The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026013	Klebsiella variicola strain 13450 chromosome, complete genome	5511705	1185488	1192213	5511705		Enterobacteria_phage(100.0%)	9	NA	NA
WP_112293555.1|1185488_1187822_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.8	0.0e+00
WP_002889897.1|1187833_1188154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004177614.1|1188150_1188411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112293557.1|1188482_1188932_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	69.0	9.7e-46
WP_004177619.1|1188924_1189224_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	67.4	1.7e-25
WP_064180916.1|1189213_1189816_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.8	6.1e-43
WP_112293558.1|1190649_1191387_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	60.1	3.8e-71
WP_112293560.1|1191383_1191629_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	1.2e-18
WP_112293561.1|1191646_1192213_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	8.2e-58
>prophage 2
NZ_CP026013	Klebsiella variicola strain 13450 chromosome, complete genome	5511705	1543160	1582620	5511705	terminase,holin,head,protease,tail	Klebsiella_phage(33.33%)	49	NA	NA
WP_012967533.1|1543160_1543652_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_022064830.1|1543804_1544914_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_022064831.1|1545664_1546573_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022064832.1|1546932_1547595_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_022064833.1|1547919_1548555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022065440.1|1548951_1550217_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_022065441.1|1550273_1550669_+	RidA family protein	NA	NA	NA	NA	NA
WP_022065442.1|1550708_1551641_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_022065443.1|1551637_1552549_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022065444.1|1552645_1553785_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_008803987.1|1554218_1554407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004102265.1|1554477_1554687_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_022065445.1|1555020_1555761_+	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.1	1.5e-14
WP_022065446.1|1555769_1556468_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016161566.1|1556477_1557230_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_022065447.1|1557219_1558062_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008803992.1|1558066_1558606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022065448.1|1558800_1559589_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_064147087.1|1560181_1560997_+	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	41.3	1.5e-49
WP_108443346.1|1561095_1562274_-	recombinase	NA	A0A2D1GN00	Marinobacter_phage	29.8	2.7e-31
WP_112293576.1|1562272_1562470_+	hypothetical protein	NA	Q8SBE4	Shigella_phage	63.5	2.3e-12
WP_112293577.1|1562709_1563267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112293579.1|1563294_1563663_+	serine/threonine protein kinase	NA	A0A2H4FSA1	Methylophilaceae_phage	30.5	2.3e-05
WP_112293580.1|1564044_1565094_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	76.8	1.6e-168
WP_142669431.1|1565447_1565888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110226810.1|1565884_1567174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032421481.1|1568257_1568653_+	membrane protein	NA	G8C7V8	Escherichia_phage	72.3	5.5e-45
WP_004899663.1|1568639_1568921_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	72.0	2.9e-32
WP_086624281.1|1568920_1569550_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	74.4	2.7e-86
WP_060598773.1|1569552_1569828_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	50.6	4.1e-15
WP_072198218.1|1569778_1569976_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	91.2	2.3e-23
WP_004886681.1|1570064_1570406_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_017880217.1|1570548_1570794_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	54.3	1.8e-14
WP_110226811.1|1570871_1571411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112293761.1|1571869_1573327_+	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	87.4	2.8e-259
WP_112293582.1|1573488_1574076_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	66.5	4.5e-75
WP_048290404.1|1574068_1574437_+	HNH endonuclease	NA	S4TTG9	Salmonella_phage	79.8	1.8e-50
WP_065954149.1|1574616_1575126_+|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	67.5	6.0e-52
WP_049009922.1|1575885_1576212_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	60.2	1.1e-27
WP_032701061.1|1576283_1576496_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	60.0	1.5e-09
WP_008806068.1|1576497_1576848_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	62.9	3.9e-34
WP_008806069.1|1576840_1577326_+	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	65.2	1.5e-52
WP_049009917.1|1577322_1577685_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	77.7	3.7e-48
WP_023343204.1|1577749_1578232_+	hypothetical protein	NA	Q9MCU9	Escherichia_phage	58.9	7.5e-52
WP_112293584.1|1578411_1578942_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	89.7	7.3e-85
WP_023343206.1|1578988_1579372_+	hypothetical protein	NA	A0A286S1N4	Klebsiella_phage	86.3	4.1e-53
WP_112293585.1|1579374_1579638_+|tail	phage tail protein	tail	A0A286S1P2	Klebsiella_phage	89.7	7.9e-40
WP_042346245.1|1579701_1580094_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	42.2	3.6e-20
WP_112293587.1|1580163_1582620_+	DUF1833 domain-containing protein	NA	A0A286S1S3	Klebsiella_phage	87.9	0.0e+00
>prophage 3
NZ_CP026013	Klebsiella variicola strain 13450 chromosome, complete genome	5511705	1674390	1742431	5511705	terminase,holin,capsid,lysis,head,integrase,plate,tail,tRNA,portal	Escherichia_phage(40.48%)	66	1705874:1705897	1738360:1738383
WP_064141735.1|1674390_1676424_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	24.4	7.8e-26
WP_008804054.1|1676577_1677687_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_022064805.1|1677683_1678145_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002912749.1|1678119_1678437_-	nickel/cobalt homeostasis protein RcnB	NA	NA	NA	NA	NA
WP_008804056.1|1678620_1679520_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180600.1|1679509_1680853_-	NCS2 family permease	NA	NA	NA	NA	NA
WP_022064804.1|1680855_1682667_-	adenine deaminase	NA	NA	NA	NA	NA
WP_008804059.1|1682790_1683714_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_112293598.1|1683796_1685773_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.1	4.4e-159
WP_008804061.1|1685976_1686612_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_022064803.1|1686679_1688656_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.0	1.1e-160
WP_012967567.1|1689018_1689792_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_008804064.1|1689788_1690589_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_004201578.1|1690736_1691789_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_008804065.1|1691870_1692812_-	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_022065385.1|1693018_1694386_+	mannitol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_022065384.1|1694395_1695859_+	xylulokinase	NA	NA	NA	NA	NA
WP_008804068.1|1695929_1697207_+	MFS transporter	NA	NA	NA	NA	NA
WP_022065383.1|1697255_1697918_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_112293600.1|1698215_1699370_+	enolase	NA	NA	NA	NA	NA
WP_022065382.1|1699489_1701112_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012541059.1|1701108_1702146_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002912641.1|1702142_1703048_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_022065381.1|1703019_1703883_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.9	6.9e-08
WP_012967575.1|1703893_1704667_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.0e-26
WP_012541062.1|1704906_1705800_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	3.6e-15
1705874:1705897	attL	CAAAAAAATAAGCCCGCGTAAGGG	NA	NA	NA	NA
WP_004175149.1|1705981_1706995_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	82.8	8.1e-165
WP_016831471.1|1707109_1707409_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	69.7	5.7e-34
WP_016831472.1|1707531_1707807_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	85.7	4.0e-42
WP_023323010.1|1707973_1708474_+	hypothetical protein	NA	M1SV55	Escherichia_phage	85.5	1.4e-80
WP_064141732.1|1708538_1708754_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_110247741.1|1708770_1709046_+	hypothetical protein	NA	S4TP00	Salmonella_phage	62.8	7.5e-25
WP_112293601.1|1709035_1711339_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	73.7	0.0e+00
WP_072061035.1|1711412_1712660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096833700.1|1712646_1714461_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_112293603.1|1714795_1715839_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	81.8	7.5e-166
WP_112293604.1|1715838_1717608_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.9	8.2e-306
WP_112293606.1|1717773_1718628_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	80.3	9.6e-127
WP_112293607.1|1718701_1719760_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.0	1.3e-162
WP_112293609.1|1719763_1720507_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	79.5	4.3e-99
WP_064141724.1|1720603_1721110_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	82.8	2.7e-60
WP_064141723.1|1721109_1721313_+|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	80.6	5.5e-25
WP_049157366.1|1721317_1721608_+|holin	holin	holin	O80308	Escherichia_phage	83.7	2.0e-36
WP_064141722.1|1721594_1722092_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	85.8	7.4e-79
WP_112293610.1|1722088_1722520_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.2	2.1e-42
WP_064141720.1|1722615_1723083_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	2.4e-63
WP_112293612.1|1723075_1723531_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	5.2e-47
WP_112293613.1|1723532_1725062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064141717.1|1725150_1725792_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	76.5	1.8e-90
WP_064141716.1|1725788_1726136_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	75.7	1.2e-43
WP_112293615.1|1726140_1727049_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.5	4.9e-113
WP_064141714.1|1727041_1727650_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	53.6	3.8e-53
WP_112293616.1|1727646_1729692_+	SGNH/GDSL hydrolase family protein	NA	A0A159B7I7	Klebsiella_phage	56.9	2.0e-194
WP_064141712.1|1729701_1730457_+	hypothetical protein	NA	A0A159B7L2	Klebsiella_phage	75.3	6.7e-108
WP_112293618.1|1730499_1731570_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	44.7	5.2e-29
WP_112293619.1|1731679_1732861_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.9	2.7e-196
WP_064141809.1|1732874_1733390_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	76.7	8.5e-70
WP_112293621.1|1733449_1733725_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	76.1	9.2e-31
WP_014838982.1|1733757_1733877_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	89.7	2.6e-14
WP_112293623.1|1733869_1736308_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	75.1	2.7e-307
WP_064141807.1|1736319_1736799_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.1	2.0e-65
WP_064141806.1|1736798_1737956_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	78.4	1.5e-170
WP_016831480.1|1738040_1738262_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.6	2.9e-27
WP_008804076.1|1738531_1739893_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.0e-207
1738360:1738383	attR	CAAAAAAATAAGCCCGCGTAAGGG	NA	NA	NA	NA
WP_004201558.1|1740209_1740932_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_008804077.1|1740928_1742431_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.6e-30
>prophage 4
NZ_CP026013	Klebsiella variicola strain 13450 chromosome, complete genome	5511705	2823898	2834778	5511705		Escherichia_phage(87.5%)	9	NA	NA
WP_080883038.1|2823898_2827006_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
WP_008804978.1|2827060_2828326_+	MFS transporter	NA	NA	NA	NA	NA
WP_112293660.1|2828354_2829443_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	98.3	1.1e-207
WP_008804980.1|2829529_2829790_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	95.3	3.0e-39
WP_112293662.1|2830084_2830945_+	SHV family class A beta-lactamase	NA	A0A077SL40	Escherichia_phage	96.2	3.3e-151
WP_002210513.1|2830962_2831724_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_014839981.1|2831985_2832888_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	4.5e-159
WP_032419518.1|2832899_2834165_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.0	1.9e-232
WP_112293663.1|2834157_2834778_+	aldolase	NA	A0A077SK32	Escherichia_phage	99.0	1.2e-113
>prophage 5
NZ_CP026013	Klebsiella variicola strain 13450 chromosome, complete genome	5511705	3333740	3415909	5511705	terminase,holin,transposase,capsid,lysis,head,protease,integrase,tail,portal	Klebsiella_phage(22.22%)	100	3396424:3396439	3422310:3422325
WP_047666393.1|3333740_3334799_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.2	9.4e-15
WP_047666392.1|3335221_3336646_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	49.2	4.1e-98
WP_112293682.1|3336707_3345407_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	83.9	1.6e-03
WP_014907815.1|3345484_3346405_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3346441_3347701_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|3347700_3347880_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_064277429.1|3349271_3350147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112293766.1|3350187_3350778_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	73.4	1.2e-72
WP_112293683.1|3350844_3352506_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	96.9	0.0e+00
WP_040211070.1|3352489_3352846_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	97.4	1.6e-59
WP_044245563.1|3353121_3353565_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	63.3	4.9e-50
WP_016160668.1|3353564_3353858_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	82.5	4.2e-42
WP_040177084.1|3353850_3354189_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	46.8	1.3e-21
WP_004174256.1|3354185_3355421_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	95.9	1.0e-233
WP_044245572.1|3355422_3355983_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	96.8	1.9e-99
WP_071583198.1|3356033_3357200_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	91.5	3.7e-198
WP_112293685.1|3357441_3358209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112293768.1|3358212_3358722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112293686.1|3358756_3359017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112293688.1|3359231_3360596_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	91.2	1.4e-244
WP_112293689.1|3360592_3360961_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	92.6	9.1e-58
WP_112293691.1|3360957_3361212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112293693.1|3361204_3361483_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_112293694.1|3361616_3361811_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_112293696.1|3361837_3362659_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_112293769.1|3362895_3363126_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_112293698.1|3363185_3363404_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_112293771.1|3363396_3364632_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	45.9	1.5e-104
WP_112293699.1|3365441_3365876_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_023289184.1|3366123_3366555_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.0	1.1e-41
WP_023297386.1|3366551_3366875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3366826_3367189_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_023289182.1|3367515_3367740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3367778_3368216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3369165_3369516_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|3369512_3370010_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160648.1|3370009_3370225_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_001352368.1|3370544_3371753_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_139042930.1|3372480_3372600_+	small membrane protein	NA	NA	NA	NA	NA
WP_004147997.1|3373368_3373572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032432828.1|3373815_3374418_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.1	4.2e-76
WP_064149226.1|3374434_3375466_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.3	2.4e-95
WP_016528965.1|3375665_3376058_-	LexA DNA binding domain-containing protein	NA	K7PHB4	Enterobacterial_phage	35.6	6.8e-11
WP_112293701.1|3376098_3376389_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	60.9	1.0e-16
WP_012542186.1|3376400_3376634_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	1.7e-25
WP_047670012.1|3377037_3378282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032444803.1|3378998_3379481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016528969.1|3379725_3380166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072420414.1|3380179_3380644_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	3.1e-63
WP_077271747.1|3380636_3381641_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	45.3	8.6e-34
WP_046622349.1|3381700_3382255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|3382257_3382482_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077257742.1|3382570_3383008_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_040234937.1|3383329_3383644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074399016.1|3384033_3384228_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3384270_3384615_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_112293702.1|3387726_3388107_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	92.1	2.9e-67
WP_023304945.1|3388117_3388600_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	97.5	3.3e-84
WP_071599323.1|3388586_3389060_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	61.5	7.8e-54
WP_085318978.1|3389059_3391756_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.7	5.8e-202
WP_032420719.1|3391736_3392054_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_020804327.1|3392074_3392470_-|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	28.4	3.7e-09
WP_023304948.1|3392512_3392995_-	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
WP_020804325.1|3393002_3393401_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_020804335.1|3393397_3393949_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.9	9.1e-54
WP_020317349.1|3393938_3394232_-	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_020804328.1|3394224_3394551_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	65.4	4.0e-33
WP_112293703.1|3394631_3395987_-	hypothetical protein	NA	K7PKX4	Enterobacterial_phage	60.1	5.0e-202
WP_112293704.1|3395931_3397431_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.2	9.5e-247
3396424:3396439	attL	AGCACCGGCAGCGACA	NA	NA	NA	NA
WP_014228569.1|3397427_3397643_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	7.7e-25
WP_049095303.1|3397639_3399748_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.6	0.0e+00
WP_014228567.1|3399747_3400239_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
WP_071785246.1|3400559_3400745_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	1.9e-11
WP_107334310.1|3400811_3401072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112293706.1|3401297_3401543_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	97.5	3.2e-35
WP_004886681.1|3401685_3402027_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_112293707.1|3402115_3402310_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	86.0	6.7e-20
WP_112293709.1|3402263_3402536_-	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	69.2	5.0e-05
WP_004886674.1|3402532_3402880_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	1.5e-38
WP_112293710.1|3402876_3403416_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	3.3e-101
WP_112293712.1|3403418_3403766_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	72.0	3.0e-39
WP_108978910.1|3404020_3404500_+	hypothetical protein	NA	F1C594	Cronobacter_phage	56.8	1.3e-40
WP_024623190.1|3404582_3405161_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.1	9.3e-49
WP_112293713.1|3405174_3406155_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	1.9e-134
WP_023317574.1|3406167_3406545_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	75.2	6.7e-48
WP_112293715.1|3406554_3407364_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.5	6.5e-109
WP_112293716.1|3407360_3408275_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.4e-30
WP_112293718.1|3408231_3408444_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	1.1e-15
WP_000230161.1|3408681_3409143_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	3.8e-69
WP_001191665.1|3409177_3409420_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_112293719.1|3409517_3410213_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	2.1e-87
WP_112293721.1|3410575_3410875_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	3.6e-12
WP_104457818.1|3410874_3411660_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	3.8e-61
WP_040164855.1|3411787_3412132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048332717.1|3412124_3412607_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	81.3	1.4e-71
WP_040164850.1|3412603_3412879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071592590.1|3412875_3413148_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	47.1	1.7e-13
WP_000089156.1|3413177_3413414_+	excisionase	NA	NA	NA	NA	NA
WP_040164848.1|3413403_3414546_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	81.6	4.5e-172
WP_008806032.1|3414658_3415909_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
3422310:3422325	attR	TGTCGCTGCCGGTGCT	NA	NA	NA	NA
>prophage 6
NZ_CP026013	Klebsiella variicola strain 13450 chromosome, complete genome	5511705	3662135	3671582	5511705	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_022065908.1|3662135_3663857_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.8	1.5e-14
WP_008805841.1|3663896_3664601_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3664951_3665170_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012542332.1|3665288_3667568_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	3.7e-165
WP_002896520.1|3667598_3667916_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3668241_3668463_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_008805839.1|3668529_3670470_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	2.9e-38
WP_008805838.1|3670466_3671582_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP026014	Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence	344479	26642	59994	344479	integrase,transposase	Escherichia_phage(38.46%)	32	32847:32860	52251:52264
WP_004220208.1|26642_27722_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_014839920.1|29433_30708_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.8	2.2e-143
WP_052626781.1|30716_31073_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.7	5.0e-21
WP_014839921.1|31626_33420_-	AAA family ATPase	NA	NA	NA	NA	NA
32847:32860	attL	TCTCTTCTTCTGTT	NA	NA	NA	NA
WP_014839922.1|33929_34997_-	SAVED domain-containing protein	NA	NA	NA	NA	NA
WP_042934513.1|35005_35476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934515.1|35468_37202_-	thiamine biosynthesis protein ThiF	NA	NA	NA	NA	NA
WP_014839923.1|37198_38242_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_014839924.1|38380_38956_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_001067855.1|39103_39808_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000792636.1|39900_40434_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_014839925.1|40606_40921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|41175_41532_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|41521_41923_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|41919_42210_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000427623.1|42653_43658_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_014839926.1|43778_44738_-	cation transporter	NA	A0A1V0SED0	Indivirus	25.3	4.5e-08
WP_011638900.1|44757_45324_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	64.6	2.2e-58
WP_001067855.1|45428_46133_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001752509.1|46459_46960_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_016947617.1|47276_48257_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_000780222.1|48534_48816_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|48796_49126_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_001067858.1|50168_50873_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_004896925.1|51757_52300_+	hypothetical protein	NA	NA	NA	NA	NA
52251:52264	attR	AACAGAAGAAGAGA	NA	NA	NA	NA
WP_000155092.1|52658_53543_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|53598_55074_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_002001451.1|55471_56656_-|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_002026779.1|56704_56890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077252464.1|57109_57391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359986.1|57371_58145_-	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_000050481.1|58452_59994_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP026014	Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence	344479	66187	89185	344479	integrase,transposase	Salmonella_phage(50.0%)	20	81541:81554	90300:90313
WP_001143760.1|66187_69193_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001749986.1|69496_69949_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_032488579.1|70045_70600_-	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_000845048.1|70891_71905_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001162012.1|72210_72768_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_048336622.1|72770_75740_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_000427614.1|75818_76823_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_014839931.1|77151_77493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900953.1|78080_78686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839932.1|79257_80142_+	hypothetical protein	NA	A0A1B0VDL5	Salmonella_phage	41.1	9.8e-50
WP_017900676.1|81038_82100_-	hypothetical protein	NA	NA	NA	NA	NA
81541:81554	attL	AAAAGTAACTTTTC	NA	NA	NA	NA
WP_017900677.1|82186_82441_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_014839933.1|82614_83748_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_024266348.1|83808_84126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024266349.1|84161_85220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839934.1|85223_85547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839935.1|85546_86302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839936.1|86298_87258_-	DNA replication protein	NA	NA	NA	NA	NA
WP_017901130.1|87716_88160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042934531.1|88261_89185_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	2.5e-173
90300:90313	attR	AAAAGTAACTTTTC	NA	NA	NA	NA
>prophage 3
NZ_CP026014	Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence	344479	189368	203091	344479		Salmonella_phage(53.85%)	21	NA	NA
WP_014839967.1|189368_189689_+	hypothetical protein	NA	J9Q750	Salmonella_phage	53.8	8.2e-31
WP_014839968.1|190370_190574_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	64.2	2.8e-16
WP_025999286.1|190616_191228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839969.1|191292_191538_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	65.8	6.1e-18
WP_062878103.1|191684_191873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900706.1|191865_192600_+	hypothetical protein	NA	A0A1V0E5L5	Salmonella_phage	36.3	9.4e-14
WP_014839970.1|192865_193090_+	hypothetical protein	NA	B1GS76	Salmonella_phage	51.2	2.3e-08
WP_017900705.1|193093_194167_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.8	1.1e-18
WP_017900703.1|194583_194991_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	56.1	3.5e-18
WP_017900702.1|194987_195272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839971.1|195761_195974_+	hypothetical protein	NA	J9Q804	Salmonella_phage	50.0	3.0e-13
WP_017900701.1|196230_196863_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	55.9	1.5e-28
WP_017900700.1|196902_197424_+	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	68.5	5.4e-64
WP_009654227.1|197516_197804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654204.1|198056_198377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900698.1|198466_198901_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	28.3	4.3e-06
WP_017900697.1|198986_199619_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	41.2	8.3e-27
WP_025999285.1|199900_200245_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_017900695.1|200241_200487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099501131.1|200560_200950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017900693.1|201849_203091_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	29.4	8.7e-12
>prophage 4
NZ_CP026014	Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence	344479	212037	233146	344479	integrase,transposase	Escherichia_phage(87.5%)	12	207335:207349	236374:236388
207335:207349	attL	CTGGGAACACATCAA	NA	NA	NA	NA
WP_032447056.1|212037_214248_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001067855.1|216925_217630_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|220942_221647_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839978.1|222146_222935_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014839979.1|222934_223453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|223457_223874_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|224259_224964_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839981.1|226597_227500_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	4.5e-159
WP_002210513.1|227761_228523_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|228543_229404_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|229540_230245_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|232141_233146_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
236374:236388	attR	CTGGGAACACATCAA	NA	NA	NA	NA
>prophage 5
NZ_CP026014	Klebsiella variicola strain 13450 plasmid p13450-1, complete sequence	344479	237853	288802	344479	integrase,transposase	uncultured_Caudovirales_phage(29.17%)	44	245943:246002	276033:276854
WP_001553819.1|237853_240751_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_001493762.1|241591_242164_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|242300_242891_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_014839983.1|243325_243940_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	47.4	8.1e-35
WP_001516695.1|244258_244915_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
245943:246002	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|245994_246699_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012477889.1|247549_247846_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_011191340.1|248500_248749_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_003159185.1|248877_249444_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	54.3	7.9e-45
WP_000845039.1|249791_250805_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015060105.1|250957_251698_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_048336621.1|251787_253137_-	group II intron reverse transcriptase/maturase	NA	H7BV81	unidentified_phage	28.3	3.3e-12
WP_000679427.1|253809_254157_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|254150_254990_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|255394_256936_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000359986.1|257243_258017_+	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_077252464.1|257997_258279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002026779.1|258498_258684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002001451.1|258732_259917_+|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_000052512.1|260315_261791_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|261846_262731_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_004896925.1|263089_263632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|264516_265221_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_004118538.1|265797_266130_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011977829.1|266483_267632_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_004118534.1|267906_268281_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_001549953.1|268809_270006_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118529.1|270077_270905_-	universal stress protein	NA	NA	NA	NA	NA
WP_001549885.1|270923_272402_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_001549886.1|272885_273239_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549887.1|273334_274618_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549888.1|274667_275096_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_004118521.1|275153_275876_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.5e-96
WP_001067855.1|276084_276789_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001239317.1|276868_277369_+	hypothetical protein	NA	NA	NA	NA	NA
276033:276854	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCT	NA	NA	NA	NA
WP_001011939.1|277518_278160_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_008126957.1|278966_281951_+|transposase	Tn3-like element ISKox2 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.7	8.8e-34
WP_001330846.1|282736_282982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|282987_283179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|283660_284203_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|284215_285076_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001339197.1|285218_286427_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001352368.1|286556_287765_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001389365.1|288037_288802_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 1
NZ_CP026016	Klebsiella variicola strain 13450 plasmid p13450-2, complete sequence	109205	88710	99460	109205	transposase	Escherichia_phage(37.5%)	11	NA	NA
WP_137963431.1|88710_89358_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.5	2.2e-35
WP_153242794.1|89372_89597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012539983.1|90665_91421_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	1.7e-135
WP_015632469.1|92186_93392_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	4.0e-163
WP_137963433.1|93388_94366_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	55.3	1.1e-86
WP_153242796.1|94447_95719_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.2	1.3e-148
WP_020805749.1|95718_96150_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_072198233.1|96383_97355_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	8.2e-74
WP_060598826.1|97357_98029_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_048993627.1|98092_98323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137963434.1|98758_99460_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	4.6e-26
>prophage 1
NZ_CP026015	Klebsiella variicola strain 13450 plasmid p13450-3, complete sequence	56044	0	7100	56044	transposase	Escherichia_phage(50.0%)	7	NA	NA
WP_002904004.1|164_1025_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|1045_1807_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_001067855.1|2647_3352_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001549892.1|3744_3984_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_000343760.1|4085_5306_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001549893.1|5394_6057_-	hypothetical protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_000516402.1|6437_7100_+	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
>prophage 2
NZ_CP026015	Klebsiella variicola strain 13450 plasmid p13450-3, complete sequence	56044	11700	12216	56044		Tupanvirus(100.0%)	1	NA	NA
WP_001025390.1|11700_12216_+	DnaJ domain-containing protein	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
>prophage 3
NZ_CP026015	Klebsiella variicola strain 13450 plasmid p13450-3, complete sequence	56044	30847	36225	56044	transposase	Moraxella_phage(25.0%)	4	NA	NA
WP_001215543.1|30847_31342_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	8.0e-17
WP_000517490.1|31424_32687_+	ATP-binding protein	NA	A0A1V0SKF8	Klosneuvirus	31.4	1.3e-07
WP_004199098.1|32690_35018_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
WP_089518920.1|35078_36225_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	7.8e-148
>prophage 4
NZ_CP026015	Klebsiella variicola strain 13450 plasmid p13450-3, complete sequence	56044	45546	46563	56044	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001310555.1|45546_46563_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
>prophage 5
NZ_CP026015	Klebsiella variicola strain 13450 plasmid p13450-3, complete sequence	56044	51147	53134	56044		uncultured_virus(100.0%)	2	NA	NA
WP_004201172.1|51147_51438_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|51493_53134_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
