The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP032490	Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 chromosome, complete genome	4837346	363395	408903	4837346	protease,integrase,lysis,coat,portal	Salmonella_phage(63.08%)	67	354165:354181	417482:417498
354165:354181	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
WP_001043675.1|363395_364448_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|364730_365834_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|365845_367096_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_000051898.1|367301_368465_-|integrase	site-specific integrase	integrase	A0A2H5BFK7	Salmonella_phage	100.0	6.3e-230
WP_153246670.1|368694_368835_-	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	91.3	5.2e-14
WP_001084858.1|368903_369431_-	DUF551 domain-containing protein	NA	E7C9P2	Salmonella_phage	100.0	1.8e-99
WP_000348980.1|369432_369624_-	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	100.0	2.1e-26
WP_000034216.1|369625_370465_-	hypothetical protein	NA	A0A088CC42	Shigella_phage	64.8	7.8e-65
WP_000812204.1|370461_371103_-	hypothetical protein	NA	E7C9P6	Salmonella_phage	100.0	1.7e-112
WP_001214777.1|371099_371270_-	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_001111291.1|371280_371574_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001253476.1|371620_371905_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_015995136.1|371904_372612_-	DNA single-strand annealing protein	NA	B8K1D9	Salmonella_phage	100.0	3.1e-139
WP_001749553.1|372741_372930_-	hypothetical protein	NA	B8K1E1	Salmonella_phage	100.0	1.6e-31
WP_015995137.1|372910_373063_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	B8K1E2	Salmonella_phage	100.0	3.2e-25
WP_022631111.1|373386_373671_-	hypothetical protein	NA	B8K1E3	Salmonella_phage	98.9	3.2e-47
WP_000213983.1|373707_373902_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_015995140.1|374715_375018_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	100.0	7.4e-50
WP_000786968.1|375381_375591_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	98.6	3.5e-30
WP_015995141.1|375631_376705_-	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	100.0	8.4e-205
WP_000885924.1|376843_377185_-	DUF3024 domain-containing protein	NA	E7C9Q9	Salmonella_phage	100.0	4.3e-62
WP_000712404.1|377251_377941_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	100.0	2.9e-126
WP_000182204.1|378051_378267_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_001103492.1|378377_378659_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_001125981.1|378693_378840_+	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000065659.1|378832_379732_+	hypothetical protein	NA	E7C9R4	Salmonella_phage	100.0	1.9e-157
WP_000131503.1|379721_381158_+	AAA family ATPase	NA	E7C9R5	Salmonella_phage	100.0	6.1e-275
WP_001227831.1|381234_381429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000440795.1|381428_381719_+	hypothetical protein	NA	E7C9R6	Salmonella_phage	100.0	2.2e-51
WP_000049339.1|381721_382018_+	hypothetical protein	NA	E7C9R7	Salmonella_phage	100.0	1.1e-48
WP_000811304.1|381974_382421_+	recombination protein NinB	NA	I6R0N7	Salmonella_phage	100.0	3.2e-81
WP_000113765.1|382557_382734_+	NinE family protein	NA	C6ZR57	Salmonella_phage	100.0	4.6e-28
WP_001532927.1|382736_383078_+	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000950941.1|383070_383247_+	protein ninF	NA	E7C9S2	Salmonella_phage	100.0	6.7e-27
WP_001107939.1|383239_383845_+	recombination protein NinG	NA	E7C9S3	Salmonella_phage	100.0	7.1e-100
WP_000036320.1|383841_384066_+	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_000149882.1|384062_384266_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000219133.1|384246_384426_+	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_001047566.1|384422_385196_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000286100.1|385626_385830_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_024136257.1|385807_386305_+	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_001687043.1|386301_386769_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_015995148.1|386981_387512_+	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	100.0	1.3e-94
WP_000808099.1|387734_387977_+	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_001140562.1|387980_388370_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_001687044.1|388369_388774_+	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_000729923.1|388777_389266_+	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_022630929.1|389243_390743_+	DNA packaging protein	NA	Q76H24	Enterobacteria_phage	99.8	8.2e-307
WP_022631113.1|390742_392920_+|portal	portal protein	portal	A0A075B8I1	Enterobacteria_phage	99.9	0.0e+00
WP_000433852.1|392933_393845_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196937.1|393844_395137_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000538670.1|395177_395738_+	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_022631114.1|395721_396222_+	Packaged DNA stabilization protein gp4	NA	I1TEJ0	Salmonella_phage	98.2	2.7e-89
WP_022631115.1|396181_397600_+	Packaged DNA stabilization protein gp10	NA	E7C9U1	Salmonella_phage	99.8	1.6e-275
WP_022631116.1|397603_398305_+	hypothetical protein	NA	B8K1I3	Salmonella_phage	98.7	1.8e-70
WP_000627695.1|398304_398760_+	DUF2824 family protein	NA	B8K1I4	Salmonella_phage	100.0	1.4e-87
WP_000964900.1|398762_399452_+	hypothetical protein	NA	E7C9U4	Salmonella_phage	100.0	4.3e-109
WP_000246971.1|399462_400767_+	DNA injection protein	NA	E7C9U5	Salmonella_phage	100.0	9.9e-224
WP_001262317.1|400766_402680_+	hypothetical protein	NA	E7C9U6	Salmonella_phage	100.0	0.0e+00
WP_000889769.1|402697_403027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000757527.1|403057_403423_+	hypothetical protein	NA	E7C9U7	Salmonella_phage	100.0	8.1e-67
WP_001085430.1|403436_403616_-	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000532175.1|403715_403967_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	100.0	1.4e-38
WP_000129928.1|404102_406106_+	endorhamnosidase	NA	E7C9U9	Salmonella_phage	100.0	0.0e+00
WP_000671497.1|406164_407622_-	hypothetical protein	NA	E7C9N7	Salmonella_phage	100.0	1.3e-240
WP_000703639.1|407611_408544_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|408540_408903_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
417482:417498	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 2
NZ_CP032490	Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 chromosome, complete genome	4837346	1016801	1025533	4837346	protease,transposase	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|1016801_1017920_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1017916_1019863_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1019992_1020214_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1020537_1020858_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1020888_1023165_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1023356_1023815_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|1024277_1025533_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NZ_CP032490	Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 chromosome, complete genome	4837346	1075596	1166513	4837346	tRNA,terminase,protease,tail,integrase,holin,lysis	Salmonella_phage(60.0%)	90	1078505:1078524	1142401:1142420
WP_001154025.1|1075596_1076400_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1076392_1077715_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1077695_1078400_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_022630856.1|1078399_1082866_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1078505:1078524	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1083210_1085052_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1085311_1085860_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1085887_1086535_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1086596_1087787_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1087971_1089063_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1089669_1091070_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1091270_1091732_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1092048_1093263_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1093507_1094944_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1095021_1096224_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020899445.1|1096418_1097711_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000065276.1|1097755_1098004_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1098044_1098284_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_014344386.1|1098326_1099484_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_020899444.1|1099446_1102647_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	78.8	0.0e+00
WP_023139985.1|1102773_1103124_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_000917559.1|1103172_1103304_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_000981510.1|1103600_1104035_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_001555460.1|1104140_1104368_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000426364.1|1104402_1104723_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_000062943.1|1104807_1105791_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000800012.1|1105793_1106543_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_020899441.1|1106553_1106901_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000065109.1|1106897_1107356_+	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_000850457.1|1107359_1107668_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000208142.1|1107671_1108316_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_001536080.1|1108315_1108573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|1108627_1109605_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_022630855.1|1109616_1110213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|1110804_1111038_+	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_000763780.1|1111147_1111369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929788.1|1111453_1112056_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_001096542.1|1112264_1112876_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000801757.1|1112872_1113013_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097242.1|1113009_1113699_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_001534733.1|1113893_1114019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1114154_1114604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1114964_1115651_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_077248428.1|1115926_1116256_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_000984584.1|1116239_1116692_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_024143045.1|1116709_1117156_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000867564.1|1117624_1118170_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_020899435.1|1119290_1119623_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000725267.1|1119722_1120220_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1120336_1120870_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1120959_1121655_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1121664_1122402_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001576012.1|1122299_1123004_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000178849.1|1126464_1126707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031247858.1|1126760_1129199_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000143167.1|1129198_1129780_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|1130255_1131224_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1131871_1132498_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_031603423.1|1132566_1132866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1132850_1133537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1133807_1133999_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1134425_1137038_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1137245_1138256_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1138421_1138964_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1138960_1140070_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1140168_1142277_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1142289_1144197_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1142401:1142420	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1144211_1145465_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1145469_1147110_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1147106_1147670_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1147925_1148093_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1148192_1148711_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1148779_1150540_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1150725_1151178_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1151249_1152302_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1152658_1153168_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1153384_1153990_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1153976_1156130_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1156148_1156595_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_022630854.1|1156718_1158773_+	DNA helicase IV	NA	A0A1P8CWU5	Bacillus_phage	23.8	1.1e-08
WP_000424187.1|1158808_1159267_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1159361_1160024_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1160194_1160611_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1160655_1160973_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1161030_1162242_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1162456_1163005_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1163030_1163810_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1163858_1164140_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1164136_1164466_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1164552_1165212_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1165832_1166513_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP032490	Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 chromosome, complete genome	4837346	1864553	1945431	4837346	transposase,plate,terminase,protease,tail,integrase,holin,head,portal,capsid,tRNA	Enterobacteria_phage(72.0%)	97	1856643:1856658	1940712:1940727
1856643:1856658	attL	CGCGTGAGCGCGATAT	NA	NA	NA	NA
WP_000173208.1|1864553_1865810_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000174484.1|1866123_1866747_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_000988246.1|1866743_1867595_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001518537.1|1867860_1868808_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
WP_001037181.1|1868932_1870618_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.3	3.9e-23
WP_000823878.1|1870662_1870941_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000365078.1|1871192_1871801_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505850.1|1871917_1873009_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000794388.1|1873167_1874433_-	DUF4427 domain-containing protein	NA	NA	NA	NA	NA
WP_001058312.1|1874927_1876046_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000070978.1|1876042_1877836_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_000147036.1|1877854_1878586_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000993803.1|1878582_1879179_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001262581.1|1879168_1879573_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000063377.1|1879569_1880418_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263610.1|1880492_1882037_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000888114.1|1882048_1883185_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270301.1|1883197_1883287_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001526439.1|1883681_1884956_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_000612821.1|1885169_1886882_+	alpha,alpha-trehalase	NA	NA	NA	NA	NA
WP_000511323.1|1886944_1887199_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_000017421.1|1887367_1888102_+	flagellar brake protein YcgR	NA	NA	NA	NA	NA
WP_000776974.1|1888115_1888727_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051601.1|1888897_1889812_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000338376.1|1889908_1891642_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197903.1|1891704_1892775_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266937.1|1892788_1894087_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_001240769.1|1894409_1895942_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234826.1|1895988_1896708_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406435.1|1896927_1898472_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943475.1|1898613_1899144_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000215756.1|1899275_1900082_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.5e-65
WP_001353016.1|1900026_1900224_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001519189.1|1900416_1900713_-	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
WP_000078916.1|1900847_1900988_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001383550.1|1901178_1901439_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001763778.1|1901481_1902582_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	99.7	6.0e-206
WP_000005430.1|1902739_1903924_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	3.4e-223
WP_000290450.1|1903923_1904436_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000651563.1|1904491_1904866_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	72.4	2.6e-36
WP_000333503.1|1904874_1905030_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_024144064.1|1905016_1907824_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.7	0.0e+00
WP_022631005.1|1907836_1908325_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	3.0e-85
WP_022631004.1|1908351_1908951_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	3.4e-86
WP_153260506.1|1908981_1909755_+|tail	phage tail protein	tail	A0A1C9II89	Salmonella_phage	61.7	7.2e-73
WP_022631136.1|1909757_1910291_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.3	5.7e-77
WP_010835343.1|1910295_1910913_-|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	83.6	5.3e-95
WP_153260500.1|1910882_1912655_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	49.6	1.1e-121
WP_000071724.1|1912651_1913260_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_001111954.1|1913252_1914149_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000213447.1|1914152_1914503_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271888.1|1914499_1915081_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	6.1e-101
WP_000356339.1|1915077_1915713_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_000920594.1|1915705_1916173_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_153260501.1|1916159_1916717_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.1	8.3e-63
WP_000072327.1|1916713_1917106_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|1917102_1917426_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|1917428_1917629_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063103.1|1917628_1918123_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632335.1|1918224_1919025_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	2.3e-130
WP_022631073.1|1919070_1920123_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.1	3.7e-197
WP_001262654.1|1920145_1920982_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	7.9e-150
WP_000613782.1|1921135_1922887_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087812.1|1922886_1923933_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_022631072.1|1924435_1924960_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	52.0	8.4e-33
WP_089602464.1|1924956_1925322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001163773.1|1925543_1925879_-	hypothetical protein	NA	A0A0A7NV51	Enterobacteria_phage	90.7	4.1e-49
WP_000211257.1|1925942_1926254_-	hypothetical protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	7.2e-48
WP_022631070.1|1926258_1927218_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	4.9e-180
WP_001701922.1|1927283_1930121_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.1	0.0e+00
WP_000564227.1|1930117_1930507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153260502.1|1930503_1931121_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104303.1|1931132_1931432_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	8.2e-41
WP_000153700.1|1931428_1931695_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985163.1|1931691_1931895_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	1.9e-25
WP_001092663.1|1931918_1932335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021654.1|1932427_1932541_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.6e-10
WP_000514277.1|1932537_1932780_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159462.1|1932791_1933070_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000813365.1|1933080_1933422_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.1e-55
WP_001001394.1|1933440_1933767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001242988.1|1933862_1934165_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_000974887.1|1934231_1935221_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	3.4e-99
WP_000018967.1|1935412_1935754_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001083582.1|1935825_1935999_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001519337.1|1936190_1936328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785857.1|1936679_1937141_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_024144067.1|1937218_1937878_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001525604.1|1937927_1938221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072527.1|1938346_1939054_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101047.1|1939077_1939890_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185666.1|1939893_1940160_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_001109130.1|1940281_1941409_-	ribonuclease D	NA	NA	NA	NA	NA
1940712:1940727	attR	ATATCGCGCTCACGCG	NA	NA	NA	NA
WP_000502119.1|1941543_1942002_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000758418.1|1942192_1943878_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
WP_000290594.1|1944082_1944664_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_001221014.1|1944735_1945431_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP032490	Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 chromosome, complete genome	4837346	1990448	1997257	4837346	tail,integrase	Salmonella_phage(33.33%)	11	1985311:1985333	1995026:1995048
1985311:1985333	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_031247788.1|1990448_1991330_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1991802_1991991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1992055_1992223_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1992479_1993013_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1993066_1993297_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1993486_1993981_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1994040_1994895_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1995268_1995622_-	YebY family protein	NA	NA	NA	NA	NA
1995026:1995048	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1995638_1996514_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1996514_1996889_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1997026_1997257_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 6
NZ_CP032490	Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 chromosome, complete genome	4837346	2101301	2111904	4837346		Morganella_phage(25.0%)	12	NA	NA
WP_001157322.1|2101301_2102732_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2102805_2103501_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2103592_2103892_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2104541_2105738_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2105998_2106187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2106197_2106410_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2106864_2108133_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2108135_2108555_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2108681_2108843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598920.1|2109323_2110121_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2110492_2110783_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2111430_2111904_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
>prophage 7
NZ_CP032490	Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 chromosome, complete genome	4837346	2197898	2208404	4837346		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2197898_2199212_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2199238_2200318_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2200322_2201096_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2201092_2202085_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2202090_2202642_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2202642_2203521_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2203568_2204468_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2204467_2205553_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2205929_2206823_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2207000_2208404_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 8
NZ_CP032490	Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 chromosome, complete genome	4837346	2276712	2285883	4837346	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_022631044.1|2276712_2278746_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2278986_2279445_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2279616_2280147_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2280203_2280671_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2280717_2281437_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2281433_2283119_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2283341_2284073_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2284132_2284240_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2284220_2284952_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2284935_2285883_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 9
NZ_CP032490	Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 chromosome, complete genome	4837346	2305290	2371679	4837346	holin,tail,lysis	Salmonella_phage(25.0%)	59	NA	NA
WP_000989296.1|2305290_2305986_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2306139_2307024_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2307200_2307920_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2307916_2308162_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2308366_2309608_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_000956095.1|2309601_2310837_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2310911_2311922_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2311937_2313458_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2313591_2314590_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2315088_2316111_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2316260_2317403_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2317417_2318086_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2318415_2319273_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2319261_2319651_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2319655_2321023_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2321239_2322127_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2322159_2323482_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2323525_2325517_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2325862_2327332_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2327521_2328385_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2328505_2329555_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2329633_2330491_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2330555_2332244_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2332260_2333199_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2333198_2334329_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2334697_2335879_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2335943_2336609_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2336610_2336733_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2337120_2337375_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2337698_2338271_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2338483_2339470_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2339499_2340219_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2340632_2341205_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2341530_2343087_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2343193_2344999_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2345008_2346103_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2346102_2347128_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2347129_2348719_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2348722_2349067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2349457_2350648_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2350675_2351371_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2351522_2353283_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2353407_2353692_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2353800_2354421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2354448_2355456_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2355635_2355863_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2355894_2357655_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2357935_2358439_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2358466_2358757_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000022213.1|2360980_2361424_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2361801_2362329_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2362331_2363573_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2364165_2364495_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2364791_2366123_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2366151_2366520_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2366534_2367524_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2367852_2370219_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2370387_2370591_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2370887_2371679_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 10
NZ_CP032490	Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 chromosome, complete genome	4837346	2740248	2830574	4837346	plate,terminase,tail,integrase,holin,head,portal,capsid,tRNA	Enterobacteria_phage(66.1%)	102	2758656:2758671	2823592:2823607
WP_001134566.1|2740248_2740800_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2740824_2741460_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2741463_2742825_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001048530.1|2742835_2743729_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2743844_2744693_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2744731_2745649_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2745670_2746867_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2746982_2747909_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2747946_2748207_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2748318_2748699_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2748698_2749430_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2749441_2750170_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2750181_2751087_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2751083_2751764_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2752037_2753012_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2753028_2754828_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000589087.1|2755079_2755559_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2755555_2756512_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2756511_2757162_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2757193_2757769_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2757765_2757930_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2758193_2759816_+	L-aspartate oxidase	NA	NA	NA	NA	NA
2758656:2758671	attL	CAGGTGCTGGAACGCA	NA	NA	NA	NA
WP_000083343.1|2759800_2760538_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2760668_2762003_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2762020_2762920_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2763022_2763610_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2763671_2764055_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2764373_2765063_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2765178_2766216_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|2766419_2766839_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183639.1|2766911_2767592_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082639.1|2767645_2770306_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2770420_2771776_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|2771820_2772144_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807809.1|2772140_2773442_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
WP_000985653.1|2773545_2774001_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_001235094.1|2779881_2782455_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_000992639.1|2782584_2783316_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2783312_2784293_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2784424_2785162_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2785433_2785772_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000215756.1|2785922_2786729_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.5e-65
WP_001353016.1|2786673_2786871_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000122998.1|2787063_2787252_-	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	68.9	8.2e-15
WP_153260503.1|2787248_2787359_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000078916.1|2787494_2787635_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001383550.1|2787825_2788086_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_001763778.1|2788128_2789229_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	99.7	6.0e-206
WP_000290450.1|2790568_2791081_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000651563.1|2791136_2791511_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	72.4	2.6e-36
WP_000333503.1|2791519_2791675_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_024144064.1|2791661_2794469_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.7	0.0e+00
WP_022631005.1|2794481_2794970_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.8	3.0e-85
WP_022631004.1|2794996_2795596_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.3	3.4e-86
WP_024144069.1|2795815_2796304_+	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	81.4	9.8e-68
WP_010835343.1|2796273_2796891_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	83.6	5.3e-95
WP_153260504.1|2797430_2798075_-|tail	phage tail protein	tail	A0A1C9II89	Salmonella_phage	61.7	1.9e-71
WP_000071724.1|2799294_2799903_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_001111954.1|2799895_2800792_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000213447.1|2800795_2801146_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001271888.1|2801142_2801724_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.9	6.1e-101
WP_000356339.1|2801720_2802356_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_000920594.1|2802348_2802816_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780549.1|2802953_2803361_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.8	4.6e-63
WP_000072327.1|2803357_2803750_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|2803746_2804070_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|2804072_2804273_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063103.1|2804272_2804767_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632335.1|2804868_2805669_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	2.3e-130
WP_022631073.1|2805714_2806767_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	99.1	3.7e-197
WP_001262654.1|2806789_2807626_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	7.9e-150
WP_000613782.1|2807780_2809532_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087812.1|2809531_2810578_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_022631072.1|2811081_2811606_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	52.0	8.4e-33
WP_022631071.1|2811602_2812127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001163773.1|2812190_2812526_-	hypothetical protein	NA	A0A0A7NV51	Enterobacteria_phage	90.7	4.1e-49
WP_000211257.1|2812589_2812901_-	hypothetical protein	NA	A0A0A7NPT5	Enterobacteria_phage	96.1	7.2e-48
WP_022631070.1|2812905_2813865_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	4.9e-180
WP_001701922.1|2813930_2816768_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.1	0.0e+00
WP_000564227.1|2816764_2817154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106940609.1|2817150_2817771_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	40.4	7.0e-10
WP_023140813.1|2817824_2818655_-	SPFH/Band 7/PHB domain protein	NA	A0A0A7NPW9	Enterobacteria_phage	99.6	3.3e-132
WP_001036813.1|2818651_2818855_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	98.5	8.3e-29
WP_000991530.1|2818866_2819166_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	87.9	1.5e-39
WP_000153674.1|2819162_2819408_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_000985161.1|2819404_2819608_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000021656.1|2819694_2819808_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000514277.1|2819804_2820047_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159462.1|2820058_2820337_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000813365.1|2820347_2820689_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.1e-55
WP_001001394.1|2820707_2821034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001242988.1|2821129_2821432_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_000974887.1|2821498_2822488_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	3.4e-99
WP_010989056.1|2822655_2822703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200080.1|2822802_2823963_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
2823592:2823607	attR	CAGGTGCTGGAACGCA	NA	NA	NA	NA
WP_000210995.1|2823923_2824832_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|2824889_2826011_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2826020_2827091_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2827530_2828049_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2828041_2829262_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2829418_2829766_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2829806_2830574_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP032490	Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 chromosome, complete genome	4837346	4397490	4417910	4837346	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4397490_4398219_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4398415_4398706_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4398954_4399410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4399406_4400012_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4400016_4401762_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4401764_4402397_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4402389_4403505_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4403495_4403855_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4404018_4405566_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4405565_4406495_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4406491_4406854_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4407181_4407904_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4407913_4408957_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4408944_4409154_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4409153_4410107_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_022630954.1|4410106_4412461_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	1.2e-65
WP_001185654.1|4412557_4412686_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4412645_4412963_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4413014_4413539_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4413538_4414966_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4414955_4415153_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4415149_4415605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4415764_4416079_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4416091_4416697_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4416699_4416987_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4417562_4417910_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP032492	Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_91, complete sequence	90686	0	89964	90686	protease,terminase,portal,plate,tRNA,holin,tail,integrase	Escherichia_phage(95.0%)	107	151:164	23829:23842
151:164	attL	TGTTAGAAATTTAA	NA	NA	NA	NA
WP_001292231.1|165_1194_-|integrase	tyrosine-type recombinase/integrase	integrase	Q5QBN6	Enterobacteria_phage	41.6	8.7e-58
WP_000888609.1|2387_2627_+	hypothetical protein	NA	Q5QBE5	Escherichia_phage	96.4	1.4e-06
WP_000897062.1|2654_4163_-|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	57.0	4.3e-162
WP_001096838.1|4162_5143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435256.1|5523_5916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130998.1|6024_6210_-	hypothetical protein	NA	Q5QBF3	Escherichia_phage	98.4	6.4e-28
WP_000488304.1|6416_6608_-	hypothetical protein	NA	A0A222YWJ0	Escherichia_phage	100.0	3.2e-30
WP_000579539.1|7641_7806_-	DUF3927 domain-containing protein	NA	A0A222YXW5	Escherichia_phage	100.0	1.8e-18
WP_000467090.1|7805_8240_-	tellurite resistance TerB family protein	NA	A0A222YXQ0	Escherichia_phage	100.0	3.7e-74
WP_000077921.1|10447_11656_-	hypothetical protein	NA	A0A222YW83	Escherichia_phage	99.0	2.9e-230
WP_046891376.1|11769_12051_-	hypothetical protein	NA	A0A222YW96	Escherichia_phage	98.9	6.9e-42
WP_099145002.1|12280_12658_-	VRR-NUC domain-containing protein	NA	A0A222YXP1	Escherichia_phage	99.2	1.1e-69
WP_001230915.1|12911_13172_-	hypothetical protein	NA	A0A222YXI8	Escherichia_phage	100.0	1.8e-44
WP_000209223.1|13174_13609_-	hypothetical protein	NA	A0A222YZ35	Escherichia_phage	100.0	2.9e-79
WP_022630892.1|13645_20482_-	helicase	NA	A0A222YYH3	Escherichia_phage	99.0	0.0e+00
WP_001273800.1|20633_21119_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	100.0	3.3e-92
WP_001548248.1|21150_21348_-	hypothetical protein	NA	A0A222YWF5	Escherichia_phage	96.9	7.0e-33
WP_000350312.1|21347_22055_-	DNA-binding protein	NA	A0A222YXY0	Escherichia_phage	99.1	1.3e-129
WP_000245715.1|22054_22279_-	host cell division inhibitor Icd-like protein	NA	A0A222YWB3	Escherichia_phage	100.0	8.8e-40
WP_022630891.1|22692_23655_-	hypothetical protein	NA	A0A222YXV1	Escherichia_phage	100.0	3.5e-178
WP_001557744.1|23855_24854_-	hypothetical protein	NA	A0A222YWA7	Escherichia_phage	100.0	1.4e-182
23829:23842	attR	TGTTAGAAATTTAA	NA	NA	NA	NA
WP_143553143.1|24867_26145_-|portal	phage portal protein	portal	A0A222YXQ7	Escherichia_phage	99.8	1.2e-245
WP_001244352.1|26634_26967_-	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	99.1	2.6e-56
WP_000094097.1|27011_27569_-	DUF4145 domain-containing protein	NA	A0A222YYQ2	Escherichia_phage	99.5	2.3e-97
WP_001043715.1|27694_29059_-	hypothetical protein	NA	A0A222YY44	Escherichia_phage	98.5	3.1e-244
WP_000156172.1|29153_29522_-	hypothetical protein	NA	A0A222YWB0	Escherichia_phage	84.7	4.0e-37
WP_058810370.1|29521_31483_-	hypothetical protein	NA	A0A222YWA3	Escherichia_phage	93.7	1.7e-307
WP_000066531.1|31475_32096_-	hypothetical protein	NA	A0A222YXB2	Escherichia_phage	99.0	8.3e-80
WP_000526264.1|32085_32532_-	hypothetical protein	NA	A0A222YXP5	Escherichia_phage	100.0	9.2e-81
WP_000457140.1|32531_32858_-|holin	holin	holin	A0A222YZ46	Escherichia_phage	100.0	3.3e-51
WP_000904917.1|32963_33524_+	recombinase family protein	NA	A0A222YWP5	Escherichia_phage	98.9	4.7e-98
WP_077941505.1|33508_34264_+|tail	phage tail protein	tail	A0A1C9II89	Salmonella_phage	61.7	7.0e-73
WP_022631029.1|34266_34800_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.9	8.7e-78
WP_153260507.1|35368_37465_-|tail	phage tail protein	tail	A0A222YWB9	Escherichia_phage	77.1	3.3e-205
WP_001396839.1|37467_37617_-	hypothetical protein	NA	A0A222YXS1	Escherichia_phage	98.0	7.9e-21
WP_000654652.1|38008_38854_-	hypothetical protein	NA	A0A222YWB7	Escherichia_phage	100.0	4.5e-161
WP_000156304.1|38864_40295_-|plate	baseplate protein	plate	A0A222YWB2	Escherichia_phage	99.4	2.0e-270
WP_001557703.1|40291_40666_-	hypothetical protein	NA	A0A222YXD0	Escherichia_phage	100.0	7.0e-66
WP_052896565.1|40671_44490_-	transglycosylase	NA	A0A222YXR4	Escherichia_phage	85.2	0.0e+00
WP_001557705.1|44504_45326_-	hypothetical protein	NA	A0A222YZ63	Escherichia_phage	99.6	3.5e-158
WP_001077897.1|45701_46457_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	100.0	3.7e-138
WP_000021878.1|46838_47546_-	hypothetical protein	NA	A0A222YY05	Escherichia_phage	100.0	1.0e-126
WP_000187859.1|47561_48113_-	hypothetical protein	NA	A0A222YWE3	Escherichia_phage	100.0	1.6e-98
WP_000012433.1|48167_48659_-	hypothetical protein	NA	A0A222YWE4	Escherichia_phage	100.0	3.5e-89
WP_001112722.1|48667_49240_-	hypothetical protein	NA	A0A222YY02	Escherichia_phage	100.0	6.0e-101
WP_000801017.1|49307_50042_-	hypothetical protein	NA	A0A222YXT7	Escherichia_phage	100.0	5.9e-125
WP_001033852.1|50085_51744_-|tail	tail sheath protein	tail	A0A222YWC8	Escherichia_phage	100.0	1.2e-311
WP_001396841.1|51811_52090_-	hypothetical protein	NA	A0A222YWH8	Escherichia_phage	100.0	3.1e-42
WP_001038834.1|52237_53935_-	hypothetical protein	NA	A0A222YWC7	Escherichia_phage	100.0	0.0e+00
WP_001427915.1|54180_54486_+	hypothetical protein	NA	A0A222YXX4	Escherichia_phage	99.0	3.4e-50
WP_000020025.1|54502_54961_+	hypothetical protein	NA	A0A222YWJ4	Escherichia_phage	100.0	2.1e-88
WP_032141600.1|55114_55573_-	hypothetical protein	NA	A0A222YWG1	Escherichia_phage	98.0	7.8e-67
WP_000887293.1|55643_56450_-	hypothetical protein	NA	A0A222YXK1	Escherichia_phage	100.0	7.7e-118
WP_001272819.1|56449_56734_-	alanine racemase	NA	A0A222YXW1	Escherichia_phage	81.9	4.0e-37
WP_153260508.1|57000_57957_+	recombinase	NA	A0A222YXF2	Escherichia_phage	99.4	4.9e-180
WP_000076908.1|57969_58308_+	plasmid stabilization protein	NA	A0A222YWJ6	Escherichia_phage	100.0	2.3e-52
WP_000585023.1|58595_59237_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	100.0	7.5e-116
WP_000595051.1|59229_59517_+	hypothetical protein	NA	A0A222YZA7	Escherichia_phage	100.0	8.1e-46
WP_001287145.1|59785_61447_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.8	0.0e+00
WP_000045489.1|61495_62401_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A222YYM0	Escherichia_phage	100.0	1.0e-174
WP_000812238.1|62393_63074_-	hypothetical protein	NA	A0A222YXN3	Escherichia_phage	100.0	5.8e-135
WP_001258018.1|63057_63963_-	recombination-associated protein RdgC	NA	A0A222YY21	Escherichia_phage	100.0	2.2e-166
WP_000828868.1|64022_64676_-	hypothetical protein	NA	A0A222YWF1	Escherichia_phage	100.0	1.9e-103
WP_000046500.1|64672_65653_-	hypothetical protein	NA	A0A222YXZ0	Escherichia_phage	100.0	2.5e-187
WP_000203295.1|65656_66424_-	hypothetical protein	NA	A0A222YWF4	Escherichia_phage	99.6	2.2e-138
WP_153260509.1|66420_67212_-|tail	phage tail protein	tail	A0A222YXU3	Escherichia_phage	97.0	4.5e-147
WP_000162415.1|67374_67677_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	100.0	5.9e-55
WP_000806445.1|67748_68087_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	100.0	1.3e-55
WP_044868318.1|68143_68503_+	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	100.0	1.6e-62
WP_044868320.1|68565_69294_+	hypothetical protein	NA	A0A222YY57	Escherichia_phage	100.0	3.0e-129
WP_153260510.1|69327_70521_-|tail	phage tail protein	tail	A0A222YXT1	Escherichia_phage	98.0	1.3e-201
WP_000542383.1|70513_70843_-	hypothetical protein	NA	A0A222YYR0	Escherichia_phage	100.0	3.6e-58
WP_001557715.1|71171_71825_-	hypothetical protein	NA	A0A222YZ79	Escherichia_phage	99.1	1.4e-114
WP_000776955.1|72107_72716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024133810.1|72901_73129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001050887.1|73216_73834_-	dCTP deaminase	NA	B6EFB7	Stygiolobus_rod-shaped_virus	36.3	3.1e-10
WP_000879262.1|73830_74904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000964983.1|74903_75209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001557717.1|75535_75823_-	hypothetical protein	NA	A0A222YY28	Escherichia_phage	83.0	9.3e-34
WP_084572533.1|75882_76824_-	Rha family transcriptional regulator	NA	A0A222YWG0	Escherichia_phage	97.4	4.0e-174
WP_000201265.1|76823_77039_-	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	100.0	2.3e-37
WP_071587538.1|77057_77177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077887023.1|77852_78431_-	recombinase	NA	A0A222YXV2	Escherichia_phage	96.4	1.1e-73
WP_153260511.1|78548_78704_+	hypothetical protein	NA	A0A222YXL5	Escherichia_phage	98.0	1.9e-17
WP_084572535.1|78703_79327_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	76.8	2.4e-82
WP_001369111.1|79356_79641_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	91.5	7.0e-42
WP_001557724.1|79630_79990_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	A0A222YZB4	Escherichia_phage	98.0	4.9e-48
WP_001557725.1|80081_80357_+	DUF4752 family protein	NA	A0A222YWQ2	Escherichia_phage	100.0	5.5e-44
WP_000139733.1|80353_80578_+	hypothetical protein	NA	A0A222YYR6	Escherichia_phage	100.0	9.1e-37
WP_001557726.1|80574_80886_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	100.0	4.8e-60
WP_153260512.1|80882_81575_+	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	97.8	2.7e-135
WP_046891371.1|81673_82669_+	DUF968 domain-containing protein	NA	A0A222YWL6	Escherichia_phage	100.0	1.9e-198
WP_046891370.1|82682_82982_+	hypothetical protein	NA	A0A222YY12	Escherichia_phage	100.0	1.3e-51
WP_000034256.1|82968_83616_+	ead/Ea22-like family protein	NA	A0A222YWN7	Escherichia_phage	100.0	2.9e-115
WP_001557730.1|83602_83794_+	hypothetical protein	NA	A0A222YWL3	Escherichia_phage	100.0	4.6e-29
WP_001557731.1|83795_84011_+	hypothetical protein	NA	A0A222YWK2	Escherichia_phage	100.0	1.3e-37
WP_001142594.1|84012_84468_+	DUF4014 domain-containing protein	NA	A0A222YXP4	Escherichia_phage	100.0	8.8e-79
WP_001344848.1|85799_86009_-	hypothetical protein	NA	A0A222YY00	Escherichia_phage	98.6	1.1e-31
WP_001443773.1|86182_86329_+	hypothetical protein	NA	A0A222YXH0	Escherichia_phage	100.0	1.7e-20
WP_022630896.1|86340_86730_+	DNA repair protein	NA	A0A222YZE2	Escherichia_phage	100.0	2.4e-69
WP_000098854.1|86864_87287_+	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	100.0	1.8e-70
WP_001190712.1|87395_87617_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216038.1|87616_87997_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	100.0	2.5e-63
WP_000113017.1|88001_88199_+	hypothetical protein	NA	A0A222YWI9	Escherichia_phage	100.0	2.9e-26
WP_022630895.1|88231_89008_-	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	99.6	1.6e-141
WP_001557736.1|89014_89455_-	DUF2829 domain-containing protein	NA	A0A222YXY1	Escherichia_phage	100.0	2.8e-82
WP_001557737.1|89469_89964_-	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	100.0	3.4e-92
