709_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	69.0	1.7e-47
WP_001136770.1|3665769_3666225_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	94.0	2.6e-78
WP_000152657.1|3666888_3667125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039309.1|3667333_3667678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002001423.1|3668434_3668554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000619822.1|3668748_3669324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000959666.1|3669473_3670226_-	hypothetical protein	NA	A0A0P0J081	Acinetobacter_phage	92.8	4.8e-130
WP_042052234.1|3670236_3670638_-	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	95.5	4.0e-67
WP_042052242.1|3670637_3670853_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	43.2	3.6e-06
WP_094320719.1|3670845_3671241_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	47.6	1.4e-24
WP_094320720.1|3671237_3671645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109433707.1|3671641_3671761_-	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	88.6	2.9e-10
WP_094320722.1|3672498_3673440_-	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	81.5	3.4e-141
WP_057065241.1|3674273_3674561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094320724.1|3674611_3675112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210973.1|3675166_3675415_-	helix-turn-helix domain-containing protein	NA	A0A0R6PH31	Moraxella_phage	58.6	8.0e-18
WP_094320725.1|3675417_3676209_+	helix-turn-helix domain-containing protein	NA	A0A0R6PH50	Moraxella_phage	50.7	5.2e-10
WP_094320726.1|3676425_3676866_+	hypothetical protein	NA	A0A0D4DBH9	Acinetobacter_phage	91.8	5.5e-70
WP_094320727.1|3676868_3677129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094320728.1|3677131_3677458_+	hypothetical protein	NA	A0A0P0IRC4	Acinetobacter_phage	95.4	1.0e-52
WP_001207471.1|3677469_3678591_+	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	100.0	5.2e-213
WP_094320752.1|3678587_3679547_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	85.9	2.2e-151
WP_005120240.1|3679548_3679794_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	96.3	3.7e-39
WP_000481377.1|3679796_3680276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094914353.1|3680272_3680995_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	87.4	9.8e-56
WP_000362184.1|3680996_3681212_+	hypothetical protein	NA	A0A0R6PG25	Moraxella_phage	55.9	3.7e-11
WP_001185176.1|3681421_3682702_+	aspartate kinase	NA	NA	NA	NA	NA
WP_000906487.1|3682948_3683203_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_000495836.1|3683272_3683839_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	42.4	1.8e-25
WP_000735756.1|3683904_3684294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111760.1|3684532_3685090_+	cytochrome b	NA	NA	NA	NA	NA
WP_001077405.1|3685133_3686132_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000729980.1|3686243_3687563_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.8	7.8e-59
WP_002001404.1|3687885_3688083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256760.1|3688481_3690032_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000599996.1|3690055_3690886_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000226456.1|3690951_3691914_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000459997.1|3692424_3693147_+	pirin family protein	NA	NA	NA	NA	NA
WP_000107496.1|3693211_3693835_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|3693894_3694599_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|3694728_3695544_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_000902128.1|3695697_3695877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|3695968_3696673_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000904905.1|3696684_3697344_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.4e-37
WP_001067855.1|3700367_3701072_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|3701142_3702003_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_029642339.1|3702185_3702725_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.8	1.2e-85
WP_001067855.1|3702754_3703459_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 243
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3706530	3711041	4030371		Dickeya_phage(33.33%)	4	NA	NA
WP_001986427.1|3706530_3707889_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	81.0	2.0e-54
WP_000013374.1|3707947_3709210_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.6	2.9e-18
WP_001084867.1|3709359_3710394_+	dihydroorotase	NA	NA	NA	NA	NA
WP_001982681.1|3710378_3711041_+	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	35.4	2.0e-07
>prophage 244
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3714921	3716511	4030371		Planktothrix_phage(100.0%)	1	NA	NA
WP_000550783.1|3714921_3716511_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	3.2e-19
>prophage 245
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3720431	3725259	4030371		Lactobacillus_phage(50.0%)	2	NA	NA
WP_000277826.1|3720431_3723647_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	37.7	2.8e-25
WP_000084042.1|3723879_3725259_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.6	7.9e-38
>prophage 246
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3730051	3730888	4030371		Streptococcus_phage(100.0%)	1	NA	NA
WP_001275986.1|3730051_3730888_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.9	4.0e-45
>prophage 247
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3740474	3741848	4030371	integrase	Moraxella_phage(100.0%)	1	3736602:3736614	3741850:3741862
3736602:3736614	attL	ACTCAAGTTTTAA	NA	NA	NA	NA
WP_000046989.1|3740474_3741848_+|integrase	integrase family protein	integrase	A0A0R6PGY7	Moraxella_phage	41.5	1.9e-76
WP_000046989.1|3740474_3741848_+|integrase	integrase family protein	integrase	A0A0R6PGY7	Moraxella_phage	41.5	1.9e-76
3741850:3741862	attR	ACTCAAGTTTTAA	NA	NA	NA	NA
>prophage 248
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3747298	3775971	4030371	terminase,capsid	Acinetobacter_phage(93.33%)	37	NA	NA
WP_001019739.1|3747298_3747844_-	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
WP_000433907.1|3747885_3748275_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
WP_000598554.1|3748342_3751768_-	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.2	0.0e+00
WP_000835160.1|3751760_3752123_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
WP_000368388.1|3752119_3752626_-	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
WP_000277448.1|3752625_3753024_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
WP_000721057.1|3753116_3753704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000046573.1|3753794_3758105_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
WP_001275792.1|3758232_3758496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000721572.1|3758497_3759178_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_000274931.1|3759282_3759741_-	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_000335868.1|3759749_3760049_-	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_001185585.1|3760551_3761067_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
WP_000094278.1|3761136_3762054_-	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
WP_000002408.1|3762106_3763285_-	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	66.3	1.2e-103
WP_000064593.1|3763284_3763638_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_000749909.1|3763734_3764256_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_001277696.1|3764364_3764583_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_001984404.1|3764584_3765028_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	94.6	2.0e-75
WP_000539749.1|3764984_3765353_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	2.0e-52
WP_000248411.1|3765324_3765735_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.3	7.7e-50
WP_000235282.1|3765786_3766080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000540685.1|3766087_3766285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000524257.1|3766353_3766722_-	hypothetical protein	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
WP_000008459.1|3766722_3767103_-	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
WP_000524488.1|3767106_3767442_-	hypothetical protein	NA	A0A0N7IRE4	Acinetobacter_phage	100.0	2.7e-53
WP_000852265.1|3767486_3768437_-	hypothetical protein	NA	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
WP_000056390.1|3768450_3769242_-	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
WP_000589038.1|3769328_3769643_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
WP_001291451.1|3769694_3769847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004550.1|3769862_3770093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000146970.1|3770089_3771196_-|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
WP_000301495.1|3771205_3772546_-	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
WP_001132930.1|3772585_3773878_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
WP_000729387.1|3773837_3774353_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
WP_000378523.1|3775020_3775455_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	84.7	7.4e-67
WP_001136773.1|3775515_3775971_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
>prophage 249
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3779928	3792276	4030371		Acinetobacter_phage(95.65%)	24	NA	NA
WP_001277128.1|3779928_3780405_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
WP_000100162.1|3780401_3780803_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.6e-66
WP_000462878.1|3780802_3781195_-	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	57.8	1.2e-07
WP_000647826.1|3781187_3781526_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
WP_001003671.1|3781522_3782323_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
WP_000064627.1|3782325_3783207_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
WP_000602535.1|3783199_3783424_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
WP_001180660.1|3783495_3783768_-	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.0	7.2e-36
WP_000048916.1|3783829_3784150_-	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
WP_000703023.1|3784160_3784349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052252.1|3784453_3785206_+	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
WP_000370485.1|3785220_3785436_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_000048052.1|3785487_3786495_+	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_001129676.1|3786496_3787000_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_000845537.1|3787138_3787342_+	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
WP_000051960.1|3787348_3787591_-	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
WP_001101038.1|3787784_3788228_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
WP_000656405.1|3788227_3788518_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
WP_000064463.1|3788510_3788834_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
WP_001207474.1|3788845_3789967_+	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.8e-211
WP_000698529.1|3789963_3790896_+	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
WP_000654846.1|3790897_3791149_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
WP_000147323.1|3791149_3791557_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_000004579.1|3791553_3792276_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
>prophage 250
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3803262	3805692	4030371		Moraxella_phage(100.0%)	1	NA	NA
WP_001292274.1|3803262_3805692_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	62.7	8.4e-277
>prophage 251
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3832528	3834142	4030371		Hokovirus(100.0%)	1	NA	NA
WP_000019502.1|3832528_3834142_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.2	2.6e-40
>prophage 252
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3838284	3839847	4030371	tRNA	Catovirus(100.0%)	1	NA	NA
WP_001128171.1|3838284_3839847_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	7.2e-88
>prophage 253
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3851932	3855250	4030371		Planktothrix_phage(50.0%)	4	NA	NA
WP_001136089.1|3851932_3852625_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	3.6e-31
WP_002075186.1|3852669_3853293_+	arylesterase	NA	NA	NA	NA	NA
WP_001987747.1|3853325_3853964_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_000197531.1|3854224_3855250_+	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	31.0	6.5e-05
>prophage 254
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3868999	3872686	4030371		Dickeya_phage(100.0%)	1	NA	NA
WP_000105333.1|3868999_3872686_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	60.0	3.3e-14
>prophage 255
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3883278	3892309	4030371		Synechococcus_phage(25.0%)	8	NA	NA
WP_000117812.1|3883278_3883761_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.7	3.7e-19
WP_000371873.1|3883995_3885294_+	MFS transporter	NA	NA	NA	NA	NA
WP_002000879.1|3885356_3886532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000140233.1|3886708_3888349_-	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.8	9.1e-25
WP_001040562.1|3888387_3889854_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000735778.1|3889867_3890659_-	aspartate dehydrogenase	NA	NA	NA	NA	NA
WP_000009973.1|3890674_3891469_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	8.6e-13
WP_000988614.1|3891484_3892309_-	alpha/beta hydrolase	NA	A0A249XPN5	Mycobacterium_phage	31.3	5.2e-13
>prophage 256
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3900255	3900837	4030371		Raoultella_phage(100.0%)	1	NA	NA
WP_000074692.1|3900255_3900837_-	nicotinamide mononucleotide transporter	NA	A0A2H4YHF9	Raoultella_phage	28.6	1.4e-07
>prophage 257
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3911639	3919554	4030371	holin	Vibrio_phage(66.67%)	5	NA	NA
WP_000179784.1|3911639_3913706_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.1	2.0e-16
WP_000243375.1|3913823_3915446_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.3	2.5e-19
WP_001985959.1|3915699_3916335_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001286307.1|3916327_3917800_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001021934.1|3917895_3919554_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.7e-56
>prophage 258
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3957557	3964444	4030371	integrase	Pseudomonas_phage(33.33%)	9	3952659:3952675	3968915:3968931
3952659:3952675	attL	TTCAGGGCTTTTTTATT	NA	NA	NA	NA
WP_001022397.1|3957557_3960023_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	27.6	1.7e-51
WP_001064707.1|3960035_3960314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787149.1|3960435_3960741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001046481.1|3960750_3961119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001988245.1|3961111_3961666_-	hypothetical protein	NA	A0A0R6PGW1	Moraxella_phage	52.0	1.4e-25
WP_001016479.1|3961662_3961872_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000153154.1|3961874_3962090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000578618.1|3962299_3963067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001991065.1|3963214_3964444_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAT5	uncultured_Caudovirales_phage	38.7	4.8e-71
3968915:3968931	attR	AATAAAAAAGCCCTGAA	NA	NA	NA	NA
>prophage 259
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	3969041	3998401	4030371		Acinetobacter_phage(40.0%)	25	NA	NA
WP_000766534.1|3969041_3969812_-	TIGR02594 family protein	NA	A0A0B5L5G5	Acinetobacter_phage	100.0	1.4e-153
WP_001279704.1|3969808_3970096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000894311.1|3970219_3970438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627459.1|3970430_3971129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114213684.1|3971128_3971923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000594623.1|3972010_3972259_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000067916.1|3972460_3973360_+	hypothetical protein	NA	G9L6D8	Escherichia_phage	48.9	1.1e-40
WP_000373973.1|3973518_3974232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000067934.1|3974447_3975527_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0U4JD08	Gordonia_phage	31.9	2.6e-36
WP_000951724.1|3975523_3976153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209667.1|3976303_3977755_-	hypothetical protein	NA	A0A222YY44	Escherichia_phage	43.1	3.8e-83
WP_002029048.1|3977754_3979707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000863709.1|3979780_3980434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000098517.1|3980433_3981969_-	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	26.2	3.6e-31
WP_000852568.1|3982127_3982322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000852828.1|3982349_3983120_-	hypothetical protein	NA	G4WT79	Acinetobacter_phage	80.0	3.8e-82
WP_000190165.1|3983119_3983518_-	hypothetical protein	NA	G4WT78	Acinetobacter_phage	68.9	3.9e-46
WP_001013752.1|3983518_3993874_-	DUF1983 domain-containing protein	NA	A0A126DKX0	Acinetobacter_phage	26.8	7.4e-80
WP_001167468.1|3993883_3994777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240941.1|3994776_3995226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001187723.1|3995225_3995870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119670.1|3995996_3996263_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	51.2	5.2e-15
WP_001015563.1|3996225_3996501_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000229653.1|3997046_3997298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000210194.1|3997504_3998401_+	hypothetical protein	NA	A5VW58	Enterobacteria_phage	46.2	4.3e-45
>prophage 260
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	4004778	4013023	4030371	tail,terminase	Escherichia_phage(50.0%)	10	NA	NA
WP_001272164.1|4004778_4005909_-	hypothetical protein	NA	A0A222YXT1	Escherichia_phage	32.0	1.1e-21
WP_001243268.1|4005910_4006189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000996674.1|4006203_4007742_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001162227.1|4007813_4009805_-|terminase	terminase	terminase	A0A077SK57	Escherichia_phage	54.9	3.6e-07
WP_000014220.1|4009824_4010337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130711.1|4010348_4010549_-	TraR/DksA C4-type zinc finger protein	NA	G3EN77	Psychrobacter_phage	42.4	2.2e-05
WP_001108875.1|4010541_4011345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000157185.1|4011347_4012253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237356.1|4012325_4012553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001183519.1|4012564_4013023_-	hypothetical protein	NA	A0A143FJ28	Bacillus_phage	38.5	1.8e-10
>prophage 261
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	4017650	4018550	4030371		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001259764.1|4017650_4018550_-	hypothetical protein	NA	A5VW58	Enterobacteria_phage	42.9	3.8e-41
>prophage 262
NZ_CP042931	Acinetobacter baumannii strain ABCR01 chromosome, complete genome	4030371	4028326	4030131	4030371		Acinetobacter_phage(50.0%)	2	NA	NA
WP_000994866.1|4028326_4029091_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	6.7e-63
WP_094078970.1|4029087_4030131_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
