The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040313	Escherichia coli strain M7638 chromosome, complete genome	5396363	357275	371940	5396363	integrase,tail,tRNA	Enterobacteria_phage(40.0%)	18	358556:358571	376085:376100
WP_000956557.1|357275_357809_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|358226_358508_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
358556:358571	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|358852_359050_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|359385_359670_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|359666_360017_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|360007_360544_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230509.1|361865_362465_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_153038102.1|362529_363843_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|363844_364114_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|364225_364798_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|364870_365500_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|365581_366223_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|366383_366632_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|366693_367791_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|367879_368917_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|369050_369293_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|369458_370442_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|370524_371940_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
376085:376100	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 2
NZ_CP040313	Escherichia coli strain M7638 chromosome, complete genome	5396363	508820	567848	5396363	protease,transposase	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|508820_510080_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|510082_511087_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|511168_511366_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|511469_512768_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|512972_513398_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|513436_515878_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|516058_516790_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|516916_517318_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|517336_518035_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|518085_518745_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|518762_519161_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|519170_519809_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|519811_520975_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|521058_522684_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|522800_523076_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|523224_523554_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|523735_524485_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|524481_525237_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001301921.1|526763_528161_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|528176_528482_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|528491_528956_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|528969_529620_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|529629_530484_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|530483_531170_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|531298_531574_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|531900_532296_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|532302_532617_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|532621_532849_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|532890_533340_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|533410_534205_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|534827_535259_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|535266_536475_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|536609_537248_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|537465_538086_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|538394_539807_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|539851_540514_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|540621_541587_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|541694_542555_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001302935.1|542643_543024_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589488.1|543141_545085_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|545274_546015_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937658.1|546226_547165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175296.1|547227_547782_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|548106_548313_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|548408_549752_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|550074_550713_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|550918_552652_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|552648_556428_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|556430_556772_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|556983_557235_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_000239579.1|557228_557579_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|557658_558189_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|558498_559455_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205805.1|559594_561097_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001301928.1|561110_562133_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|562119_563115_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|563147_564146_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|564321_565695_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|565850_566402_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|566495_567848_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 3
NZ_CP040313	Escherichia coli strain M7638 chromosome, complete genome	5396363	600268	612844	5396363		Enterobacteria_phage(81.82%)	15	NA	NA
WP_000772662.1|600268_601543_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
WP_000936844.1|601710_602016_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001453880.1|602092_602827_+	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000095622.1|602864_604109_-	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_000446132.1|604434_605007_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638634.1|605080_605581_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283021.1|605577_606312_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|606863_607130_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980224.1|607126_607717_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001244670.1|607709_607997_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459287.1|607989_608445_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|608580_608901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783684.1|608915_611249_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_044815386.1|611604_611799_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001301682.1|612016_612844_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	40.4	4.3e-55
>prophage 4
NZ_CP040313	Escherichia coli strain M7638 chromosome, complete genome	5396363	1007595	1089612	5396363	protease,portal,holin,head,transposase,plate,lysis,terminase,integrase,capsid,tail	Shigella_phage(46.55%)	93	1024843:1024857	1090028:1090042
WP_000246433.1|1007595_1008927_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|1008929_1009454_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|1009450_1010731_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|1010755_1011838_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|1011801_1013652_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|1013655_1014069_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|1014159_1015551_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|1015601_1015826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|1015860_1016361_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|1017057_1017576_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103335.1|1017785_1019927_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_153038104.1|1020002_1024226_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000247943.1|1024427_1024691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|1024605_1024791_-	protein YncO	NA	NA	NA	NA	NA
1024843:1024857	attL	AATAACTAAAAAGAT	NA	NA	NA	NA
WP_000027427.1|1024871_1026044_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_001118031.1|1026161_1026932_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|1027085_1027559_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973071.1|1027601_1030046_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284050.1|1030285_1030864_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001301698.1|1030968_1031736_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|1031706_1032447_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001303998.1|1032602_1032863_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729705.1|1032881_1033142_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543891.1|1033327_1034101_+	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_001301901.1|1034918_1036658_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001301640.1|1036617_1037388_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226186.1|1037458_1038514_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554757.1|1038565_1038859_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263495.1|1038861_1039260_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_001059871.1|1039269_1039722_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001303804.1|1040028_1040295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077626217.1|1040227_1040764_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001293009.1|1040820_1042278_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|1042538_1042997_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189536.1|1043088_1044333_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174701.1|1044390_1044792_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|1044830_1045886_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|1046173_1047277_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|1047288_1048542_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_000051887.1|1048746_1049910_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_077769569.1|1049786_1050221_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	98.6	1.0e-76
WP_000206732.1|1050136_1050442_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|1050441_1050804_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008235.1|1050794_1051331_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_000917896.1|1052007_1052304_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_001020634.1|1052581_1053274_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|1053371_1053632_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|1053624_1054176_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|1054351_1054531_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104949.1|1054520_1055462_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_072141203.1|1055458_1055953_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_001303054.1|1055952_1056606_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_000210141.1|1056602_1056929_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_000767113.1|1056925_1057315_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|1057334_1058144_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001360050.1|1058151_1059141_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001008431.1|1059154_1059907_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_000484663.1|1060121_1060661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310393.1|1060804_1061038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449601.1|1061316_1061610_+	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001120501.1|1061746_1062082_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001197766.1|1062085_1062562_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001228695.1|1062778_1062961_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|1063051_1063345_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_085948178.1|1064043_1065257_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000929175.1|1065659_1066154_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_128484532.1|1066387_1067884_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000923141.1|1068031_1069258_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000999805.1|1069250_1069853_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000766100.1|1069863_1071093_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000924828.1|1071171_1071495_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000702395.1|1071491_1071902_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000224836.1|1071876_1072383_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000779288.1|1072379_1072940_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000497751.1|1072948_1073119_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155728.1|1073102_1074599_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000090993.1|1074598_1074955_+	hypothetical protein	NA	U5P076	Shigella_phage	99.2	1.2e-62
WP_000661054.1|1074954_1075224_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000807197.1|1075365_1077201_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000219910.1|1077261_1078590_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000999513.1|1078586_1079666_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_001259066.1|1079665_1080214_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000424732.1|1080213_1080639_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785302.1|1080625_1081684_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000383550.1|1081674_1082259_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_032195359.1|1082529_1082925_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	4.8e-65
WP_001008234.1|1082945_1083389_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_000368084.1|1083360_1083963_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001145352.1|1083962_1084481_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.0	1.2e-55
WP_000905124.1|1084511_1085066_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_000355484.1|1085126_1085900_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000246059.1|1086724_1087468_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001130487.1|1088430_1089612_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
1090028:1090042	attR	AATAACTAAAAAGAT	NA	NA	NA	NA
>prophage 5
NZ_CP040313	Escherichia coli strain M7638 chromosome, complete genome	5396363	1668551	1706646	5396363	protease,portal,holin,lysis,terminase,integrase,tail	Enterobacteria_phage(51.22%)	48	1657993:1658007	1690282:1690296
1657993:1658007	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_024219169.1|1668551_1669433_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
WP_001303849.1|1669595_1669814_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|1669853_1670021_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|1670263_1670866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|1671076_1671298_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|1671396_1671678_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|1671688_1671880_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|1671852_1672035_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|1672031_1672712_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|1673409_1673592_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|1673588_1673759_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|1673751_1674372_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028857.1|1674368_1675034_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_000750155.1|1675245_1676205_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|1676542_1676665_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|1676679_1677369_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|1677552_1678296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1678381_1678540_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_012578864.1|1678620_1679019_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|1679161_1679377_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|1679376_1679874_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|1679870_1680338_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|1680325_1680478_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000934137.1|1681642_1683745_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001072975.1|1683741_1683954_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|1683881_1685006_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|1685127_1685463_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136598.1|1685407_1687435_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_001097050.1|1687521_1687845_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|1687837_1688113_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|1688124_1688703_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|1688699_1689101_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|1689111_1689855_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|1689915_1690302_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
1690282:1690296	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|1690310_1690640_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|1690611_1693677_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|1693676_1694006_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|1694015_1694714_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|1694719_1695463_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001508920.1|1695399_1696008_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	93.6	7.1e-100
WP_001233141.1|1699552_1700152_+	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|1700211_1701528_+|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|1701529_1701799_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|1701975_1702956_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|1702989_1704009_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|1704505_1704667_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|1704835_1705717_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|1705947_1706646_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 6
NZ_CP040313	Escherichia coli strain M7638 chromosome, complete genome	5396363	1923354	1992919	5396363	protease,portal,holin,head,transposase,integrase,tail	Escherichia_phage(26.67%)	79	1931842:1931857	1953208:1953223
WP_000156526.1|1923354_1925115_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1925300_1925753_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_024238687.1|1925828_1926869_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1927225_1927735_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1927953_1928583_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1928545_1930708_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1930717_1931164_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1931286_1933341_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1931842:1931857	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1933372_1933831_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1933926_1934589_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1934761_1935175_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1935219_1935537_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1935594_1936785_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1936879_1937158_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1937154_1937484_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1937574_1938234_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1938641_1939661_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1939638_1939881_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1939948_1942420_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1942513_1942705_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1942701_1942890_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1943463_1943649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1943835_1944225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1944366_1944522_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1944799_1945087_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1945086_1945278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1945305_1945707_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1945815_1946088_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1946071_1946497_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1946703_1947159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1947237_1948329_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1948335_1949082_+	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1949103_1949874_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1949889_1950303_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1950654_1951428_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1951793_1951931_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|1951975_1952188_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|1952355_1952634_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1952635_1953685_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1953208:1953223	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1953697_1954069_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1954058_1954430_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1954581_1955400_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|1955686_1955926_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|1956020_1956734_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1957500_1959351_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_085948178.1|1959526_1960739_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303878.1|1960944_1961259_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1961786_1961972_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1962193_1962307_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1962527_1963061_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1963220_1963493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1963748_1963955_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1964705_1964981_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1965056_1965437_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1965433_1965781_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1965830_1967369_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|1967418_1967661_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000259002.1|1969545_1969752_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_087497989.1|1969748_1971341_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.3	5.7e-181
WP_001254002.1|1971330_1972836_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1972872_1973220_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1973277_1973544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|1973525_1974266_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1974279_1974711_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1974737_1975151_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082473.1|1975131_1977711_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847298.1|1977707_1978037_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302968.1|1978036_1978735_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_001356665.1|1978745_1979489_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	100.0	3.7e-151
WP_050546863.1|1979434_1980067_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649827.1|1980257_1980785_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_000515109.1|1980918_1984392_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_001230444.1|1984459_1985059_+	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268855.1|1985123_1986437_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001023407.1|1986438_1986708_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001301613.1|1988700_1989819_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1989815_1991609_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1991627_1992335_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1992331_1992919_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP040313	Escherichia coli strain M7638 chromosome, complete genome	5396363	2243908	2341971	5396363	protease,portal,holin,head,transposase,plate,terminase,integrase,capsid,tail	Shigella_phage(25.0%)	131	2248305:2248319	2342094:2342108
WP_000952736.1|2243908_2244730_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|2244885_2245932_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|2245928_2246723_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|2246889_2248008_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|2247976_2248246_-	excisionase	NA	NA	NA	NA	NA
2248305:2248319	attL	ACATTAAAAATCAGC	NA	NA	NA	NA
WP_077699040.1|2248307_2248697_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|2248829_2249345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|2249459_2249612_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|2249927_2250404_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2250528_2250852_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693962.1|2250835_2251261_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|2251329_2252367_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_001301518.1|2252398_2252821_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_000451012.1|2252854_2253571_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_000017339.1|2253567_2253885_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|2253881_2254184_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|2254173_2254491_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|2254444_2254762_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|2254748_2255186_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|2255187_2255379_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|2255381_2255969_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|2256084_2256189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2256377_2256590_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|2256757_2257036_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265159.1|2257037_2258087_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001217410.1|2258099_2258474_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|2258470_2259292_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|2259888_2260056_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023167.1|2260370_2262308_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|2262455_2262638_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|2262675_2262945_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|2263020_2263236_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|2263240_2263585_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2263635_2264169_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2264439_2265009_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2265008_2265155_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|2265382_2265589_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2265653_2265878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2266234_2266375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|2266504_2266690_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279796.1|2266731_2267097_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_153038106.1|2267388_2267916_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	98.3	5.4e-80
WP_000356295.1|2268270_2268882_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001266279.1|2269038_2269305_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	46.0	1.4e-07
WP_087497971.1|2269315_2271406_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	44.9	4.4e-165
WP_000129790.1|2271476_2272409_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000268103.1|2272411_2272633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|2272645_2272900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|2272901_2273183_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|2273179_2273452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049306.1|2273456_2273750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|2273761_2274292_+	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323222.1|2274389_2274932_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_000564281.1|2274935_2275469_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	6.9e-67
WP_000465562.1|2275468_2275984_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000973023.1|2275987_2276539_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000633440.1|2276535_2276847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|2276861_2277212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310453.1|2277227_2277560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|2277552_2277750_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000378480.1|2277739_2278036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214366.1|2278032_2278542_+	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000852377.1|2278611_2279037_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|2279108_2279609_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|2279643_2280072_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|2280055_2280274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342747.1|2280283_2280511_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|2280491_2280800_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279082.1|2280796_2281087_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000360581.1|2281089_2281671_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057665.1|2281670_2283335_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000532592.1|2283334_2284924_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_000046901.1|2284907_2286239_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000094808.1|2286360_2286834_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000850822.1|2287010_2288135_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.9	2.9e-78
WP_001142982.1|2288134_2289082_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002060.1|2289125_2289494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|2289490_2289910_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|2289906_2290467_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|2290467_2290713_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|2290709_2292212_+|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|2292220_2292586_+|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|2292600_2293077_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113525.1|2293203_2295279_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000146116.1|2295265_2296615_+	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|2296598_2297723_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|2297712_2298327_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|2298319_2298757_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|2298756_2299839_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_087497970.1|2299829_2300390_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.6	3.0e-44
WP_000469162.1|2300389_2301301_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|2301335_2301857_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|2301936_2302140_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|2302361_2302922_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_087497969.1|2303021_2305061_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	7.3e-274
WP_000144787.1|2305207_2305390_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|2305425_2305671_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|2305709_2306174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|2306288_2306489_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|2306442_2307180_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001301491.1|2307357_2309019_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2309082_2311020_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2311064_2311286_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2311231_2313733_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2313812_2314139_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2314148_2314499_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2314495_2314942_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2314938_2315283_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2315341_2316058_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2316072_2316447_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2316542_2316752_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2316799_2320042_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2320034_2320376_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|2320375_2321074_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|2321090_2321345_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|2321454_2321565_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2321867_2322746_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|2322799_2323537_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|2323482_2323719_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2323731_2323821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2323840_2326189_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2326779_2330181_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|2332284_2332410_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|2332489_2332765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2332825_2334187_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|2334550_2335414_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2335397_2336534_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2336783_2338010_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2338058_2339180_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_085952403.1|2339541_2340755_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_032174463.1|2340753_2341971_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
2342094:2342108	attR	GCTGATTTTTAATGT	NA	NA	NA	NA
>prophage 8
NZ_CP040313	Escherichia coli strain M7638 chromosome, complete genome	5396363	2348063	2441567	5396363	protease,tRNA,portal,holin,head,transposase,lysis,terminase,integrase,capsid,tail	Enterobacteria_phage(49.09%)	101	2349228:2349243	2377482:2377497
WP_000907465.1|2348063_2349119_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|2349131_2349467_+|head	head decoration protein	head	NA	NA	NA	NA
2349228:2349243	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|2349479_2349893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2350098_2350641_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|2350896_2351178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2351778_2353239_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2353238_2353910_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2354078_2355449_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2355452_2356094_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2356129_2357236_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2357289_2357751_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2357760_2358414_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2358585_2359836_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2359949_2361092_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088657.1|2361081_2361318_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|2361421_2362246_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|2362242_2362944_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2362940_2363243_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2363310_2363643_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2363707_2363830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|2363887_2365414_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|2365915_2366371_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2366370_2366541_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2366533_2366824_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2366820_2367183_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2367179_2367320_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2367316_2368006_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|2368327_2368633_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2368619_2369096_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2369312_2369495_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2369585_2369879_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|2370170_2370581_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2370866_2371073_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2371237_2371432_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2371820_2372366_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_024748455.1|2372340_2374266_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000198153.1|2374262_2374469_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2374465_2376067_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2376047_2377367_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2377376_2377709_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
2377482:2377497	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063233.1|2377763_2378789_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_000158906.1|2378830_2379229_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2379240_2379594_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|2379605_2380184_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|2380180_2380576_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|2380583_2381324_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2381339_2381762_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2381743_2382178_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001509030.1|2382170_2384720_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.2	0.0e+00
WP_000847331.1|2384716_2385046_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2385045_2385744_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|2385749_2386493_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|2386429_2387062_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|2387122_2390521_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|2390587_2391187_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|2391251_2394167_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|2394166_2394748_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|2394867_2395758_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2395776_2396283_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2396319_2396820_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2396898_2397081_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|2397578_2398247_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|2398303_2398552_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|2398627_2399008_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2399004_2399352_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2399401_2400940_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|2401242_2402727_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2402913_2403867_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|2404365_2404950_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001185665.1|2406181_2406448_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000101055.1|2406451_2407264_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000072536.1|2407287_2407983_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_001056834.1|2408502_2408871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|2408973_2409375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000874954.1|2409445_2409604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295992.1|2409615_2409909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284277.1|2409980_2410640_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000807626.1|2410716_2411178_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001304191.1|2411384_2412296_-	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000897378.1|2412668_2413088_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457644.1|2413087_2414356_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000943459.1|2414401_2414932_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000406391.1|2415077_2416619_-	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000234823.1|2416840_2417560_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000190855.1|2417611_2419144_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_000197859.1|2420626_2421697_+	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_085949318.1|2422034_2423247_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_064717263.1|2423213_2423303_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.7e-07
WP_000340206.1|2423405_2425142_-	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000051572.1|2425237_2426152_-	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_001295616.1|2426251_2426863_+	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_001310261.1|2427569_2429489_+	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_001303183.1|2429588_2432474_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000505866.1|2433317_2434409_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000152933.1|2434525_2435110_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000823885.1|2435387_2435666_+	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_001033352.1|2435720_2437400_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|2437524_2438472_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001260332.1|2438622_2439474_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001130692.1|2439473_2440097_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001299679.1|2440310_2441567_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP040313	Escherichia coli strain M7638 chromosome, complete genome	5396363	2488263	2556076	5396363	protease,holin,head,transposase,terminase,integrase,capsid,tail	Stx2-converting_phage(39.58%)	72	2488100:2488127	2540548:2540575
2488100:2488127	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|2488263_2489394_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2489371_2489620_-	excisionase	NA	NA	NA	NA	NA
WP_000048549.1|2489684_2492156_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_001090200.1|2492248_2492440_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2492436_2492625_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2493022_2493190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2493183_2493417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2493394_2493802_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2493824_2494043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2494115_2494415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2494678_2495086_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2495162_2495390_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2495373_2495925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2495896_2496937_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_001302276.1|2496968_2497391_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000774808.1|2497577_2498159_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|2498155_2498320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2499018_2499777_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2500055_2500268_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|2500488_2500746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2500815_2501094_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2501095_2502142_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2502154_2502514_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2502522_2503053_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2503294_2503492_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|2503642_2504701_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_153038107.1|2505497_2507348_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_000411805.1|2507796_2508003_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|2508007_2508352_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2508402_2508936_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2509206_2509776_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2509775_2509922_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2510149_2510335_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2510759_2510987_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2511028_2511394_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000958387.1|2511683_2512247_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2512243_2513905_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2513968_2515906_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2515950_2516172_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000126019.1|2518697_2519024_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2519033_2519384_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2519380_2519827_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2519823_2520168_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2520226_2520943_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2520948_2521323_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2521418_2521628_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2521680_2524923_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2524915_2525257_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2525256_2525955_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_024748465.1|2525965_2526709_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	6.6e-148
WP_129137391.1|2526654_2527287_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_024748464.1|2527533_2531013_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.1	0.0e+00
WP_001230495.1|2531079_2531679_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	3.7e-109
WP_024748463.1|2531743_2533057_+|tail	tail fiber protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	6.5e-82
WP_001023426.1|2533058_2533328_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_085952403.1|2534976_2536190_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001079499.1|2540725_2541232_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2540548:2540575	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|2541277_2541778_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2541863_2542043_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2542423_2543230_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2543229_2544423_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001416116.1|2544434_2545793_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	7.3e-36
WP_000763503.1|2545796_2547392_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|2547391_2548954_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2549045_2549090_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2549227_2550109_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2550105_2550726_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2550753_2552337_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2552549_2553422_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2553461_2554052_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2554048_2554807_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2555026_2556076_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 10
NZ_CP040313	Escherichia coli strain M7638 chromosome, complete genome	5396363	2828704	2880999	5396363	portal,holin,head,transposase,terminase,integrase,capsid,tail	Escherichia_phage(38.33%)	68	2856292:2856307	2883783:2883798
WP_000214712.1|2828704_2828908_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2828943_2830404_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2830492_2831776_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|2831835_2832150_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2832311_2832953_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2833034_2833664_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2833736_2834312_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2834425_2834695_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_137049508.1|2834696_2836010_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.9	4.5e-83
WP_001230508.1|2836074_2836674_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_137049505.1|2836741_2840152_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_050546863.1|2840455_2841088_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_024748514.1|2841033_2841777_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_024748502.1|2841787_2842486_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	7.6e-130
WP_000847298.1|2842485_2842815_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081804.1|2842811_2845424_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000533440.1|2845404_2845818_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2845844_2846267_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2846280_2847033_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2847040_2847436_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2847432_2847966_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2847980_2848334_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2848345_2848744_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_024748468.1|2848785_2849811_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	9.6e-190
WP_001295978.1|2849866_2850199_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2850208_2851528_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2851508_2853110_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2853106_2853313_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024748469.1|2853309_2855235_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
WP_000867498.1|2855209_2855755_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2856141_2856366_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
2856292:2856307	attL	AATGAAAAATATTCTC	NA	NA	NA	NA
WP_001302717.1|2856447_2856762_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2857287_2857473_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|2857695_2857842_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|2857841_2858411_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2858681_2859215_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2859265_2859610_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|2859614_2859821_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023184.1|2860269_2862120_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|2862597_2863029_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2863479_2864193_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2864328_2864526_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2864750_2865305_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2865367_2865673_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2865685_2866735_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|2866736_2867009_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|2867130_2867475_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2867594_2867807_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2868040_2868598_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2868599_2868818_-	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2868945_2869257_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2869249_2869477_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2869473_2869755_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2869787_2870504_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_001379651.1|2870537_2870960_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_001262402.1|2870991_2872035_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|2872103_2872529_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2872512_2872755_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2873146_2873485_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2873777_2873930_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2873941_2874580_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2874580_2874790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|2875354_2875543_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|2875539_2875728_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_087497992.1|2875820_2877557_+	exodeoxyribonuclease VIII	NA	V5UQJ3	Shigella_phage	61.6	4.6e-176
WP_085948178.1|2877559_2878773_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000113189.1|2879642_2879891_+	excisionase	NA	NA	NA	NA	NA
WP_001500821.1|2879868_2880999_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	50.9	4.9e-102
2883783:2883798	attR	AATGAAAAATATTCTC	NA	NA	NA	NA
>prophage 11
NZ_CP040313	Escherichia coli strain M7638 chromosome, complete genome	5396363	2887979	2931564	5396363	portal,holin,head,transposase,terminase,capsid,tail	Stx2-converting_phage(45.45%)	46	NA	NA
WP_000998048.1|2887979_2889518_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001025672.1|2892182_2893508_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2894534_2894804_-|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_024748516.1|2894805_2896119_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
WP_001228304.1|2896270_2896870_-	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|2896937_2899283_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|2899234_2900410_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2900752_2901385_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_046671488.1|2901330_2902074_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_001303038.1|2902084_2902783_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_000807954.1|2902782_2903124_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261924.1|2903116_2906359_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|2906411_2906621_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2906716_2907091_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2907096_2907813_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2907871_2908216_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2908212_2908659_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2908655_2909006_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2909014_2909341_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2909420_2911922_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2911867_2912089_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|2912133_2914071_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2914134_2915796_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|2915792_2916356_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_015994246.1|2916644_2917010_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|2917051_2917279_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2917703_2917889_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2918116_2918263_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2918262_2918832_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2919102_2919636_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2919686_2920031_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|2920035_2920242_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_024748470.1|2920690_2922541_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_001303509.1|2923019_2923448_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2924084_2924774_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2924770_2925130_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|2925142_2926192_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|2926193_2926472_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2926639_2926852_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2927040_2927145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2927260_2927845_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2927901_2928297_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788936.1|2929107_2929848_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_000095670.1|2929854_2930817_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000693943.1|2930839_2931265_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2931261_2931564_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 12
NZ_CP040313	Escherichia coli strain M7638 chromosome, complete genome	5396363	3245132	3296254	5396363	transposase,tail,integrase,tRNA	Enterobacteria_phage(63.33%)	59	3238356:3238371	3296333:3296348
3238356:3238371	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|3245132_3246866_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|3247042_3247531_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|3247650_3248043_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|3248042_3250121_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|3250113_3251262_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|3251463_3252108_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3252118_3252508_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|3252522_3253572_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|3253574_3254435_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|3254453_3256055_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|3256100_3257762_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|3257904_3258408_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|3258428_3260393_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3260397_3261324_-	motility protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|3261320_3262208_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3262334_3262913_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|3262915_3263266_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|3264045_3264474_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|3264480_3265905_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|3265879_3266680_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|3266846_3267833_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|3267847_3269362_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|3269431_3270421_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|3271217_3271721_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|3271800_3272052_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3272166_3272253_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|3272514_3272838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3273008_3273506_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|3273542_3273782_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|3273973_3275185_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|3275246_3275912_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001303019.1|3276268_3277270_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
WP_000865208.1|3277275_3277623_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|3277652_3278303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|3278318_3278723_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|3278812_3278950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3279021_3279225_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3279246_3279597_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|3279607_3279886_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|3279897_3280140_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|3280136_3280250_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|3280342_3280759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3280782_3280986_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|3280982_3281249_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|3281245_3281545_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000775057.1|3281867_3282098_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000599379.1|3282170_3282536_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|3282542_3285365_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|3285441_3286401_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|3286405_3286720_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|3287925_3288342_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|3288385_3288958_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|3289114_3289603_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000763327.1|3292405_3292534_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|3292569_3292935_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|3292989_3293502_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|3293501_3294686_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|3294843_3295167_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|3295117_3296254_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3296333:3296348	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 13
NZ_CP040313	Escherichia coli strain M7638 chromosome, complete genome	5396363	3353838	3426077	5396363	portal,holin,head,transposase,terminase,integrase,tail	Enterobacteria_phage(31.11%)	69	3369490:3369505	3426557:3426572
WP_001023396.1|3353838_3354108_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000268854.1|3354109_3355279_-	hypothetical protein	NA	B6DZB7	Enterobacteria_phage	96.9	1.1e-83
WP_001230509.1|3355343_3355943_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_137049505.1|3356010_3359421_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_050546863.1|3359724_3360357_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_024748514.1|3360302_3361046_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_024748502.1|3361056_3361755_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	7.6e-130
WP_000847298.1|3361754_3362084_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|3362080_3364660_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3364640_3365054_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3365080_3365512_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3365525_3366266_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3366247_3366514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3366571_3366919_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3366955_3368461_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3368450_3370043_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
3369490:3369505	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|3370039_3370246_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|3372130_3372640_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|3373034_3373259_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|3373340_3373655_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3374181_3374367_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|3374594_3374726_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|3374738_3374921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|3375076_3375610_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|3375660_3376005_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000411809.1|3376009_3376216_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_085948178.1|3376535_3377748_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000023257.1|3377830_3379681_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001059369.1|3381220_3381910_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|3381906_3382266_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|3382278_3383328_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|3383329_3383608_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|3383775_3383988_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|3384174_3384279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|3384388_3384952_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|3385078_3385390_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|3385386_3385539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|3385571_3385928_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|3385924_3386149_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|3386170_3386869_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000373320.1|3386903_3387326_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_153038110.1|3387357_3388395_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	67.9	9.0e-87
WP_000693816.1|3388463_3388889_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|3388885_3389113_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|3389210_3389855_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|3390129_3390282_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|3390762_3390951_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|3390947_3391136_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|3391231_3393703_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|3393761_3393965_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001509205.1|3393964_3394999_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.1	7.8e-99
WP_001302302.1|3395209_3396007_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_014714124.1|3396496_3404479_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_000480501.1|3404740_3405793_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|3406106_3407423_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|3407524_3408979_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|3409321_3410038_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|3410663_3412307_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|3412424_3413375_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|3413476_3414394_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|3414850_3415786_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|3415847_3416927_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|3416938_3417682_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|3417678_3418224_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|3418585_3418966_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3418962_3419310_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3419359_3420898_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001509211.1|3422345_3424493_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_085952406.1|3424864_3426077_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.3	1.8e-163
3426557:3426572	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 14
NZ_CP040313	Escherichia coli strain M7638 chromosome, complete genome	5396363	3524091	3626349	5396363	protease,tRNA,portal,holin,transposase,terminase,integrase,tail	Enterobacteria_phage(50.0%)	111	3578905:3578925	3623855:3623875
WP_000476014.1|3524091_3525453_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|3525782_3526100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|3526505_3527405_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|3527486_3528266_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|3528365_3529406_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490697.1|3529453_3530809_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|3530812_3531097_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|3531127_3531580_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853846.1|3531589_3532852_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001301486.1|3532880_3533735_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|3534033_3535086_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_024177454.1|3535342_3536620_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|3536616_3537621_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|3537617_3538583_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|3538556_3539303_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301907.1|3539354_3540173_-	glycosyl hydrolase 25 family protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000822268.1|3540237_3541038_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|3541034_3541823_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|3542156_3542396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|3543446_3543794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|3543803_3544118_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|3544227_3544500_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134629.1|3544620_3545472_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153070.1|3545689_3546028_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|3546109_3547144_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000945390.1|3547154_3549635_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677409.1|3549650_3550325_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000682830.1|3550412_3550955_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|3551246_3551528_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|3551789_3552899_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001301615.1|3553030_3555064_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001411921.1|3559026_3560307_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_085948178.1|3564604_3565817_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000636932.1|3567024_3567342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|3568582_3569671_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|3569681_3571211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|3571229_3571961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|3571953_3573090_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|3573086_3575090_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|3575214_3575676_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3575717_3576188_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3576234_3576954_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|3576950_3578636_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
3578905:3578925	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261939.1|3579150_3579399_+	DNA damage-inducible protein DinI	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001143784.1|3579560_3580202_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_072142879.1|3580283_3580700_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001023396.1|3580860_3581130_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_088136427.1|3581131_3582301_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001230509.1|3582365_3582965_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_024748476.1|3583032_3586512_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_071601640.1|3586752_3587382_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_000194801.1|3587327_3588071_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|3588081_3588780_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3588779_3589109_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_046671471.1|3589105_3591751_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
WP_000532073.1|3591794_3592103_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|3592129_3592552_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_024748478.1|3592565_3593318_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	2.9e-135
WP_000682716.1|3593325_3593724_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3593736_3594360_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|3594362_3594644_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|3594636_3594963_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114421.1|3595050_3597075_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974568.1|3597019_3598522_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_000102415.1|3598521_3598734_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077626.1|3598730_3600854_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000348565.1|3600850_3601327_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|3601844_3602030_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3602257_3602404_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3602403_3602973_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3603243_3603777_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3603781_3603997_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|3604074_3604320_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3604360_3604540_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142932.1|3604677_3606624_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_001356551.1|3607427_3607580_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|3607828_3608263_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|3608348_3608489_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3608485_3608848_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774504.1|3608844_3609135_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3609127_3609298_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053021.1|3609297_3609753_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072141214.1|3609749_3609851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|3609941_3610223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001481254.1|3610266_3610464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145928.1|3610691_3610976_-	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_000788906.1|3610972_3611674_-	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_001417283.1|3611670_3612600_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.9e-110
WP_001182876.1|3612686_3613226_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000712399.1|3613589_3614282_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001362421.1|3614388_3615996_+	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_023148105.1|3616499_3616790_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995395.1|3616865_3617162_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|3617167_3617953_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|3617949_3618627_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_032195523.1|3618626_3618809_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000548547.1|3618781_3618973_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3618983_3619265_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|3619363_3619585_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|3619581_3620529_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|3620530_3620707_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|3621040_3621397_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|3621393_3621756_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|3621843_3622086_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|3622089_3622224_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|3622242_3622497_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|3622530_3623817_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|3623837_3624539_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
3623855:3623875	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|3624598_3624706_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3624686_3625418_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|3625422_3626349_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 15
NZ_CP040313	Escherichia coli strain M7638 chromosome, complete genome	5396363	3870630	3876017	5396363	integrase	Enterobacteria_phage(50.0%)	6	3861081:3861097	3873045:3873061
3861081:3861097	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3870630_3871563_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3871874_3873032_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3873206_3874343_-	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3873045:3873061	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3874352_3875033_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3875019_3875487_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_001005794.1|3875486_3876017_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
>prophage 16
NZ_CP040313	Escherichia coli strain M7638 chromosome, complete genome	5396363	4117735	4177255	5396363	tRNA,holin,transposase,integrase,tail	Enterobacteria_phage(31.58%)	59	4135183:4135197	4182214:4182228
WP_000997403.1|4117735_4118773_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4118979_4119399_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|4119467_4120166_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|4120197_4122858_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|4122971_4124327_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|4124372_4124696_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|4124692_4125991_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|4131766_4134340_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|4134469_4135201_-	polyphenol oxidase	NA	NA	NA	NA	NA
4135183:4135197	attL	GGACAATCAGCTTAC	NA	NA	NA	NA
WP_000079092.1|4135197_4136178_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|4136312_4137050_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|4137320_4137662_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|4137765_4137813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|4137911_4139072_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|4139114_4140236_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|4140246_4141317_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|4141526_4141892_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|4142041_4142560_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000969012.1|4142549_4143776_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|4143791_4144274_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|4144350_4144698_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|4144739_4145507_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|4145537_4146086_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|4146104_4146353_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|4146489_4147851_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|4148017_4148809_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|4148830_4150117_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|4150171_4150765_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|4150887_4151766_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880924.1|4151851_4153513_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|4153661_4154003_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|4154064_4154355_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|4154344_4154821_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|4154952_4155435_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|4156280_4156529_+	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|4157030_4157621_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|4157803_4158454_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|4158532_4159591_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|4159720_4160143_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|4160303_4160573_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_001303014.1|4160574_4161141_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
WP_000612591.1|4161190_4161538_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4161534_4161915_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|4162271_4162616_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|4162620_4162836_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143065.1|4162985_4164839_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|4165246_4165414_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|4165499_4166243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|4166495_4167119_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|4167115_4167781_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|4167777_4168389_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|4168363_4168930_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001254939.1|4169271_4170027_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001417601.1|4170062_4170365_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_153038112.1|4170440_4171787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|4172182_4172596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|4172693_4173092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000428092.1|4174734_4176048_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|4176049_4177255_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4182214:4182228	attR	GGACAATCAGCTTAC	NA	NA	NA	NA
