The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040314	Escherichia coli strain MA11 chromosome, complete genome	5460921	359748	374413	5460921	tail,integrase,tRNA	Enterobacteria_phage(40.0%)	18	361029:361044	378558:378573
WP_000956557.1|359748_360282_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|360699_360981_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
361029:361044	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|361325_361523_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|361858_362143_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|362139_362490_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|362480_363017_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|364338_364938_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|365002_366316_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|366317_366587_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|366698_367271_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|367343_367973_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|368054_368696_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|368856_369105_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|369166_370264_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|370352_371390_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|371523_371766_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|371931_372915_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|372997_374413_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
378558:378573	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 2
NZ_CP040314	Escherichia coli strain MA11 chromosome, complete genome	5460921	511292	570320	5460921	transposase,protease	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|511292_512552_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|512554_513559_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|513640_513838_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|513941_515240_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|515444_515870_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|515908_518350_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|518530_519262_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|519388_519790_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|519808_520507_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|520557_521217_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|521234_521633_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|521642_522281_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|522283_523447_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|523530_525156_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|525272_525548_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|525696_526026_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|526207_526957_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|526953_527709_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001301921.1|529235_530633_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|530648_530954_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|530963_531428_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|531441_532092_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|532101_532956_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|532955_533642_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|533770_534046_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|534372_534768_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|534774_535089_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|535093_535321_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|535362_535812_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|535882_536677_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|537299_537731_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|537738_538947_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|539081_539720_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|539937_540558_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|540866_542279_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331462.1|542323_542986_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|543093_544059_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|544166_545027_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001302935.1|545115_545496_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589488.1|545613_547557_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|547746_548487_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937658.1|548698_549637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175296.1|549699_550254_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|550578_550785_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|550880_552224_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|552546_553185_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|553390_555124_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060932.1|555120_558900_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|558902_559244_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|559455_559707_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_000239579.1|559700_560051_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|560130_560661_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|560970_561927_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205805.1|562066_563569_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001301928.1|563582_564605_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|564591_565587_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|565619_566618_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|566793_568167_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|568322_568874_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|568967_570320_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 3
NZ_CP040314	Escherichia coli strain MA11 chromosome, complete genome	5460921	602740	615316	5460921		Enterobacteria_phage(81.82%)	15	NA	NA
WP_000772662.1|602740_604015_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
WP_000936844.1|604182_604488_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001453880.1|604564_605299_+	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000095622.1|605336_606581_-	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_000446132.1|606906_607479_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638634.1|607552_608053_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283021.1|608049_608784_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|609335_609602_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980224.1|609598_610189_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001244670.1|610181_610469_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459287.1|610461_610917_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|611052_611373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783684.1|611387_613721_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_044815386.1|614076_614271_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001301682.1|614488_615316_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	40.4	4.3e-55
>prophage 4
NZ_CP040314	Escherichia coli strain MA11 chromosome, complete genome	5460921	1011392	1093135	5460921	protease,lysis,plate,terminase,head,capsid,tail,integrase,holin,transposase,portal	Shigella_phage(48.21%)	91	1028640:1028654	1093551:1093565
WP_000246433.1|1011392_1012724_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|1012726_1013251_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|1013247_1014528_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|1014552_1015635_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|1015598_1017449_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|1017452_1017866_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|1017956_1019348_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|1019398_1019623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|1019657_1020158_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|1020854_1021373_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103335.1|1021582_1023724_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_000509142.1|1023799_1028023_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000247943.1|1028224_1028488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|1028402_1028588_-	protein YncO	NA	NA	NA	NA	NA
1028640:1028654	attL	AATAACTAAAAAGAT	NA	NA	NA	NA
WP_000027427.1|1028668_1029841_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_001118031.1|1029958_1030729_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|1030882_1031356_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973071.1|1031398_1033843_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284050.1|1034082_1034661_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001301698.1|1034765_1035533_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|1035503_1036244_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001303998.1|1036399_1036660_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729705.1|1036678_1036939_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543891.1|1037124_1037898_+	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001301901.1|1038715_1040455_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001301640.1|1040414_1041185_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226186.1|1041255_1042311_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|1042362_1042656_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263495.1|1042658_1043057_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_001059871.1|1043066_1043519_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001303804.1|1043825_1044092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077626217.1|1044024_1044561_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293009.1|1044617_1046075_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1046335_1046794_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189536.1|1046885_1048130_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174701.1|1048187_1048589_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|1048627_1049683_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|1049970_1051074_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|1051085_1052339_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_000051887.1|1052543_1053707_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_077769569.1|1053583_1054018_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	98.6	1.0e-76
WP_000206732.1|1053933_1054239_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|1054238_1054601_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008235.1|1054591_1055128_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_000917896.1|1055804_1056101_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_001020634.1|1056378_1057071_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|1057168_1057429_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|1057421_1057973_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|1058148_1058328_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104949.1|1058317_1059259_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_072141203.1|1059255_1059750_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_001303054.1|1059749_1060403_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_000210141.1|1060399_1060726_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_000767113.1|1060722_1061112_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|1061131_1061941_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001360050.1|1061948_1062938_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001008431.1|1062951_1063704_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_000484663.1|1063917_1064457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310393.1|1064600_1064834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449601.1|1065112_1065406_+	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001120501.1|1065542_1065878_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001197766.1|1065881_1066358_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001228695.1|1066574_1066757_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|1066847_1067141_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_085948178.1|1067839_1069053_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000929175.1|1069455_1069950_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_128484532.1|1070183_1071680_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000923141.1|1071827_1073054_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000999805.1|1073046_1073649_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000766100.1|1073659_1074889_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000924828.1|1074967_1075291_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000702395.1|1075287_1075698_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000224836.1|1075672_1076179_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000779288.1|1076175_1076736_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000497751.1|1076744_1076915_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155728.1|1076898_1078395_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000090993.1|1078394_1078751_+	hypothetical protein	NA	U5P076	Shigella_phage	99.2	1.2e-62
WP_000661054.1|1078750_1079020_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000807197.1|1079161_1080997_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000219910.1|1081057_1082386_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000999513.1|1082382_1083462_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_001259066.1|1083461_1084010_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000424732.1|1084009_1084435_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785302.1|1084421_1085480_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000383550.1|1085470_1086055_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_032195359.1|1086325_1086721_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	4.8e-65
WP_001008234.1|1086741_1087185_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_000905124.1|1088034_1088589_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_000355484.1|1088649_1089423_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000246059.1|1090247_1090991_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001130487.1|1091953_1093135_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
1093551:1093565	attR	AATAACTAAAAAGAT	NA	NA	NA	NA
>prophage 5
NZ_CP040314	Escherichia coli strain MA11 chromosome, complete genome	5460921	1672062	1710157	5460921	lysis,portal,tail,integrase,holin,protease	Enterobacteria_phage(52.5%)	47	1661504:1661518	1693793:1693807
1661504:1661518	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_024219169.1|1672062_1672944_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
WP_001303849.1|1673106_1673325_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|1673364_1673532_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|1673774_1674377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|1674587_1674809_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|1674907_1675189_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|1675199_1675391_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|1675363_1675546_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|1675542_1676223_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|1676920_1677103_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|1677099_1677270_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|1677262_1677883_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028857.1|1677879_1678545_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_000750155.1|1678756_1679716_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|1680053_1680176_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|1680190_1680880_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|1681063_1681807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1681892_1682051_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_012578864.1|1682131_1682530_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|1682672_1682888_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|1682887_1683385_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|1683381_1683849_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|1683836_1683989_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_001072975.1|1687252_1687465_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|1687392_1688517_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|1688638_1688974_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136598.1|1688918_1690946_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_001097050.1|1691032_1691356_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|1691348_1691624_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|1691635_1692214_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|1692210_1692612_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|1692622_1693366_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|1693426_1693813_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
1693793:1693807	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|1693821_1694151_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|1694122_1697188_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|1697187_1697517_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|1697526_1698225_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|1698230_1698974_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|1698910_1699519_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_001233141.1|1703063_1703663_+	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|1703722_1705039_+|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|1705040_1705310_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|1705486_1706467_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|1706500_1707520_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|1708016_1708178_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|1708346_1709228_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|1709458_1710157_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 6
NZ_CP040314	Escherichia coli strain MA11 chromosome, complete genome	5460921	1832277	1843387	5460921	capsid,terminase,integrase	uncultured_Caudovirales_phage(25.0%)	15	1826739:1826753	1839482:1839496
1826739:1826753	attL	AATAACTTTTAACGC	NA	NA	NA	NA
WP_000188174.1|1832277_1834224_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1834296_1834521_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000085207.1|1834925_1836149_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.2	1.6e-127
WP_000775337.1|1836145_1836919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075374.1|1837010_1837235_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	1.9e-18
WP_072141637.1|1837244_1837943_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920688.1|1837935_1838124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659213.1|1838123_1838315_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	2.2e-07
WP_000770151.1|1838552_1838852_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761783.1|1838848_1840597_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.4	5.6e-89
1839482:1839496	attR	GCGTTAAAAGTTATT	NA	NA	NA	NA
WP_000164427.1|1840947_1841193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391152.1|1841323_1841518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018605.1|1841521_1841683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229493.1|1841812_1842301_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	3.5e-25
WP_000562896.1|1842463_1843387_+|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.1	3.4e-13
>prophage 7
NZ_CP040314	Escherichia coli strain MA11 chromosome, complete genome	5460921	1936386	2005950	5460921	terminase,head,tail,portal,integrase,holin,transposase,protease	Escherichia_phage(26.09%)	80	1944874:1944889	1966240:1966255
WP_000156526.1|1936386_1938147_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1938332_1938785_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1938860_1939901_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1940257_1940767_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1940985_1941615_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1941577_1943740_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1943749_1944196_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1944318_1946373_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1944874:1944889	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1946404_1946863_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1946958_1947621_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1947793_1948207_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1948251_1948569_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1948626_1949817_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1949911_1950190_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1950186_1950516_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1950606_1951266_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1951673_1952693_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1952670_1952913_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1952980_1955452_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1955545_1955737_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1955733_1955922_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1956495_1956681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1956867_1957257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1957398_1957554_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1957831_1958119_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1958118_1958310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1958337_1958739_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1958847_1959120_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1959103_1959529_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1959735_1960191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1960269_1961361_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1961367_1962114_+	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1962135_1962906_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1962921_1963335_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1963686_1964460_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1964825_1964963_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|1965007_1965220_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|1965387_1965666_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1965667_1966717_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1966240:1966255	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1966729_1967101_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1967090_1967462_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1967613_1968432_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|1968718_1968958_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|1969052_1969766_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1970532_1972383_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_085948178.1|1972558_1973771_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303878.1|1973976_1974291_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1974818_1975004_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1975225_1975339_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1975559_1976093_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1976252_1976525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1976780_1976987_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1977737_1978013_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1978088_1978469_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1978465_1978813_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1978862_1980401_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|1980450_1980693_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_001302857.1|1980664_1982593_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|1982576_1982783_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1982779_1984372_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1984361_1985867_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1985903_1986251_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1986308_1986575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|1986556_1987297_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1987310_1987742_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1987768_1988182_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_128484525.1|1988162_1990742_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000847298.1|1990738_1991068_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302968.1|1991067_1991766_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000194760.1|1991776_1992520_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|1992465_1993098_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649827.1|1993288_1993816_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_000515109.1|1993949_1997423_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_001230444.1|1997490_1998090_+	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268855.1|1998154_1999468_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001023407.1|1999469_1999739_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001301613.1|2001731_2002850_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|2002846_2004640_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|2004658_2005366_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|2005362_2005950_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP040314	Escherichia coli strain MA11 chromosome, complete genome	5460921	2253654	2372889	5460921	protease,lysis,terminase,head,capsid,tail,integrase,tRNA,holin,transposase,portal	Enterobacteria_phage(37.61%)	154	2318250:2318265	2346504:2346519
WP_000952736.1|2253654_2254476_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|2254631_2255678_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|2255674_2256469_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|2256635_2257754_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|2257722_2257992_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|2258053_2258443_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|2258575_2259091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|2259205_2259358_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|2259673_2260150_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2260274_2260598_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693962.1|2260581_2261007_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|2261075_2262113_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_001301518.1|2262144_2262567_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_000017339.1|2263314_2263632_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|2263628_2263931_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|2263920_2264238_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|2264191_2264509_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|2264495_2264933_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|2264934_2265126_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|2265128_2265716_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|2265831_2265936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2266124_2266337_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|2266504_2266783_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265159.1|2266784_2267834_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001217410.1|2267846_2268221_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|2268217_2269039_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|2269635_2269803_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023167.1|2270117_2272055_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|2272202_2272385_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|2272422_2272692_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|2272767_2272983_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|2272987_2273332_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2273382_2273916_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2274186_2274756_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2274755_2274902_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|2275129_2275336_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2275400_2275625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2275981_2276122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|2276251_2276437_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279796.1|2276478_2276844_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|2277135_2277699_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2277695_2279357_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2279420_2281358_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2281402_2281624_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2281569_2284071_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2284150_2284477_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2284486_2284837_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2284833_2285280_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2285276_2285621_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2285679_2286396_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2286410_2286785_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2286880_2287090_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2287137_2290380_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2290372_2290714_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|2290713_2291412_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|2291428_2291683_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|2291792_2291903_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2292205_2293084_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967266.1|2293137_2293407_+	hypothetical protein	NA	A0A0N7KZA3	Stx2-converting_phage	100.0	6.2e-48
WP_153021262.1|2293410_2293875_+	endopeptidase	NA	B6ETG2	Enterobacteria_phage	99.4	2.7e-91
WP_071526731.1|2293820_2294057_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2294069_2294159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2294178_2296527_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2297117_2300519_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|2302622_2302748_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|2302827_2303103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2303163_2304525_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|2304888_2305752_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2305735_2306872_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2307121_2308348_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2308396_2309518_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085270.1|2309766_2310993_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	5.4e-131
WP_000953272.1|2311357_2311546_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|2311595_2311922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|2312046_2312220_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|2312350_2312548_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|2312540_2312753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|2312742_2313207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|2313199_2313433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|2313438_2313738_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833626.1|2313734_2315135_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.3	3.6e-115
WP_000192401.1|2315335_2315587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|2315583_2315994_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|2316004_2316277_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|2316403_2316628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|2316879_2317086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|2317085_2318141_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|2318153_2318489_+|head	head decoration protein	head	NA	NA	NA	NA
2318250:2318265	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|2318501_2318915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2319120_2319663_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|2319918_2320200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2320800_2322261_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2322260_2322932_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2323100_2324471_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2324474_2325116_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2325151_2326258_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2326311_2326773_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2326782_2327436_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2327607_2328858_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2328971_2330114_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088657.1|2330103_2330340_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|2330443_2331268_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|2331264_2331966_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2331962_2332265_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2332332_2332665_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2332729_2332852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|2332909_2334436_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|2334937_2335393_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2335392_2335563_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2335555_2335846_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2335842_2336205_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2336201_2336342_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2336338_2337028_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|2337349_2337655_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2337641_2338118_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2338334_2338517_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2338607_2338901_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|2339192_2339603_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2339888_2340095_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2340259_2340454_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2340842_2341388_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_153021249.1|2341362_2343288_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|2343284_2343491_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2343487_2345089_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2345069_2346389_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2346398_2346731_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
2346504:2346519	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063233.1|2346785_2347811_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_000158906.1|2347852_2348251_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2348262_2348616_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|2348627_2349206_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|2349202_2349598_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|2349605_2350346_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2350361_2350784_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2350765_2351200_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|2351192_2353742_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|2353738_2354068_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2354067_2354766_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|2354771_2355515_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|2355451_2356084_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|2356144_2359543_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|2359609_2360209_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|2360273_2363189_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|2363188_2363770_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|2363889_2364780_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2364798_2365305_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2365341_2365842_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2365920_2366103_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|2366600_2367269_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|2367325_2367574_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|2367649_2368030_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2368026_2368374_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2368423_2369962_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|2370264_2371749_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2371935_2372889_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 9
NZ_CP040314	Escherichia coli strain MA11 chromosome, complete genome	5460921	2457473	2556066	5460921	terminase,head,capsid,tail,integrase,holin,transposase,portal	Escherichia_phage(31.78%)	126	2450199:2450212	2467020:2467033
2450199:2450212	attL	TGGTATGCAGTAAC	NA	NA	NA	NA
WP_000113674.1|2457473_2458604_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2458581_2458830_-	excisionase	NA	NA	NA	NA	NA
WP_000048549.1|2458894_2461366_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_001090200.1|2461458_2461650_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2461646_2461835_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2462232_2462400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2462393_2462627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2462604_2463012_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2463034_2463253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2463325_2463625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2463888_2464296_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2464372_2464600_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2464583_2465135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2465106_2466147_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_001302276.1|2466178_2466601_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000774808.1|2466787_2467369_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
2467020:2467033	attR	GTTACTGCATACCA	NA	NA	NA	NA
WP_001505071.1|2467365_2467530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2468228_2468987_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2469265_2469478_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|2469698_2469956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2470025_2470304_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2470305_2471352_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2471364_2471724_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2471732_2472263_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2472504_2472702_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|2472852_2473911_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143067.1|2474707_2476561_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|2476710_2476926_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|2476930_2477275_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2477325_2477859_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2478129_2478699_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2478698_2478845_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2479072_2479258_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2479682_2479910_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2479951_2480317_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000958387.1|2480606_2481170_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2481166_2482828_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2482891_2484829_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2484873_2485095_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2485040_2487542_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2487621_2487948_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2487957_2488308_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2488304_2488751_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2488747_2489092_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2489150_2489867_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2489872_2490247_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2490342_2490552_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2490604_2493847_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2493839_2494181_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_024748472.1|2494180_2494618_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	100.0	5.0e-63
WP_085949318.1|2494739_2495953_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_012779365.1|2496118_2499379_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_001304111.1|2499381_2499597_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2499664_2500264_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2500328_2501552_+|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2501553_2501823_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2501936_2502512_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2503221_2503872_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2504454_2505993_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2506042_2506390_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2506386_2506767_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000102124.1|2507729_2508947_-	exonuclease	NA	H6WRX1	Salmonella_phage	51.3	4.4e-85
WP_000199475.1|2509039_2509228_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2509224_2509413_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2509977_2510187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2510187_2510826_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2510837_2510990_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2511282_2511621_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2512012_2512255_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2512238_2512664_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2512732_2513776_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_001379651.1|2513807_2514230_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_000450627.1|2514263_2514980_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2515012_2515294_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2515290_2515518_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2515510_2515822_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2515949_2516168_+	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2516169_2516727_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2516960_2517173_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2517292_2517637_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2517758_2518031_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2518032_2519082_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2519094_2519400_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2519462_2520017_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2520241_2520439_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2520574_2521288_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2521738_2522170_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2522647_2524498_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_000411805.1|2524946_2525153_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|2525157_2525502_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2525552_2526086_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2526356_2526926_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2526925_2527072_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2527294_2527480_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2528005_2528320_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2528401_2528626_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2529012_2529558_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2529532_2531458_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2531454_2531661_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001483435.1|2531657_2533259_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	6.7e-307
WP_000123254.1|2533239_2534559_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2534568_2534901_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2534956_2535982_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2536023_2536422_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2536433_2536787_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2536801_2537335_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2537331_2537727_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2537734_2538487_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2538500_2538923_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2538949_2539363_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2539343_2541956_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2541952_2542282_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302968.1|2542281_2542980_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_153021250.1|2542990_2543734_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	97.6	2.1e-146
WP_071601640.1|2543679_2544309_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_024748476.1|2544549_2548029_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_001230509.1|2548096_2548696_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_024748460.1|2548760_2550074_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001023407.1|2550075_2550345_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2550458_2551034_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2551106_2551736_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2551817_2552459_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_016241229.1|2552620_2552935_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2552994_2554278_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2554366_2555827_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2555862_2556066_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 10
NZ_CP040314	Escherichia coli strain MA11 chromosome, complete genome	5460921	2827660	2933580	5460921	protease,terminase,head,capsid,tail,integrase,holin,transposase,portal	Stx2-converting_phage(41.94%)	116	2870918:2870939	2918553:2918574
WP_000422055.1|2827660_2828710_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559267.1|2828929_2829688_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2829684_2830275_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2830314_2831187_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2831399_2832983_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2833010_2833631_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2833627_2834509_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2834646_2834691_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2834782_2836345_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763503.1|2836344_2837940_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001416116.1|2837943_2839302_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	7.3e-36
WP_000209521.1|2839313_2840507_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2840506_2841313_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2841693_2841873_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2841958_2842459_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2842504_2843011_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001023426.1|2849093_2849363_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_024748463.1|2849364_2850678_-|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	6.5e-82
WP_001230495.1|2850742_2851342_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	3.7e-109
WP_024748464.1|2851408_2854888_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.1	0.0e+00
WP_129137391.1|2855134_2855767_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|2855712_2856456_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_001303038.1|2856466_2857165_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_000807954.1|2857164_2857506_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261924.1|2857498_2860741_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|2860793_2861003_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2861098_2861473_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2861478_2862195_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2862253_2862598_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2862594_2863041_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2863037_2863388_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2863397_2863724_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2863803_2866305_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2866250_2866472_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2866516_2868454_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2868517_2870179_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|2870175_2870739_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
2870918:2870939	attL	GCCAGTTAACATGTTAACTGGC	NA	NA	NA	NA
WP_001303046.1|2871027_2871393_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000074669.1|2871434_2871659_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|2871740_2872055_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2872582_2872768_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000075112.1|2872984_2873482_-	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_000411802.1|2873481_2873688_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_024748518.1|2874135_2875986_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_000483497.1|2876477_2877536_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_000917735.1|2877686_2877884_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762904.1|2878110_2878932_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000904137.1|2878928_2879303_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_001304183.1|2880366_2880645_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000967408.1|2881174_2881387_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|2881575_2881680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610379.1|2881795_2882158_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_000137941.1|2882154_2882526_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000063625.1|2882561_2882774_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_001302146.1|2882822_2883179_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_001118161.1|2883235_2883631_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000450888.1|2883646_2884417_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_000790456.1|2884446_2885187_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000095667.1|2885193_2886147_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000693888.1|2886169_2886595_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_024213789.1|2886578_2886854_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000367559.1|2886956_2887346_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000380314.1|2887515_2887668_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000450222.1|2888155_2888344_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|2888340_2888529_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102181.1|2888621_2891066_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000113189.1|2891130_2891379_+	excisionase	NA	NA	NA	NA	NA
WP_085948178.1|2892071_2893284_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_153021251.1|2893281_2893800_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	58.9	4.1e-48
WP_001261931.1|2894515_2894764_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	1.2e-37
WP_122993326.1|2895135_2896149_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|2896363_2896441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023420.1|2896551_2896821_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_153021252.1|2896822_2898136_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	2.4e-76
WP_001228290.1|2898287_2898887_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_129137390.1|2898954_2901300_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|2901251_2902427_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2902769_2903402_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_046671488.1|2903347_2904091_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_001303038.1|2904101_2904800_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_000807954.1|2904799_2905141_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_065763508.1|2905133_2908376_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.7	0.0e+00
WP_001453698.1|2908428_2908638_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2908733_2909108_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2909113_2909830_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2909888_2910233_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2910229_2910676_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2910672_2911023_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2911032_2911359_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2911438_2913940_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2913885_2914107_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2914151_2916089_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2916152_2917814_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|2917810_2918374_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001303046.1|2918661_2919027_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
2918553:2918574	attR	GCCAGTTAACATGTTAACTGGC	NA	NA	NA	NA
WP_000074667.1|2919068_2919296_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	98.7	1.1e-34
WP_012816791.1|2919720_2919906_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2920133_2920280_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2920279_2920849_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2921119_2921653_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2921703_2922048_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|2922052_2922259_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_024748470.1|2922707_2924558_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_001303509.1|2925036_2925465_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2926100_2926790_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2926786_2927146_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2927158_2928208_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2928209_2928488_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2928655_2928868_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2929056_2929161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2929276_2929861_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2929917_2930313_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788936.1|2931123_2931864_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_000095670.1|2931870_2932833_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000693943.1|2932855_2933281_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2933277_2933580_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 11
NZ_CP040314	Escherichia coli strain MA11 chromosome, complete genome	5460921	3199994	3293755	5460921	protease,terminase,tail,integrase,tRNA,holin,portal	Enterobacteria_phage(40.0%)	102	3274585:3274600	3292016:3292031
WP_000984517.1|3199994_3200876_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055778.1|3201067_3203116_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
WP_000431368.1|3203135_3203834_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043882.1|3203930_3204428_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207282.1|3204557_3205841_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001302055.1|3205809_3208443_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001302304.1|3208523_3209963_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|3210080_3210317_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|3210421_3210613_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812736.1|3210613_3211270_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	6.8e-56
WP_000976483.1|3211665_3212007_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879314.1|3212019_3212892_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168751.1|3212895_3213270_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|3213408_3213639_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011656.1|3213740_3214397_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944243.1|3214420_3215083_+	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_000936917.1|3215079_3217140_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000024742.1|3217348_3218008_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|3218334_3218691_-	protein YebF	NA	NA	NA	NA	NA
WP_000257740.1|3218757_3219048_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173471.1|3219181_3220360_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|3220415_3221057_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|3221093_3222905_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301737.1|3223139_3224615_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056694.1|3224952_3225822_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091169.1|3225949_3227392_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_000448391.1|3227522_3228494_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|3228613_3229936_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001303192.1|3229951_3230884_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|3230962_3231718_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571476.1|3231714_3232500_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|3232646_3233657_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|3233665_3234277_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010723105.1|3234415_3234481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024949.1|3234551_3235154_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|3235155_3235677_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|3235711_3236452_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001300367.1|3236480_3236933_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258685.1|3237050_3238823_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891621.1|3239132_3239699_+	hydrolase	NA	NA	NA	NA	NA
WP_001261931.1|3240016_3240265_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	1.2e-37
WP_122993326.1|3240636_3241650_-	peptidase M85	NA	NA	NA	NA	NA
WP_122988840.1|3241864_3241942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023420.1|3242052_3242322_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	100.0	3.8e-45
WP_153021252.1|3242323_3243637_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	2.4e-76
WP_001228290.1|3243788_3244388_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_153021253.1|3244455_3247929_-	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	90.6	0.0e+00
WP_153021263.1|3248174_3248807_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	3.4e-105
WP_001372130.1|3248752_3249496_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.9e-147
WP_001302968.1|3249506_3250205_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000847298.1|3250204_3250534_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_115333668.1|3250530_3253176_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000532073.1|3253219_3253528_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479061.1|3253554_3253977_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.1	3.7e-71
WP_000235090.1|3253990_3254743_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|3254750_3255149_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3255161_3255785_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|3255787_3256069_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|3256061_3256388_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114421.1|3256475_3258500_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974568.1|3258444_3259947_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_000102415.1|3259946_3260159_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_032312325.1|3260155_3262279_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000348565.1|3262275_3262752_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|3263269_3263455_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3263682_3263829_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3263828_3264398_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3264668_3265202_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3265206_3265422_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|3265499_3265745_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3265785_3265965_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_153021254.1|3266102_3268049_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.0	0.0e+00
WP_000483509.1|3268643_3269702_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_000917741.1|3269853_3270051_-	hypothetical protein	NA	A0A0P0ZDH6	Stx2-converting_phage	100.0	8.0e-29
WP_001204809.1|3270266_3270647_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	99.2	1.4e-66
WP_001202271.1|3270665_3271655_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	8.9e-193
WP_001065352.1|3271706_3271964_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	71.1	1.2e-21
WP_000203852.1|3271960_3273361_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.4	1.7e-245
WP_000988196.1|3273357_3274236_-	ATPase AAA	NA	Q8W641	Enterobacteria_phage	96.0	2.0e-140
WP_001247844.1|3274246_3275155_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	94.0	2.4e-59
3274585:3274600	attL	ATTCCGGTGAATATTC	NA	NA	NA	NA
WP_153021255.1|3275219_3275393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587259.1|3275371_3276034_-	hypothetical protein	NA	Q8W643	Enterobacteria_phage	92.5	3.7e-110
WP_001090254.1|3276142_3276850_-	DNA-binding protein	NA	Q8W645	Enterobacteria_phage	90.2	1.6e-114
WP_000944728.1|3276931_3277165_-	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	77.0	1.2e-28
WP_000800140.1|3277321_3278011_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	88.2	5.2e-115
WP_000387836.1|3278159_3278861_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPB8	Escherichia_phage	59.7	1.5e-37
WP_000147364.1|3278857_3279058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000553977.1|3279256_3279439_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	52.7	2.9e-09
WP_001365075.1|3279444_3280017_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	71.3	5.5e-78
WP_000720006.1|3280386_3281214_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	97.5	1.2e-129
WP_001484100.1|3281254_3281626_+	hypothetical protein	NA	Q8W655	Enterobacteria_phage	95.1	2.3e-61
WP_001193437.1|3281817_3282072_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063650.1|3282105_3283392_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	99.8	6.9e-254
WP_069198793.1|3283408_3284173_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	1.3e-71
WP_000252980.1|3284225_3284621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|3284661_3285405_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564730.1|3285401_3286373_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176813.1|3286537_3288967_-	Trimethylamine-N-oxide reductase 2	NA	NA	NA	NA	NA
WP_001214277.1|3288991_3290092_-	cytochrome c-type protein TorY	NA	NA	NA	NA	NA
WP_001185748.1|3290479_3291226_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001302537.1|3291239_3291806_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025318.1|3292021_3293755_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
3292016:3292031	attR	ATTCCGGTGAATATTC	NA	NA	NA	NA
>prophage 12
NZ_CP040314	Escherichia coli strain MA11 chromosome, complete genome	5460921	3322907	3343812	5460921	tail,integrase,transposase	Enterobacteria_phage(79.17%)	28	3314821:3314835	3331361:3331375
3314821:3314835	attL	TCAGCGCCCGGCGTT	NA	NA	NA	NA
WP_001303019.1|3322907_3323909_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
WP_000865208.1|3323914_3324262_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|3324291_3324942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|3324957_3325362_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|3325451_3325589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3325660_3325864_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3325885_3326236_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|3326246_3326525_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|3326536_3326779_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|3326775_3326889_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|3326981_3327398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3327421_3327625_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|3327621_3327888_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|3327884_3328184_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000775057.1|3328506_3328737_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000599379.1|3328809_3329175_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|3329181_3332004_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
3331361:3331375	attR	AACGCCGGGCGCTGA	NA	NA	NA	NA
WP_000686523.1|3332080_3333040_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|3333044_3333359_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|3334564_3334981_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|3335024_3335597_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|3335753_3336242_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000763327.1|3339044_3339173_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|3339208_3339574_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|3339628_3340141_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|3340140_3341325_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|3341482_3341806_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_085948178.1|3342599_3343812_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 13
NZ_CP040314	Escherichia coli strain MA11 chromosome, complete genome	5460921	3401790	3468863	5460921	terminase,head,tail,integrase,holin,transposase,portal	Escherichia_phage(31.11%)	68	3417443:3417458	3474522:3474537
WP_001023396.1|3401790_3402060_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_088136427.1|3402061_3403231_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001230509.1|3403295_3403895_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_137049505.1|3403962_3407373_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_148936303.1|3407677_3408310_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	1.7e-104
WP_000194760.1|3408255_3408999_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001302968.1|3409009_3409708_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000847298.1|3409707_3410037_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|3410033_3412613_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3412593_3413007_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3413033_3413465_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3413478_3414219_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3414200_3414467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3414524_3414872_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3414908_3416414_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3416403_3417996_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
3417443:3417458	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|3417992_3418199_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3418182_3420111_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000235436.1|3420082_3420592_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|3420986_3421211_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|3421292_3421607_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3422133_3422319_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|3422546_3422678_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|3422690_3422873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|3423028_3423562_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|3423612_3423957_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000411809.1|3423961_3424168_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_085948178.1|3424487_3425700_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000023257.1|3425782_3427633_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001059369.1|3429172_3429862_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|3429858_3430218_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|3430230_3431280_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|3431281_3431560_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|3431727_3431940_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|3432126_3432231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|3432340_3432904_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|3433030_3433342_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|3433338_3433491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|3433523_3433880_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|3433876_3434101_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|3434122_3434821_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000373320.1|3434855_3435278_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_001262409.1|3435309_3436347_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|3436415_3436841_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|3436837_3437065_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|3437162_3437807_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|3438081_3438234_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|3438714_3438903_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|3438899_3439088_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|3439183_3441655_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|3441713_3441917_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|3441916_3442939_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|3443174_3443972_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_014714124.1|3444461_3452444_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_000480501.1|3452705_3453758_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|3454071_3455388_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|3455489_3456944_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|3457286_3458003_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|3458628_3460272_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|3460389_3461340_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|3461441_3462359_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|3462815_3463751_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|3463812_3464892_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|3464903_3465647_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|3465643_3466189_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|3466550_3466931_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3466927_3467275_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3467324_3468863_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
3474522:3474537	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 14
NZ_CP040314	Escherichia coli strain MA11 chromosome, complete genome	5460921	3572056	3673012	5460921	terminase,tail,portal,integrase,tRNA,holin,protease	Enterobacteria_phage(53.42%)	111	3625563:3625583	3670518:3670538
WP_000476014.1|3572056_3573418_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|3573747_3574065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|3574470_3575370_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|3575451_3576231_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|3576330_3577371_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490697.1|3577418_3578774_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|3578777_3579062_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|3579092_3579545_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853846.1|3579554_3580817_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001301486.1|3580845_3581700_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|3581998_3583051_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000859148.1|3583307_3584585_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|3584581_3585586_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|3585582_3586548_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|3586521_3587268_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301907.1|3587319_3588138_-	glycosyl hydrolase 25 family protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000822268.1|3588202_3589003_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|3588999_3589788_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|3590121_3590361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|3591411_3591759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|3591768_3592083_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|3592192_3592465_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134627.1|3592585_3593443_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153070.1|3593660_3593999_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|3594080_3595115_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000945390.1|3595125_3597606_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677409.1|3597621_3598296_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000682830.1|3598383_3598926_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|3599217_3599499_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|3599760_3600870_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001301615.1|3601001_3603035_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001411921.1|3606997_3608278_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_000356838.1|3609991_3613621_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|3613682_3614000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|3615240_3616329_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|3616339_3617869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|3617887_3618619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|3618611_3619748_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|3619744_3621748_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|3621872_3622334_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3622375_3622846_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3622892_3623612_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|3623608_3625294_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
3625563:3625583	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261939.1|3625808_3626057_+	DNA damage-inducible protein DinI	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001143784.1|3626218_3626860_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_072142879.1|3626941_3627358_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001023396.1|3627518_3627788_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_088136427.1|3627789_3628959_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001230509.1|3629023_3629623_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_153021258.1|3629690_3633170_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.2	0.0e+00
WP_153021263.1|3633415_3634048_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	3.4e-105
WP_001372130.1|3633993_3634737_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.9e-147
WP_153021259.1|3634747_3635446_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_000847306.1|3635445_3635775_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_021351599.1|3635771_3638417_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.9	0.0e+00
WP_000532073.1|3638460_3638769_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479061.1|3638795_3639218_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.1	3.7e-71
WP_024748478.1|3639231_3639984_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	2.9e-135
WP_000682716.1|3639991_3640390_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3640402_3641026_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281347.1|3641028_3641310_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_001097065.1|3641302_3641629_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_122993997.1|3641716_3643696_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.8	0.0e+00
WP_000974567.1|3643685_3645188_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_000102415.1|3645187_3645400_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_032312325.1|3645396_3647520_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.9	0.0e+00
WP_000348556.1|3647516_3647993_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	96.8	1.3e-80
WP_012816791.1|3648508_3648694_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3648921_3649068_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3649067_3649637_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3649907_3650441_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3650445_3650661_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|3650738_3650984_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3651024_3651204_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_153021260.1|3651340_3653287_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.5	0.0e+00
WP_001356551.1|3654090_3654243_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|3654491_3654926_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|3655011_3655152_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3655148_3655511_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774504.1|3655507_3655798_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3655790_3655961_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053021.1|3655960_3656416_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072141214.1|3656412_3656514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|3656604_3656886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001481254.1|3656929_3657127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145928.1|3657354_3657639_-	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_000788906.1|3657635_3658337_-	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_001417283.1|3658333_3659263_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.9e-110
WP_001182876.1|3659349_3659889_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000712399.1|3660252_3660945_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001362421.1|3661051_3662659_+	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_023148105.1|3663162_3663453_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995395.1|3663528_3663825_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|3663830_3664616_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|3664612_3665290_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_032195523.1|3665289_3665472_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000548547.1|3665444_3665636_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3665646_3665928_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|3666026_3666248_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|3666244_3667192_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|3667193_3667370_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|3667703_3668060_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|3668056_3668419_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|3668506_3668749_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|3668752_3668887_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|3668905_3669160_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|3669193_3670480_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|3670500_3671202_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
3670518:3670538	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|3671261_3671369_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3671349_3672081_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|3672085_3673012_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 15
NZ_CP040314	Escherichia coli strain MA11 chromosome, complete genome	5460921	3917293	3922680	5460921	integrase	Enterobacteria_phage(50.0%)	6	3907744:3907760	3919708:3919724
3907744:3907760	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3917293_3918226_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3918537_3919695_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3919869_3921006_-	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3919708:3919724	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3921015_3921696_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3921682_3922150_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_001005794.1|3922149_3922680_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
>prophage 16
NZ_CP040314	Escherichia coli strain MA11 chromosome, complete genome	5460921	4167025	4226605	5460921	tail,integrase,tRNA,holin,transposase	Enterobacteria_phage(36.84%)	59	4184473:4184487	4231564:4231578
WP_000997403.1|4167025_4168063_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4168269_4168689_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|4168757_4169456_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|4169487_4172148_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|4172261_4173617_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|4173662_4173986_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|4173982_4175281_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|4181056_4183630_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|4183759_4184491_-	polyphenol oxidase	NA	NA	NA	NA	NA
4184473:4184487	attL	GGACAATCAGCTTAC	NA	NA	NA	NA
WP_000079092.1|4184487_4185468_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|4185602_4186340_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|4186610_4186952_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|4187055_4187103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|4187201_4188362_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|4188404_4189526_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|4189536_4190607_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|4190816_4191182_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|4191331_4191850_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000969012.1|4191839_4193066_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|4193081_4193564_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|4193640_4193988_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|4194029_4194797_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|4194827_4195376_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|4195394_4195643_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|4195779_4197141_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|4197307_4198099_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|4198120_4199407_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|4199461_4200055_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|4200177_4201056_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880924.1|4201141_4202803_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|4202951_4203293_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|4203354_4203645_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|4203634_4204111_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|4204242_4204725_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|4205570_4205819_+	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|4206320_4206911_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|4207093_4207744_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|4207822_4208881_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|4209010_4209433_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|4209593_4209863_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_001303014.1|4209864_4210431_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
WP_000612591.1|4210480_4210828_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4210824_4211205_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731259.1|4211561_4211906_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|4211910_4212126_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|4212275_4214129_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|4214536_4214704_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|4214789_4215533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|4215785_4216409_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|4216405_4217071_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|4217067_4217679_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|4217653_4218220_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001254939.1|4218561_4219317_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001417601.1|4219352_4219655_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_153021261.1|4219730_4221137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|4221532_4221946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|4222043_4222442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000428092.1|4224084_4225398_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|4225399_4226605_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4231564:4231578	attR	GGACAATCAGCTTAC	NA	NA	NA	NA
>prophage 1
NZ_CP040315	Escherichia coli strain MA11 plasmid pO157, complete sequence	95631	8201	60701	95631	transposase,protease,integrase	Macacine_betaherpesvirus(35.71%)	46	NA	NA
WP_001034097.1|8201_12104_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_001171554.1|12339_12720_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|12716_13064_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|13113_14652_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_071525077.1|15950_16130_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|16731_17553_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|17552_18659_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|18748_20470_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|20543_21542_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_072141201.1|22411_25108_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|25194_26070_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|26127_28038_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|28037_29543_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001173152.1|29544_30768_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|30798_31233_+	type II secretion system protein GspG	NA	NA	NA	NA	NA
WP_000082929.1|31229_31784_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_000173396.1|31798_32146_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082782.1|32142_32742_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000776550.1|32738_33716_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_071525076.1|33754_34927_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|34913_35426_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|35483_36317_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|36408_36810_+	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_000839950.1|38700_39216_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000217739.1|39217_42214_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|42263_44384_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|44387_45827_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|45893_46088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|46117_46402_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032195322.1|46570_46810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|46930_47671_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|47955_48933_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|49340_49541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|49537_50158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|50154_50838_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|51296_51515_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|51516_51822_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|51822_52629_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|53305_53386_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_085948178.1|53351_54565_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000852148.1|54640_55396_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|55983_57150_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|57149_58121_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|58729_59632_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|59635_59941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|60017_60701_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
