The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045611	Enterobacter hormaechei strain AUH-ENM30 chromosome	4869611	65695	73290	4869611	integrase	Enterobacteria_phage(30.0%)	10	55149:55163	80861:80875
55149:55163	attL	ACAGGATTACGCCGT	NA	NA	NA	NA
WP_022650433.1|65695_66157_+	VUT family protein	NA	A0A2H4N7D9	Pectobacterium_phage	55.7	4.1e-39
WP_022650432.1|66156_66957_+	hypothetical protein	NA	K7P7Q8	Enterobacteria_phage	85.0	6.6e-138
WP_003863184.1|66965_67166_+	hypothetical protein	NA	G8C7S1	Escherichia_phage	71.2	1.1e-20
WP_032628143.1|67174_67723_+	hypothetical protein	NA	E5AGD3	Erwinia_phage	35.0	2.3e-20
WP_003863189.1|67759_67969_+	hypothetical protein	NA	A0A220IH74	Escherichia_phage	59.3	2.1e-11
WP_003863191.1|67971_68322_+	helix-turn-helix domain-containing protein	NA	Q5G8V4	Enterobacteria_phage	95.7	1.5e-57
WP_058647473.1|68198_69362_+|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	95.3	7.7e-220
WP_003863195.1|69563_70817_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	2.3e-97
WP_003863197.1|70828_71932_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.7e-59
WP_003863199.1|72237_73290_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.6e-118
80861:80875	attR	ACAGGATTACGCCGT	NA	NA	NA	NA
>prophage 2
NZ_CP045611	Enterobacter hormaechei strain AUH-ENM30 chromosome	4869611	1011006	1051267	4869611	integrase,tRNA,transposase	Virus_Rctr41k(25.0%)	40	1009159:1009175	1053868:1053884
1009159:1009175	attL	GGCATTGCGCAGGTTTG	NA	NA	NA	NA
WP_003861139.1|1011006_1012371_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_000868608.1|1012567_1013725_+|integrase	site-specific integrase	integrase	A7J266	Streptococcus_phage	24.1	2.2e-09
WP_032471379.1|1013755_1014025_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000802152.1|1014444_1015398_-	replication protein	NA	NA	NA	NA	NA
WP_032471378.1|1015384_1015630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106055.1|1015762_1018522_-	conjugal transfer mating pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_032471366.1|1018618_1019152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271073.1|1019154_1019766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000709417.1|1019945_1020236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091004.1|1020255_1020510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000347733.1|1020509_1023914_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_001266261.1|1023917_1025342_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_000783472.1|1025585_1026443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060801.1|1026439_1026835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000901447.1|1027249_1027519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031951562.1|1028762_1029635_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000556384.1|1030831_1031767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032471365.1|1032338_1033274_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_000845039.1|1033242_1034256_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001209508.1|1034401_1035193_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|1035356_1035704_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|1035697_1036537_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|1036664_1037165_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152787.1|1037147_1037288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|1037671_1038436_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_058647329.1|1039086_1040049_-|integrase	integron integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.4	3.4e-56
WP_000777554.1|1040412_1040886_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_058647330.1|1041296_1041584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058647331.1|1041593_1042841_-	Y-family DNA polymerase	NA	A0A1W6JNT0	Morganella_phage	36.9	2.1e-74
WP_000429838.1|1043079_1043514_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294667.1|1043585_1043936_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000735441.1|1043951_1044227_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_058647318.1|1044229_1044475_+	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_058647319.1|1044471_1046118_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
WP_058647320.1|1046133_1046499_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_058647321.1|1046495_1046732_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_058647322.1|1046784_1047399_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	44.3	1.1e-36
WP_000801210.1|1047459_1048677_-	TniQ family protein	NA	NA	NA	NA	NA
WP_000393453.1|1048673_1049582_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_108400217.1|1049584_1051267_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1053868:1053884	attR	GGCATTGCGCAGGTTTG	NA	NA	NA	NA
>prophage 3
NZ_CP045611	Enterobacter hormaechei strain AUH-ENM30 chromosome	4869611	2299177	2362798	4869611	lysis,integrase,terminase,capsid,head,tRNA,tail,plate,portal	Escherichia_phage(22.73%)	67	2307499:2307516	2336332:2336349
WP_003863138.1|2299177_2299945_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|2299988_2300336_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003863141.1|2300468_2300873_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_058647360.1|2300911_2302282_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003863144.1|2302284_2302770_-	OmpA family protein	NA	NA	NA	NA	NA
WP_003863147.1|2302782_2304003_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.2e-05
WP_003863149.1|2303995_2304532_-	YfiR family protein	NA	NA	NA	NA	NA
WP_003863151.1|2304685_2305060_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_003863153.1|2305272_2306343_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
WP_003863156.1|2306353_2307475_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
2307499:2307516	attL	CCAGCATTGCTGGCTTTT	NA	NA	NA	NA
WP_032659847.1|2307663_2308644_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	80.7	5.2e-153
WP_023295264.1|2308713_2309007_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	71.1	7.7e-36
WP_023295263.1|2309166_2309439_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	82.2	3.4e-38
WP_032659853.1|2309441_2309621_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	86.8	6.2e-12
WP_032659855.1|2309611_2310112_+	hypothetical protein	NA	M1SV55	Escherichia_phage	87.3	9.4e-82
WP_050597015.1|2310176_2310392_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_032659859.1|2310407_2310683_+	hypothetical protein	NA	M1TAP2	Escherichia_phage	61.5	6.8e-26
WP_063159811.1|2310672_2312967_+	replication endonuclease	NA	U5N0W3	Enterobacteria_phage	74.6	0.0e+00
WP_063159810.1|2313004_2313784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063159809.1|2314146_2315172_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.3	1.2e-168
WP_063159808.1|2315173_2316943_-|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	84.9	4.7e-301
WP_023323599.1|2317108_2317963_+|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	73.2	7.1e-114
WP_039269020.1|2318018_2319113_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	82.5	1.2e-166
WP_063159807.1|2319116_2319872_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	65.3	7.5e-75
WP_032609900.1|2319971_2320478_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	71.4	9.9e-63
WP_017382979.1|2320477_2320681_+|tail	tail protein	tail	Q858W3	Yersinia_virus	79.1	3.3e-25
WP_017382980.1|2320671_2320893_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	74.0	7.1e-26
WP_058647368.1|2320876_2321389_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	89.4	6.0e-84
WP_058647369.1|2321385_2321817_+	hypothetical protein	NA	A0A218M4L6	Erwinia_phage	76.9	2.4e-57
WP_058685136.1|2321816_2322233_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	66.4	3.9e-41
WP_045911509.1|2322328_2322796_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	70.3	6.1e-59
WP_047738472.1|2322788_2323238_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.1	4.2e-49
WP_045339915.1|2323306_2323942_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	87.2	9.7e-100
WP_045893687.1|2323938_2324289_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	73.3	1.6e-40
WP_045911506.1|2324294_2325203_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	82.5	3.3e-133
WP_045911505.1|2325195_2325726_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	87.5	3.1e-91
WP_108400182.1|2325737_2328167_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	48.5	8.5e-104
WP_044704182.1|2328168_2328621_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	39.6	1.1e-15
WP_047727360.1|2329091_2330285_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	80.9	4.1e-184
WP_023295232.1|2330297_2330816_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	2.9e-78
WP_032618991.1|2330873_2331197_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	66.3	2.3e-25
WP_017382998.1|2331229_2331352_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	5.9e-14
WP_108400183.1|2331341_2333792_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.3	9.0e-303
WP_023323579.1|2333802_2334267_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	71.4	9.3e-60
WP_063159803.1|2334263_2335433_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.5	5.1e-171
WP_023323577.1|2335509_2335731_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.6	4.9e-27
WP_044704196.1|2335776_2336169_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.2	2.8e-25
WP_003863157.1|2336368_2337241_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
2336332:2336349	attR	CCAGCATTGCTGGCTTTT	NA	NA	NA	NA
WP_003863160.1|2337237_2338398_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_100229775.1|2338505_2338553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003863162.1|2338658_2339000_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_003863164.1|2339267_2340005_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003863165.1|2340136_2341117_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_003863167.1|2341113_2341845_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_022651674.1|2341974_2344548_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	4.5e-127
WP_058647525.1|2350198_2350651_+	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	49.3	4.3e-33
WP_003860741.1|2350802_2352110_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	2.7e-43
WP_003860739.1|2352106_2352430_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_022651673.1|2352476_2353832_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_022651672.1|2353941_2356605_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_003860734.1|2356640_2357339_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_003860733.1|2357409_2357829_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
WP_022651671.1|2358033_2359119_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003860729.1|2359158_2359848_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	7.9e-55
WP_003860727.1|2360163_2360547_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
WP_003860725.1|2360599_2361928_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
WP_003860724.1|2362060_2362798_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP045611	Enterobacter hormaechei strain AUH-ENM30 chromosome	4869611	2437471	2480440	4869611	integrase,terminase,holin,tail	Salmonella_phage(42.22%)	54	2436310:2436325	2482135:2482150
2436310:2436325	attL	TAAGCTGGTTATCCAG	NA	NA	NA	NA
WP_003860601.1|2437471_2438938_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	1.0e-88
WP_003860599.1|2439005_2440583_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_108400170.1|2440775_2442029_+|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	79.9	5.2e-190
WP_108400169.1|2442025_2442577_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	57.9	4.1e-54
WP_032634919.1|2442573_2443260_-	hypothetical protein	NA	R9VWB9	Serratia_phage	63.7	9.8e-82
WP_032634920.1|2443256_2443415_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	76.9	2.8e-16
WP_032636581.1|2443407_2443704_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	69.1	1.1e-32
WP_032634922.1|2443813_2444062_-	AlpA family phage regulatory protein	NA	A0A193GYW1	Enterobacter_phage	79.3	1.2e-32
WP_108400168.1|2444111_2445134_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	97.4	6.0e-184
WP_108400167.1|2445143_2446043_-	endonuclease	NA	Q858E0	Salmonella_phage	95.3	2.5e-162
WP_063162294.1|2446039_2446339_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	6.1e-20
WP_047050275.1|2446636_2447227_-	transcriptional regulator	NA	G9L6A6	Escherichia_phage	75.0	6.7e-79
WP_032634928.1|2447381_2447612_+	hypothetical protein	NA	A0A193GYK6	Enterobacter_phage	84.0	1.5e-31
WP_108400166.1|2447954_2449016_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	79.2	1.2e-179
WP_108400165.1|2449005_2449836_+	Pyocin large subunit	NA	T1SA92	Salmonella_phage	81.3	2.6e-121
WP_108400164.1|2449956_2450301_+	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	93.9	3.4e-59
WP_108400163.1|2450362_2450764_+	hypothetical protein	NA	T1SBJ7	Salmonella_phage	53.2	1.9e-21
WP_108400162.1|2450760_2451072_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.4	1.2e-34
WP_108400161.1|2451071_2451440_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	76.8	5.2e-37
WP_108400160.1|2451982_2452183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058663763.1|2452420_2452687_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	63.2	2.7e-11
WP_058663762.1|2452674_2452854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153213694.1|2452846_2453017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058663761.1|2453009_2453348_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	83.9	4.6e-48
WP_104208887.1|2453425_2453755_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	61.9	7.9e-29
WP_108400159.1|2453811_2454444_+|terminase	terminase small subunit	terminase	A0A193GYG6	Enterobacter_phage	79.9	3.0e-85
WP_108400158.1|2454440_2455916_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	98.2	3.9e-293
WP_153213695.1|2456047_2456278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108400156.1|2456359_2456782_-	hypothetical protein	NA	Q716E1	Shigella_phage	72.9	7.0e-54
WP_032636549.1|2457538_2457745_+	hypothetical protein	NA	T1SA67	Salmonella_phage	95.6	1.3e-08
WP_058663757.1|2457759_2459430_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	94.6	4.0e-302
WP_058663756.1|2459426_2459726_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	91.7	9.3e-45
WP_058663755.1|2459722_2460046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058663754.1|2460057_2460756_+	peptidase	NA	G9L6C4	Escherichia_phage	85.3	8.8e-78
WP_058663753.1|2460773_2461760_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	86.0	4.8e-162
WP_077579850.1|2461811_2462252_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	89.7	4.1e-65
WP_058663751.1|2462256_2462631_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	49.6	4.8e-22
WP_058663750.1|2462682_2463006_+	hypothetical protein	NA	A0A193GYH8	Enterobacter_phage	87.4	4.8e-47
WP_045342897.1|2463005_2463611_+	hypothetical protein	NA	A0A193GYT2	Enterobacter_phage	86.6	1.9e-100
WP_108400155.1|2463610_2466088_+	hypothetical protein	NA	Q858G3	Salmonella_phage	95.0	0.0e+00
WP_058656797.1|2466087_2466552_+	hypothetical protein	NA	T1SA73	Salmonella_phage	90.3	3.1e-79
WP_032671835.1|2466551_2467091_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	73.9	2.0e-61
WP_108400154.1|2467103_2469614_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	78.3	0.0e+00
WP_108400153.1|2469610_2471428_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	70.7	6.6e-234
WP_108400152.1|2471430_2473905_+	hypothetical protein	NA	T1S9I6	Salmonella_phage	86.7	0.0e+00
WP_153213696.1|2473913_2474060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108400151.1|2474097_2474358_-	hypothetical protein	NA	T1SA06	Salmonella_phage	83.5	2.0e-35
WP_108400150.1|2474553_2477052_+	hypothetical protein	NA	G0XNW6	Escherichia_phage	74.3	1.4e-263
WP_108400149.1|2477078_2478287_-	acyltransferase	NA	NA	NA	NA	NA
WP_047344980.1|2478439_2478844_+	membrane protein	NA	T1SA79	Salmonella_phage	82.8	5.1e-54
WP_024203029.1|2478830_2479124_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	65.7	9.2e-29
WP_058656793.1|2479113_2479740_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	87.9	7.8e-102
WP_058656792.1|2479736_2479946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058656791.1|2479942_2480440_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	62.1	1.3e-43
2482135:2482150	attR	CTGGATAACCAGCTTA	NA	NA	NA	NA
>prophage 5
NZ_CP045611	Enterobacter hormaechei strain AUH-ENM30 chromosome	4869611	2860582	2868328	4869611		Ostreococcus_lucimarinus_virus(16.67%)	7	NA	NA
WP_003859473.1|2860582_2861989_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	3.1e-37
WP_003859475.1|2862078_2863164_+	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	52.6	3.7e-99
WP_003859476.1|2863164_2864046_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.4	1.5e-103
WP_003859477.1|2864285_2865452_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	54.0	4.1e-112
WP_003859478.1|2865500_2866505_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.3	1.1e-33
WP_003859479.1|2866697_2867678_+	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_003859480.1|2867716_2868328_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	2.1e-14
>prophage 6
NZ_CP045611	Enterobacter hormaechei strain AUH-ENM30 chromosome	4869611	3048831	3112232	4869611	protease,holin,integrase,terminase,head,tail	Cronobacter_phage(31.15%)	88	3051017:3051045	3099949:3099977
WP_003859784.1|3048831_3049062_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	7.0e-16
WP_022651439.1|3049199_3049571_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_022651438.1|3049572_3050442_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003859787.1|3050458_3050797_+	YebY family protein	NA	NA	NA	NA	NA
3051017:3051045	attL	ACAGGAATCGTATTCGGTCTCTTTTTATC	NA	NA	NA	NA
WP_039268953.1|3051119_3052205_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.4	9.6e-148
WP_023300430.1|3052173_3052446_-	hypothetical protein	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	2.9e-29
WP_047725139.1|3052566_3053088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053004013.1|3053144_3053360_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	66.2	2.6e-17
WP_047725137.1|3053451_3053682_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	39.7	7.7e-07
WP_047725134.1|3053678_3053900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047720562.1|3053896_3054115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072058660.1|3054124_3054841_-	DNA cytosine methyltransferase	NA	A0A0F7L3T9	uncultured_marine_virus	49.6	1.1e-62
WP_058663640.1|3054837_3055500_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	91.2	8.2e-118
WP_058663639.1|3055475_3056003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058663638.1|3055999_3056149_-	DUF1317 family protein	NA	NA	NA	NA	NA
WP_058663637.1|3056145_3056574_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	95.8	3.4e-72
WP_058663636.1|3056570_3057251_-	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	94.2	1.4e-125
WP_058663635.1|3057247_3058093_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.2	4.8e-70
WP_045330311.1|3058110_3058395_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	93.6	1.5e-47
WP_006809788.1|3058466_3058676_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	95.7	6.7e-34
WP_058663634.1|3058827_3059097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058648000.1|3059255_3059693_-	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	96.6	1.5e-75
WP_058691551.1|3060117_3060315_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	90.6	1.0e-23
WP_100185496.1|3060452_3061271_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	46.8	2.0e-36
WP_058663706.1|3061502_3062162_-	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	66.5	8.0e-73
WP_022650973.1|3062270_3062489_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	47.0	1.9e-10
WP_047724847.1|3062519_3063062_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	92.2	3.3e-88
WP_047724849.1|3063195_3063924_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	69.1	5.6e-35
WP_086527956.1|3063920_3064700_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	64.2	1.8e-95
WP_047724854.1|3064696_3064996_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	53.7	7.4e-18
WP_047724857.1|3064992_3065289_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	63.0	9.3e-29
WP_053004007.1|3065285_3065594_+	hypothetical protein	NA	A0A0F6N6A6	Escherichia_phage	48.6	1.1e-11
WP_047724860.1|3065590_3065977_+	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	79.0	1.5e-31
WP_047724863.1|3065978_3066182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058663708.1|3066710_3066905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058663710.1|3067181_3067436_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	47.4	4.1e-09
WP_023330682.1|3067581_3067863_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	53.8	3.2e-23
WP_058663711.1|3068073_3068523_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	47.9	3.8e-34
WP_058663712.1|3068515_3068686_+	NinE family protein	NA	G8C7V4	Escherichia_phage	82.1	8.5e-19
WP_058663713.1|3068678_3069284_+	protein ninG	NA	A0A1P8DTE0	Proteus_phage	63.8	4.3e-65
WP_072206104.1|3069280_3069481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023330677.1|3069467_3069584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058663714.1|3069580_3070270_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	6.5e-57
WP_122008274.1|3071008_3071314_+|holin	holin	holin	E7C9S8	Salmonella_phage	86.1	1.1e-43
WP_044704956.1|3071300_3071741_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	81.2	8.0e-61
WP_044704953.1|3071737_3072124_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	40.3	7.9e-12
WP_046695771.1|3072522_3072738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651103.1|3072797_3073133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044704358.1|3073160_3073676_+|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	76.4	2.3e-67
WP_044704357.1|3073675_3075148_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	83.9	1.3e-253
WP_044704355.1|3075159_3076620_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	74.8	8.5e-200
WP_072056246.1|3076567_3077554_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	66.1	4.0e-108
WP_044704353.1|3077585_3077780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044704352.1|3077872_3079069_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	48.4	5.7e-93
WP_047724469.1|3079072_3079507_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	74.3	5.1e-52
WP_014884000.1|3079516_3080614_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.7	7.6e-161
WP_047724465.1|3080623_3080989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047724463.1|3080991_3081372_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	5.3e-29
WP_047724461.1|3081371_3081545_+	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	49.1	1.0e-11
WP_047724459.1|3081544_3081895_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	4.0e-39
WP_047724457.1|3081897_3082266_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	74.6	3.0e-45
WP_047724455.1|3082262_3082646_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	56.7	2.9e-38
WP_047724454.1|3082704_3083460_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	53.4	9.9e-59
WP_047724452.1|3083510_3084254_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	52.2	1.9e-62
WP_032619448.1|3084326_3084701_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	54.4	1.3e-24
WP_047724448.1|3084758_3087086_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	52.3	6.2e-152
WP_047724447.1|3087085_3087583_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	89.7	4.3e-87
WP_015571561.1|3087582_3088053_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
WP_047724445.1|3088066_3088432_+	NlpC/P60 family protein	NA	F1C5F2	Cronobacter_phage	89.9	1.7e-61
WP_047724443.1|3088418_3090896_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.1	0.0e+00
WP_003859861.1|3090951_3093375_+	SGNH/GDSL hydrolase family protein	NA	G0XNW5	Escherichia_phage	39.8	3.5e-142
WP_039268929.1|3094054_3095365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003859865.1|3095357_3096287_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	90.1	5.7e-157
WP_003859867.1|3096283_3096646_-	GtrA family protein	NA	U5P0S6	Shigella_phage	85.0	4.4e-49
WP_003859869.1|3096758_3097064_+	hypothetical protein	NA	I6PCW5	Cronobacter_phage	40.6	7.8e-15
WP_003859872.1|3097063_3098332_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.5	3.4e-229
WP_032666022.1|3098474_3098882_+	cell envelope integrity/translocation protein TolA	NA	NA	NA	NA	NA
WP_047724439.1|3098948_3099620_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.0	2.6e-79
WP_003859879.1|3100097_3101078_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
3099949:3099977	attR	ACAGGAATCGTATTCGGTCTCTTTTTATC	NA	NA	NA	NA
WP_003859884.1|3101245_3101890_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	3.3e-55
WP_003859885.1|3101924_3102164_-	YebV family protein	NA	NA	NA	NA	NA
WP_022651437.1|3102270_3103734_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_003859888.1|3103790_3106424_-	PqiB family protein	NA	NA	NA	NA	NA
WP_003859890.1|3106392_3107676_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_006811006.1|3107808_3108306_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_003859895.1|3108402_3109089_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_003859896.1|3109108_3111157_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.6	7.8e-82
WP_003859899.1|3111350_3112232_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 7
NZ_CP045611	Enterobacter hormaechei strain AUH-ENM30 chromosome	4869611	3362789	3459128	4869611	holin,integrase,terminase,tRNA,tail,plate	Enterobacteria_phage(26.42%)	89	3352902:3352918	3460362:3460378
3352902:3352918	attL	TGACGGTCGATCAGCAC	NA	NA	NA	NA
WP_022651334.1|3362789_3364133_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_022651333.1|3364129_3364804_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_022651332.1|3364803_3366474_+	OmpA family protein	NA	NA	NA	NA	NA
WP_022651331.1|3366479_3366971_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_022651330.1|3367144_3369793_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.8	1.2e-95
WP_022651329.1|3369789_3372147_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_153213701.1|3374500_3374680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153213702.1|3374679_3375081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651326.1|3375161_3375782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108400188.1|3375978_3376242_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	48.0	1.5e-06
WP_022651324.1|3376244_3377453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039268917.1|3377445_3380817_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_022651322.1|3380836_3382444_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_108400189.1|3382476_3384246_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_022651318.1|3386700_3387192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651316.1|3387524_3388607_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_022651315.1|3388642_3389167_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_039268915.1|3389171_3391634_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_022651313.1|3391623_3392631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058647470.1|3395258_3395603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123839387.1|3395778_3396054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003856903.1|3396617_3397142_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_022651308.1|3398287_3398743_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_022651307.1|3398766_3400083_+	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_003856913.1|3400111_3400600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651306.1|3400916_3402047_+	methyl-accepting chemotaxis sensory transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	2.6e-10
WP_003856916.1|3402137_3403121_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_003856922.1|3403605_3404979_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.6	1.1e-50
WP_003856923.1|3405022_3405958_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.7	3.0e-142
WP_022651305.1|3406007_3407246_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	70.0	4.3e-168
WP_022651304.1|3407247_3407460_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	63.4	4.3e-20
WP_020882485.1|3407524_3407767_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	93.6	1.3e-33
WP_022651303.1|3407805_3408891_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	63.3	2.8e-123
WP_058647468.1|3408900_3412038_-	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	64.3	0.0e+00
WP_022651301.1|3412856_3413249_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	63.1	6.3e-41
WP_022651300.1|3413348_3413576_+	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	62.2	1.6e-20
WP_039268913.1|3413578_3414130_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	47.3	7.5e-32
WP_022651298.1|3414274_3415132_+	phage replication protein O domain	NA	K7PGZ0	Enterobacteria_phage	70.1	3.1e-101
WP_014884021.1|3415128_3415815_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	63.4	5.2e-83
WP_014832179.1|3416091_3416541_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_014884019.1|3416842_3417061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039268909.1|3417406_3418588_-	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_022651295.1|3419074_3419521_+	VOC family protein	NA	NA	NA	NA	NA
WP_022651294.1|3419891_3420116_+	DinI family protein	NA	H6WRY5	Salmonella_phage	62.3	1.8e-21
WP_022651293.1|3420504_3421107_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	82.5	6.8e-95
WP_032645711.1|3421314_3421677_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	83.1	5.2e-50
WP_022651290.1|3421673_3422507_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	78.7	3.3e-124
WP_022651288.1|3423032_3423224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015570936.1|3424009_3424396_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	78.1	3.2e-45
WP_022651286.1|3424382_3424664_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	1.3e-19
WP_022651285.1|3424663_3425293_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.1	2.3e-101
WP_032645710.1|3425300_3425576_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	84.4	3.7e-32
WP_032645635.1|3427296_3427746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651282.1|3427792_3428791_+|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	43.4	1.1e-38
WP_022651281.1|3428768_3430076_+	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	57.3	1.3e-143
WP_022651280.1|3430077_3431466_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	49.2	2.1e-123
WP_022651279.1|3431467_3432565_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	57.9	1.8e-117
WP_022651278.1|3432645_3433416_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.6	6.3e-69
WP_039268908.1|3433428_3434382_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	75.0	5.3e-134
WP_022651276.1|3434699_3435182_+	hypothetical protein	NA	A0A0E3GMJ4	Enterobacteria_phage	34.7	2.6e-12
WP_022651275.1|3435183_3435534_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	57.8	2.1e-32
WP_022651274.1|3435535_3436120_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	55.3	1.4e-49
WP_058647467.1|3436116_3436527_+	hypothetical protein	NA	I6PDJ8	Cronobacter_phage	52.2	2.5e-32
WP_022651272.1|3436596_3437268_+	hypothetical protein	NA	I6PBN6	Cronobacter_phage	47.3	7.4e-50
WP_022651271.1|3437333_3437645_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	68.0	1.8e-35
WP_032645632.1|3437641_3437956_+	hypothetical protein	NA	I6PD79	Cronobacter_phage	65.0	1.1e-16
WP_022651270.1|3437952_3440865_+|tail	phage tail tape measure protein	tail	A0A0K0VLY2	Klebsiella_phage	34.7	1.6e-128
WP_020690998.1|3440939_3441293_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	98.3	6.0e-59
WP_022651269.1|3441349_3441697_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	62.6	1.7e-37
WP_022651268.1|3441693_3442449_+|tail	phage minor tail protein L	tail	G8C7J7	Escherichia_phage	77.2	2.0e-115
WP_022651267.1|3442450_3443164_+|tail	phage tail protein	tail	K7PLS6	Enterobacteria_phage	97.4	1.0e-142
WP_123839386.1|3443240_3443807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651265.1|3443918_3444545_+|tail	tail assembly protein	tail	K7PH91	Enterobacterial_phage	59.9	1.8e-53
WP_022651264.1|3444597_3448149_+|tail	phage tail protein	tail	K7P840	Enterobacteria_phage	84.6	0.0e+00
WP_022651263.1|3448189_3448504_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	65.7	6.6e-33
WP_022651262.1|3448504_3449215_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	3.6e-87
WP_022651261.1|3449283_3449517_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	76.3	9.5e-29
WP_022651260.1|3449575_3450838_+	hypothetical protein	NA	K7PM99	Enterobacterial_phage	65.9	3.2e-147
WP_104468396.1|3451697_3452528_-|tail	tail fiber domain-containing protein	tail	A0A192Y7T9	Enterobacteria_phage	30.6	8.4e-35
WP_022651255.1|3452610_3453177_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	80.0	6.0e-77
WP_022651254.1|3453591_3453930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032645629.1|3454134_3454362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022651253.1|3454923_3455142_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	65.7	2.9e-19
WP_071787990.1|3455424_3455637_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_022651252.1|3455674_3456364_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	1.1e-77
WP_071785691.1|3456688_3456889_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	71.7	1.1e-20
WP_003856931.1|3457309_3457507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651250.1|3457510_3457933_+	GFA family protein	NA	NA	NA	NA	NA
WP_003856933.1|3457967_3459128_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	59.3	2.5e-117
3460362:3460378	attR	GTGCTGATCGACCGTCA	NA	NA	NA	NA
>prophage 8
NZ_CP045611	Enterobacter hormaechei strain AUH-ENM30 chromosome	4869611	4019646	4101182	4869611	protease,transposase,holin,capsid,terminase,integrase,head,tail,portal	Enterobacterial_phage(27.27%)	89	4020601:4020615	4104004:4104018
WP_022650866.1|4019646_4020930_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.3	1.4e-09
4020601:4020615	attL	AGCGCCCTGAAGCTG	NA	NA	NA	NA
WP_108400195.1|4021190_4021511_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	54.7	6.1e-26
WP_153213704.1|4021498_4021738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059468795.1|4021832_4023215_-	hypothetical protein	NA	K7P6I4	Enterobacteria_phage	56.3	6.1e-123
WP_032665940.1|4023273_4023507_-	cor protein	NA	E4WL42	Enterobacteria_phage	77.6	3.9e-30
WP_100185511.1|4023614_4024286_-	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.2	9.9e-87
WP_006809146.1|4024286_4024601_-	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	63.7	7.3e-32
WP_100185512.1|4024645_4028491_-	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	64.0	0.0e+00
WP_022650859.1|4028543_4029128_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	52.6	7.4e-54
WP_023296258.1|4029127_4029838_-	NlpC/P60 family protein	NA	F1C573	Cronobacter_phage	70.2	1.3e-97
WP_016240208.1|4029840_4030599_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	3.9e-95
WP_058647356.1|4030595_4030934_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	60.7	1.1e-38
WP_058663677.1|4030936_4034401_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	89.3	0.0e+00
WP_058647333.1|4034462_4034828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058647334.1|4034874_4035153_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	96.7	2.8e-43
WP_040117541.1|4035161_4035545_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	7.4e-63
WP_040117540.1|4035553_4035997_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	92.4	1.5e-70
WP_058663681.1|4036056_4036404_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	97.4	5.0e-58
WP_058663680.1|4036400_4036850_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.0	3.8e-74
WP_016042205.1|4036846_4037185_-|head	phage head closure protein	head	K7P7L2	Enterobacteria_phage	100.0	2.9e-58
WP_080396119.1|4037184_4037511_-	hypothetical protein	NA	K7PGU9	Enterobacterial_phage	97.2	1.8e-54
WP_058647336.1|4037543_4038701_-|capsid	phage major capsid protein	capsid	Q77WA0	Escherichia_phage	97.4	5.2e-208
WP_057992068.1|4038703_4039381_-|head,protease	HK97 family phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	99.6	5.4e-125
WP_032624427.1|4039398_4040673_-|portal	phage portal protein	portal	F1C584	Cronobacter_phage	99.8	1.9e-248
WP_058647353.1|4040672_4042187_-|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	99.4	2.0e-292
WP_058663679.1|4042193_4042679_-	hypothetical protein	NA	Q77WA1	Escherichia_phage	99.4	3.5e-81
WP_059468687.1|4042832_4043069_-	hypothetical protein	NA	K7PHC8	Enterobacterial_phage	96.2	7.4e-37
WP_000608644.1|4043347_4044610_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|4044865_4045741_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|4045787_4046120_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|4048441_4049146_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002063889.1|4050339_4050882_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|4050894_4051755_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_001067855.1|4051861_4052566_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|4053197_4054028_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|4054158_4054713_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|4054856_4055561_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000509965.1|4056162_4056768_-	DNA invertase	NA	A0A1W5LU24	Ralstonia_phage	31.2	1.9e-12
WP_000427614.1|4059350_4060355_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|4061714_4062419_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004199413.1|4063297_4066315_+|transposase	Tn3-like element IS3000 family transposase	transposase	NA	NA	NA	NA
WP_014386481.1|4066887_4067532_+	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_001067855.1|4068404_4069109_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|4069654_4070668_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|4070823_4071297_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	A0A140HLG8	Bacillus_phage	33.8	5.3e-18
WP_001144737.1|4071517_4071784_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|4071926_4072691_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|4072951_4074166_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001288432.1|4074199_4075633_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|4076014_4076221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071886840.1|4076225_4076693_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001067855.1|4076751_4077456_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013851371.1|4077492_4077996_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_031942321.1|4078510_4079710_-	tetracycline efflux MFS transporter Tet(A)	NA	A0A2H4UVM2	Bodo_saltans_virus	22.4	8.2e-07
WP_031942322.1|4079810_4080479_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078310596.1|4080842_4081040_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	57.4	1.2e-11
WP_058663728.1|4081783_4082374_-	hypothetical protein	NA	K7P6K4	Enterobacteria_phage	95.2	2.1e-104
WP_058647381.1|4082355_4083813_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	90.3	2.1e-270
WP_058647382.1|4083828_4084767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127673971.1|4085138_4085342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058663721.1|4085506_4085704_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	83.7	2.7e-16
WP_058647384.1|4085660_4085930_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	49.4	7.2e-12
WP_058647385.1|4085937_4086564_-	glycoside hydrolase family 19 protein	NA	K7PJS7	Enterobacterial_phage	93.8	2.1e-110
WP_000220248.1|4086560_4086842_-|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	35.9	3.0e-05
WP_006809173.1|4086838_4087243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047746036.1|4087341_4087674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058647386.1|4087828_4088407_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.8	3.6e-45
WP_058647387.1|4088419_4089409_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	91.2	2.1e-181
WP_080396120.1|4089405_4090131_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	52.7	9.8e-56
WP_023293909.1|4090146_4090536_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	96.0	1.1e-66
WP_058647388.1|4090532_4090853_-	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	77.4	1.1e-43
WP_058647389.1|4090849_4091803_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	93.0	1.7e-169
WP_032673528.1|4091786_4091972_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	3.4e-13
WP_072059691.1|4092135_4092696_-	hypothetical protein	NA	A5LH68	Enterobacteria_phage	52.2	2.4e-46
WP_045345728.1|4092718_4092970_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	49.3	7.9e-13
WP_058647390.1|4093004_4093757_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	55.8	2.6e-75
WP_006809187.1|4093917_4094166_+	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	61.9	2.4e-22
WP_006809188.1|4094158_4094617_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	50.7	4.8e-40
WP_006809189.1|4094616_4095030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058647391.1|4095115_4095472_+	hypothetical protein	NA	G0ZNF1	Cronobacter_phage	92.4	3.4e-54
WP_058647392.1|4095506_4095716_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	68.8	1.5e-17
WP_058647393.1|4095896_4096124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058647394.1|4096113_4096350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022648915.1|4096752_4097073_+	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	55.7	3.6e-26
WP_058647431.1|4097121_4097535_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	83.9	8.1e-55
WP_065187046.1|4097531_4098569_+	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	93.6	1.9e-177
WP_045895832.1|4098555_4099230_+	hypothetical protein	NA	K7P6H6	Enterobacteria_phage	97.4	4.4e-34
WP_072202861.1|4099801_4100065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058647396.1|4100039_4101182_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	49.3	1.1e-93
4104004:4104018	attR	AGCGCCCTGAAGCTG	NA	NA	NA	NA
