The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045547	Streptomyces sp. SYP-A7193 chromosome, complete genome	8193527	896969	903299	8193527		uncultured_virus(16.67%)	9	NA	NA
WP_061441690.1|896969_897341_+	helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	50.7	1.7e-11
WP_153176677.1|897351_898416_-	FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	50.3	1.6e-75
WP_078884541.1|898412_898616_-	DUF2180 family protein	NA	NA	NA	NA	NA
WP_061441692.1|898615_899725_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_061441693.1|899721_900030_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061441694.1|900122_900536_+	arsenate reductase ArsC	NA	A0A2H4PQT9	Staphylococcus_phage	38.1	3.7e-15
WP_061441695.1|900532_901513_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	48.7	2.1e-69
WP_061441696.1|901548_901872_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	59.4	3.8e-28
WP_061441697.1|902315_903299_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	26.1	5.3e-12
>prophage 2
NZ_CP045547	Streptomyces sp. SYP-A7193 chromosome, complete genome	8193527	4807033	4844403	8193527	tail,tRNA,plate,integrase	Catovirus(25.0%)	37	4817385:4817430	4829381:4829426
WP_153179202.1|4807033_4808434_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	29.4	3.8e-40
WP_153179203.1|4808567_4809512_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_153181895.1|4809635_4811378_+	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_153179204.1|4811442_4811655_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_153179205.1|4811651_4812500_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153179206.1|4812854_4813769_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153179207.1|4813857_4814205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153179208.1|4814201_4814459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153179209.1|4814495_4815233_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_153181896.1|4815275_4815731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054101637.1|4815995_4817132_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	39.7	1.6e-20
4817385:4817430	attL	CTTGTAATGCGTAGGTCGTCGGTTCGAATCCGACAGGGGGCTCCGC	NA	NA	NA	NA
WP_153179210.1|4817472_4818879_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B3AYD4	Gordonia_phage	28.6	1.7e-35
WP_153179211.1|4818942_4819146_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_153179212.1|4819317_4820472_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_153179213.1|4820662_4821625_-	DNA primase	NA	NA	NA	NA	NA
WP_153179214.1|4821713_4822178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153179215.1|4822384_4824499_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_153179216.1|4824585_4824771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153181897.1|4824773_4824950_-	pRL2-8	NA	NA	NA	NA	NA
WP_153179217.1|4824946_4825264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153179218.1|4825266_4825611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153179219.1|4825610_4826510_-	DUF2637 domain-containing protein	NA	NA	NA	NA	NA
WP_153179220.1|4826506_4826953_-	integral membrane plasmid transfer protein	NA	NA	NA	NA	NA
WP_153179221.1|4826949_4827219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153179222.1|4827680_4828457_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_153179223.1|4828515_4828944_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_153179224.1|4828983_4829217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153179225.1|4829519_4831160_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
4829381:4829426	attR	CTTGTAATGCGTAGGTCGTCGGTTCGAATCCGACAGGGGGCTCCGC	NA	NA	NA	NA
WP_153179226.1|4831313_4832801_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_153179227.1|4832797_4833376_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_153179228.1|4833372_4835331_-|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_153179229.1|4835330_4835795_-|plate	baseplate protein	plate	D6PHT9	uncultured_phage	28.7	2.9e-08
WP_153179230.1|4835865_4837788_-	VgrG-related protein	NA	NA	NA	NA	NA
WP_153179231.1|4837787_4838507_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054101634.1|4838540_4838963_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_153179232.1|4843432_4843954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007450914.1|4843953_4844403_-|tail	phage tail protein	tail	NA	NA	NA	NA
>prophage 1
NZ_CP045548	Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence	508575	314233	352104	508575	transposase,holin	Pseudomonas_phage(16.67%)	32	NA	NA
WP_153182306.1|314233_314341_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153182307.1|314428_316186_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	38.6	3.5e-99
WP_153182308.1|317686_318565_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.9	6.4e-17
WP_153182309.1|318528_319071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153182310.1|319067_319688_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_153182311.1|320263_321298_+	arginine beta-hydroxylase, Fe(II)/alpha-ketoglutarate-dependent	NA	NA	NA	NA	NA
WP_153182312.1|321335_322142_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_153182456.1|322174_322789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153182313.1|323596_326173_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_153182314.1|326169_327000_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.1	1.1e-31
WP_153182315.1|326965_327394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153182316.1|327703_328378_-	response regulator	NA	NA	NA	NA	NA
WP_153182457.1|328337_329612_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_153182458.1|329913_330519_+	sigma-70 family RNA polymerase sigma factor	NA	K4F9S8	Cronobacter_phage	25.3	5.0e-05
WP_153182317.1|330515_331568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153182318.1|332143_332329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153182319.1|333065_333827_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	9.1e-12
WP_153182320.1|333823_334246_-	glyoxalase	NA	NA	NA	NA	NA
WP_153182321.1|334315_334987_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_153182322.1|335515_338953_+|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_153182323.1|338967_339903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153182459.1|339511_340756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153182324.1|341064_342714_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_153182325.1|342880_343501_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_153182326.1|343647_344412_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_153182327.1|344424_346623_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	A0A0E3F6W9	Synechococcus_phage	44.6	7.4e-06
WP_153182460.1|346739_348359_+|transposase	ISAzo13 family transposase	transposase	NA	NA	NA	NA
WP_153182328.1|349597_349891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153182329.1|349912_350134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153182330.1|350251_350431_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_153182331.1|350579_351146_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_153182332.1|351834_352104_+|transposase	transposase	transposase	NA	NA	NA	NA
