The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040311	Escherichia coli strain F3398 chromosome, complete genome	5381728	357264	371929	5381728	tRNA,tail,integrase	Enterobacteria_phage(40.0%)	18	358545:358560	376074:376089
WP_000956557.1|357264_357798_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|358215_358497_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
358545:358560	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|358841_359039_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|359374_359659_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|359655_360006_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|359996_360533_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|361854_362454_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268962.1|362518_363832_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001023355.1|363833_364103_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|364214_364787_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|364859_365489_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|365570_366212_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|366372_366621_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|366682_367780_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|367868_368906_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|369039_369282_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|369447_370431_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|370513_371929_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
376074:376089	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 2
NZ_CP040311	Escherichia coli strain F3398 chromosome, complete genome	5381728	508809	567820	5381728	protease,transposase	Pectobacterium_phage(12.5%)	60	NA	NA
WP_000312488.1|508809_510069_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|510071_511076_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|511157_511355_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|511458_512757_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|512961_513387_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|513425_515867_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|516047_516779_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|516905_517307_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|517325_518024_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|518074_518734_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|518751_519150_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|519159_519798_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|519800_520964_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|521047_522673_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|522789_523065_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|523213_523543_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|523724_524474_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|524470_525226_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|525333_526398_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001301921.1|526752_528150_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|528165_528471_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|528480_528945_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|528958_529609_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949515.1|529618_530473_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|530472_531159_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|531287_531563_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|531889_532285_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|532291_532606_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|532610_532838_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|532879_533329_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|533399_534194_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|534816_535248_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|535255_536464_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|536598_537237_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|537454_538075_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|538383_539796_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|539840_540503_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|540610_541576_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|541683_542544_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|542632_543013_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589487.1|543130_545074_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|545263_546004_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937659.1|546215_547154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175287.1|547216_547771_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|548095_548302_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|548380_549724_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|550046_550685_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|550890_552624_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|552620_556400_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|556402_556744_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|556955_557207_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_000239579.1|557200_557551_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|557630_558161_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|558470_559427_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001301928.1|561082_562105_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|562091_563087_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|563119_564118_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|564293_565667_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|565822_566374_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|566467_567820_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 3
NZ_CP040311	Escherichia coli strain F3398 chromosome, complete genome	5381728	969521	1033856	5381728	tRNA,plate,transposase	uncultured_Caudovirales_phage(40.0%)	53	NA	NA
WP_000176537.1|969521_970817_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|970869_971130_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|971116_971317_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|971482_972028_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|972024_972435_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|972448_973159_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|973358_974183_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|974235_975954_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|976064_976772_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|976768_977173_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|977290_978106_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|978145_978799_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|978791_979823_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|980010_980586_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|986345_987149_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|987145_988060_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|988300_989101_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|989178_989949_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|989996_991355_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|991426_992182_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|992215_992938_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|992934_993402_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|993466_994198_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001086136.1|994735_995536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|996013_996463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|996465_997062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|997140_997362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|997382_997862_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|997827_999237_-	membrane protein	NA	NA	NA	NA	NA
WP_001303798.1|999247_1002682_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|1002818_1004231_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|1004235_1004979_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614373.1|1004975_1007741_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.6	4.7e-82
WP_000343292.1|1007749_1008511_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246434.1|1008515_1009847_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|1009849_1010374_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|1010370_1011651_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|1011675_1012758_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|1012721_1014572_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|1014575_1014989_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|1015079_1016471_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|1016521_1016746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|1016780_1017281_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|1017977_1018496_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103125.1|1018705_1020847_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_000509129.1|1020922_1025155_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000339420.1|1026193_1027702_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_153023040.1|1027770_1028394_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000420853.1|1029138_1030275_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001145876.1|1030277_1032038_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000247943.1|1032239_1032503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|1032417_1032603_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|1032683_1033856_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP040311	Escherichia coli strain F3398 chromosome, complete genome	5381728	1052642	1069794	5381728	tail,transposase,integrase	Escherichia_phage(35.29%)	18	1059250:1059263	1075155:1075168
WP_000749881.1|1052642_1053698_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|1053985_1055089_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|1055100_1056354_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001303805.1|1057423_1057669_-	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_085948178.1|1057995_1059209_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_062946174.1|1059234_1059618_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	35.3	2.9e-06
1059250:1059263	attL	TCCGGGGCGGTTCA	NA	NA	NA	NA
WP_001274756.1|1059745_1060459_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000437875.1|1060559_1060760_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|1060878_1061172_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000788819.1|1062123_1062435_+	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_001096963.1|1062434_1063229_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	92.9	2.8e-80
WP_000805544.1|1063228_1063822_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|1063793_1064237_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_001115553.1|1064257_1064668_-|tail	tail fiber protein	tail	A0A0F7LBW5	Escherichia_phage	97.6	2.2e-65
WP_000904979.1|1064697_1065252_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000355475.1|1065309_1066083_-	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000246059.1|1066906_1067650_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001130487.1|1068612_1069794_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
1075155:1075168	attR	TGAACCGCCCCGGA	NA	NA	NA	NA
>prophage 5
NZ_CP040311	Escherichia coli strain F3398 chromosome, complete genome	5381728	1644801	1684215	5381728	holin,transposase,protease,terminase,lysis,portal,tail,integrase	Enterobacteria_phage(47.73%)	51	1634243:1634257	1666537:1666551
1634243:1634257	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_000533643.1|1644801_1645872_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|1645849_1646068_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|1646107_1646275_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|1646517_1647120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|1647330_1647552_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|1647650_1647932_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|1647942_1648134_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|1648106_1648289_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|1648285_1648966_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|1649663_1649846_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|1649842_1650013_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|1650005_1650626_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028854.1|1650622_1651288_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_000750155.1|1651499_1652459_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|1652796_1652919_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|1652933_1653623_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|1653806_1654550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1654635_1654794_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_012578864.1|1654874_1655273_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|1655415_1655631_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|1655630_1656128_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|1656124_1656592_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|1656579_1656732_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000349509.1|1657406_1657898_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_000934096.1|1657897_1660000_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_001072975.1|1659996_1660209_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|1660136_1661261_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|1661382_1661718_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_001136597.1|1661662_1663690_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_001097050.1|1663776_1664100_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|1664092_1664368_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|1664379_1664958_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|1664954_1665356_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|1665366_1666110_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|1666170_1666557_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
1666537:1666551	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|1666565_1666895_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|1666866_1669932_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|1669931_1670261_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|1670270_1670969_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|1670974_1671718_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|1671654_1672263_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000515426.1|1672323_1675737_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_001233141.1|1675807_1676407_+	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741889.1|1676466_1677783_+|tail	tail fiber protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_085948178.1|1677885_1679099_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_153023041.1|1679097_1679319_+	hypothetical protein	NA	A0A1I9LJT0	Stx_converting_phage	98.1	4.8e-22
WP_000950813.1|1679543_1680524_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|1680557_1681577_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|1682073_1682235_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951025.1|1682404_1683286_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_001247925.1|1683516_1684215_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 6
NZ_CP040311	Escherichia coli strain F3398 chromosome, complete genome	5381728	1900923	1972062	5381728	holin,transposase,protease,head,portal,tail	Escherichia_phage(26.67%)	79	NA	NA
WP_000156526.1|1900923_1902684_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1902869_1903322_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1903396_1904437_-	porin OmpA	NA	NA	NA	NA	NA
WP_062946185.1|1904793_1905303_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1905521_1906151_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1906113_1908276_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1908285_1908732_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1908854_1910909_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
WP_000424181.1|1910940_1911399_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1911494_1912157_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1912329_1912743_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1912787_1913105_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1913162_1914353_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1914447_1914726_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1914722_1915052_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1915142_1915802_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_000273151.1|1917193_1917436_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1917503_1919975_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1920068_1920260_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1920256_1920445_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1921018_1921204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1921390_1921780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1921921_1922077_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1922354_1922642_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1922641_1922833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1922860_1923262_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1923370_1923643_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1923626_1924052_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_153023042.1|1924258_1924741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948178.1|1924724_1925938_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_072141648.1|1926105_1927191_+	DNA-binding protein	NA	V5URT9	Shigella_phage	70.4	3.0e-133
WP_000788745.1|1927197_1927944_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_000450992.1|1927965_1928736_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1928751_1929165_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1929516_1930290_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1930655_1930793_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|1930837_1931050_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|1931217_1931496_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1931497_1932547_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001217436.1|1932559_1932931_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1932920_1933292_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_153023022.1|1933443_1934262_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|1934548_1934788_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|1934882_1935596_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1936363_1938214_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_085948178.1|1938389_1939602_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303878.1|1939807_1940122_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1940649_1940835_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1941056_1941170_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1941390_1941924_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1942083_1942356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1942611_1942818_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1943568_1943844_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1943919_1944300_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1944296_1944644_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1944693_1946232_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|1946281_1946524_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000259002.1|1948408_1948615_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1948611_1950204_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1950193_1951699_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1951735_1952083_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1952140_1952407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|1952388_1953129_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1953142_1953574_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1953600_1954014_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082464.1|1953994_1956574_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.2	0.0e+00
WP_000847298.1|1956570_1956900_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1956899_1957598_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_050946666.1|1957608_1958352_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	98.4	8.6e-148
WP_050546863.1|1958297_1958930_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649829.1|1959120_1959648_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_062946186.1|1959781_1963255_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.4	0.0e+00
WP_001230444.1|1963322_1963922_+	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268962.1|1963986_1965300_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001023352.1|1965301_1965571_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_001301613.1|1967843_1968962_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1968958_1970752_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|1970770_1971478_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|1971474_1972062_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP040311	Escherichia coli strain F3398 chromosome, complete genome	5381728	2246731	2369762	5381728	tRNA,capsid,holin,transposase,protease,head,terminase,lysis,portal,tail,integrase	Enterobacteria_phage(36.94%)	157	2311340:2311355	2340907:2340922
WP_000952736.1|2246731_2247553_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|2247708_2248755_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|2248751_2249546_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|2249712_2250831_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|2250799_2251069_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|2251130_2251520_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|2251652_2252168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|2252282_2252435_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|2252750_2253227_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2253351_2253675_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693915.1|2253658_2254084_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|2254152_2255190_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_001301518.1|2255221_2255644_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_000451012.1|2255677_2256394_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_000017339.1|2256390_2256708_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|2256704_2257007_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|2256996_2257314_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|2257267_2257585_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|2257571_2258009_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|2258010_2258202_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|2258204_2258792_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|2258907_2259012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2259200_2259413_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|2259580_2259859_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265168.1|2259860_2260910_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001217410.1|2260922_2261297_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|2261293_2262115_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|2262711_2262879_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023170.1|2263193_2265131_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_001213059.1|2265278_2265461_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|2265498_2265768_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|2265843_2266059_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|2266063_2266408_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2266458_2266992_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2267262_2267832_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2267831_2267978_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|2268205_2268412_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2268476_2268701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2269057_2269198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302295.1|2269327_2269513_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_065225440.1|2269554_2269920_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	98.3	3.8e-64
WP_000958416.1|2270209_2270773_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301491.1|2270769_2272431_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2272494_2274432_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2274476_2274698_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001356761.1|2274643_2277223_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.0	0.0e+00
WP_000125988.1|2277225_2277552_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2277561_2277912_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2277908_2278355_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2278351_2278696_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2278761_2279478_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2279492_2279867_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453698.1|2279962_2280172_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212850.1|2280224_2283467_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.7	0.0e+00
WP_000807950.1|2283459_2283801_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_001152182.1|2283800_2284499_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|2284515_2284770_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|2284879_2284990_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2285292_2286171_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|2286224_2286962_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|2286907_2287144_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2287156_2287246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2287265_2289614_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2290204_2293606_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|2295709_2295835_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|2295914_2296190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2296250_2297612_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|2297975_2298839_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2298822_2299959_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2300208_2301435_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2301483_2302605_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000085256.1|2302853_2304083_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_000953272.1|2304447_2304636_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|2304685_2305012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|2305136_2305310_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|2305440_2305638_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|2305630_2305843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|2305832_2306297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|2306289_2306523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|2306528_2306828_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_062946190.1|2306824_2308225_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.9	9.6e-116
WP_000192401.1|2308425_2308677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|2308673_2309084_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|2309094_2309367_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|2309493_2309718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|2309969_2310176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|2310175_2311231_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|2311243_2311579_+|head	head decoration protein	head	NA	NA	NA	NA
2311340:2311355	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_062946191.1|2311591_2312005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2312210_2312753_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|2313008_2313290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2313890_2315351_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2315350_2316022_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2316190_2317561_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2317564_2318206_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2318241_2319348_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2319401_2319863_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2319872_2320526_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2320697_2321948_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2322061_2323204_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|2323193_2323430_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|2323533_2324358_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|2324354_2325056_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2325052_2325355_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2325422_2325755_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2325819_2325942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709088.1|2325999_2327526_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|2328027_2328483_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2328482_2328653_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2328645_2328936_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2328932_2329295_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2329291_2329432_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2329428_2330118_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|2330439_2330745_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2330731_2331208_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2331424_2331607_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2331697_2331991_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_085948178.1|2332193_2333406_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000079504.1|2333595_2334006_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2334291_2334498_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2334662_2334857_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2335245_2335791_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|2335765_2337691_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|2337687_2337894_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2337890_2339492_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2339472_2340792_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2340801_2341134_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
2340907:2340922	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063265.1|2341189_2342215_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2342256_2342655_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2342666_2343020_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|2343031_2343610_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|2343606_2344002_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|2344009_2344750_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2344765_2345188_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2345169_2345604_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|2345596_2348146_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|2348142_2348472_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2348471_2349170_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|2349175_2349919_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|2349855_2350488_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|2350548_2353947_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|2354013_2354613_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|2354677_2357593_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|2357592_2358174_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|2358293_2359184_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2359202_2359709_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2359745_2360246_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2360324_2360507_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|2361004_2361673_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|2361729_2361978_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|2362053_2362434_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2362430_2362778_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998042.1|2362827_2364366_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_001226373.1|2364668_2366153_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2366339_2367293_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000361110.1|2367791_2368376_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085948178.1|2368549_2369762_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 8
NZ_CP040311	Escherichia coli strain F3398 chromosome, complete genome	5381728	2465855	2541845	5381728	capsid,holin,transposase,protease,head,terminase,lysis,portal,tail,integrase	Enterobacteria_phage(33.33%)	86	2465666:2465693	2526317:2526344
2465666:2465693	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|2465855_2466986_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2466963_2467212_-	excisionase	NA	NA	NA	NA	NA
WP_000048551.1|2467276_2469748_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090196.1|2469840_2470032_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2470028_2470217_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2470614_2470782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2470775_2471009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2470986_2471394_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2471416_2471635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2471707_2472007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2472270_2472678_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2472754_2472982_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2472965_2473517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2473488_2474529_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_001302276.1|2474560_2474983_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000774808.1|2475169_2475751_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|2475747_2475912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2476610_2477369_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2477647_2477860_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_085948178.1|2478179_2479392_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_010917803.1|2479720_2479999_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2480000_2481047_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2481059_2481419_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2481427_2481958_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2482199_2482397_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_153023024.1|2484401_2486255_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|2486404_2486620_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|2486624_2486969_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992148.1|2487019_2487553_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2487823_2488393_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2488392_2488539_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001082601.1|2488546_2489014_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_001302717.1|2489477_2489792_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2489873_2490098_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2490484_2491030_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2491004_2492930_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2492926_2493133_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2493129_2494731_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2494711_2496031_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2496040_2496373_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2496428_2497454_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2497495_2497894_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2497905_2498259_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2498273_2498807_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2498803_2499199_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2499206_2499959_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2499972_2500395_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2500421_2500835_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_072643101.1|2500815_2503428_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	94.5	0.0e+00
WP_000847298.1|2503424_2503754_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2503753_2504452_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|2504462_2505206_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_071601640.1|2505151_2505781_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_062946197.1|2506021_2508877_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.6	0.0e+00
WP_001228334.1|2508944_2509544_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_000216534.1|2509695_2511000_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
WP_001023474.1|2511001_2511271_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2512297_2513623_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|2515220_2515343_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2515449_2516361_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|2516426_2516996_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000998048.1|2517961_2519500_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2519549_2519897_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2519893_2520274_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2520613_2520892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2521319_2521466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2521602_2522250_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2522433_2523024_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001302903.1|2524752_2525181_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_000147167.1|2525774_2525993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001079499.1|2526494_2527001_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2526317:2526344	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_001056491.1|2527046_2527547_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2527632_2527812_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2528192_2528999_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2528998_2530192_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001302292.1|2530203_2531562_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	4.3e-36
WP_000763520.1|2531565_2533161_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194604.1|2533160_2534723_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2534814_2534859_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2534996_2535878_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2535874_2536495_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2536522_2538106_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2538318_2539191_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2539230_2539821_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2539817_2540576_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2540795_2541845_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 9
NZ_CP040311	Escherichia coli strain F3398 chromosome, complete genome	5381728	2813141	2903842	5381728	capsid,holin,transposase,head,terminase,portal,tail	Stx2-converting_phage(44.55%)	110	NA	NA
WP_000214712.1|2813141_2813345_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2813380_2814841_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2814929_2816213_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_016241229.1|2816272_2816587_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2816748_2817390_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2817471_2818101_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2818173_2818749_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2818862_2819132_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268849.1|2819133_2820447_-|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
WP_001230508.1|2820511_2821111_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000143597.1|2821178_2823692_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.5	0.0e+00
WP_000514693.1|2823688_2825257_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.2	1.1e-298
WP_050439450.1|2825599_2826232_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2826177_2826921_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001303180.1|2826931_2827630_-|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.4	2.9e-129
WP_000807954.1|2827629_2827971_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212925.1|2827963_2831206_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_001453698.1|2831257_2831467_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2831562_2831937_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2831942_2832659_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2832717_2833062_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2833058_2833505_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2833501_2833852_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000125988.1|2833861_2834188_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063023.1|2836228_2836450_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_062946127.1|2836494_2838432_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.2	0.0e+00
WP_001303179.1|2838495_2840157_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_000958392.1|2840153_2840717_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	93.5	3.6e-82
WP_000279786.1|2841006_2841372_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|2841413_2841641_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2842065_2842251_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2842478_2842625_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2842624_2843194_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2843464_2843998_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|2844048_2844393_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411805.1|2844397_2844604_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000023185.1|2845052_2846903_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_001302123.1|2847380_2847812_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|2848262_2848976_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|2849111_2849309_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|2849533_2850088_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|2850150_2850456_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|2850468_2851518_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191871.1|2851519_2851792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000756596.1|2851913_2852258_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|2852377_2852590_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|2852823_2853381_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|2853382_2853601_-	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|2853728_2854040_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|2854032_2854260_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|2854256_2854538_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|2854570_2855287_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_001379651.1|2855320_2855743_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_001356791.1|2855774_2856830_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	84.7	1.6e-83
WP_000693878.1|2856898_2857324_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|2857307_2857550_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|2857941_2858280_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|2858572_2858725_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|2858736_2859375_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|2859375_2859585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2860149_2860338_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|2860334_2860523_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|2860615_2861860_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_016241229.1|2862498_2862813_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|2863775_2864156_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2864152_2864500_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2864549_2866088_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|2866670_2867321_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|2868031_2868607_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|2868720_2868990_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|2868991_2870215_-|tail	tail fiber protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|2870279_2870879_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_062946126.1|2870946_2874423_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.3	0.0e+00
WP_001179509.1|2874610_2875048_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_000807954.1|2875047_2875389_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_062946125.1|2875381_2878624_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.7	0.0e+00
WP_001453746.1|2878671_2878881_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|2878976_2879351_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2879365_2880082_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2880147_2880492_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|2880488_2880935_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|2880931_2881282_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|2881291_2881618_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001356761.1|2881620_2884200_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.0	0.0e+00
WP_001063099.1|2884145_2884367_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2884411_2886349_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2886412_2888074_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958360.1|2888070_2888634_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	99.5	6.2e-90
WP_000279796.1|2888923_2889289_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2889330_2889558_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2889982_2890168_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2890395_2890542_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2890541_2891111_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2891381_2891915_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|2891965_2892310_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000411805.1|2892314_2892521_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_153023027.1|2892969_2894820_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_001303509.1|2895298_2895727_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|2896362_2897052_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|2897048_2897408_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_062946124.1|2897420_2898470_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	4.2e-108
WP_012779366.1|2898471_2898750_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2898917_2899130_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2899318_2899423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|2899538_2900123_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|2900179_2900575_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788938.1|2901385_2902126_-	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000095669.1|2902132_2903095_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000693943.1|2903117_2903543_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|2903539_2903842_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 10
NZ_CP040311	Escherichia coli strain F3398 chromosome, complete genome	5381728	3218714	3269836	5381728	tRNA,tail,transposase,integrase	Enterobacteria_phage(63.33%)	59	3211938:3211953	3269915:3269930
3211938:3211953	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|3218714_3220448_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|3220624_3221113_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|3221232_3221625_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|3221624_3223703_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|3223695_3224844_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|3225045_3225690_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3225700_3226090_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|3226104_3227154_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|3227156_3228017_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|3228035_3229637_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|3229682_3231344_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|3231486_3231990_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|3232010_3233975_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3233979_3234906_-	motility protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|3234902_3235790_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3235916_3236495_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|3236497_3236848_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|3237627_3238056_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000089029.1|3238062_3239487_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|3239461_3240262_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|3240428_3241415_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|3241429_3242944_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|3243013_3244003_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179461.1|3244799_3245303_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|3245382_3245634_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3245748_3245835_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|3246096_3246420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3246590_3247088_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|3247124_3247364_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|3247555_3248767_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|3248828_3249494_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001300279.1|3249850_3250852_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865208.1|3250857_3251205_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|3251234_3251885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|3251900_3252305_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|3252394_3252532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3252603_3252807_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3252828_3253179_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|3253189_3253468_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|3253479_3253722_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|3253718_3253832_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|3253924_3254341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3254364_3254568_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|3254564_3254831_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|3254827_3255127_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000775057.1|3255449_3255680_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000599379.1|3255752_3256118_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|3256124_3258947_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|3259023_3259983_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|3259987_3260302_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|3261507_3261924_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|3261967_3262540_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|3262696_3263185_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000763327.1|3265987_3266116_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|3266151_3266517_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|3266571_3267084_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|3267083_3268268_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|3268425_3268749_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|3268699_3269836_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3269915:3269930	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 11
NZ_CP040311	Escherichia coli strain F3398 chromosome, complete genome	5381728	3327417	3394638	5381728	holin,transposase,head,terminase,portal,tail,integrase	Escherichia_phage(35.56%)	68	3343217:3343232	3398983:3398998
WP_001023407.1|3327417_3327687_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_153023030.1|3327688_3329002_-|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	4.8e-77
WP_001230508.1|3329066_3329666_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_153023031.1|3329733_3333213_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	98.9	0.0e+00
WP_149026291.1|3333451_3334084_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	2.7e-102
WP_000194801.1|3334029_3334773_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|3334783_3335482_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3335481_3335811_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082464.1|3335807_3338387_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.2	0.0e+00
WP_000533402.1|3338367_3338781_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3338807_3339239_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3339252_3339993_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3339974_3340241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3340298_3340646_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3340682_3342188_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3342177_3343770_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
3343217:3343232	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|3343766_3343973_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|3345857_3346367_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|3346761_3346986_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|3347067_3347382_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3347908_3348094_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|3348321_3348453_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|3348465_3348648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|3348803_3349337_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|3349387_3349732_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000411809.1|3349736_3349943_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_085948178.1|3350262_3351475_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000023257.1|3351557_3353408_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001303558.1|3353885_3354314_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_001059369.1|3354947_3355637_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|3355633_3355993_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|3356005_3357055_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|3357056_3357335_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|3357502_3357715_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|3357901_3358006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|3358115_3358679_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|3358805_3359117_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|3359113_3359266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|3359298_3359655_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|3359651_3359876_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_153023032.1|3359897_3360596_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	2.1e-71
WP_000373320.1|3360630_3361053_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_001262409.1|3361084_3362122_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_000693816.1|3362190_3362616_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|3362612_3362840_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|3362937_3363582_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|3363856_3364009_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|3364489_3364678_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|3364674_3364863_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_153023033.1|3364958_3367430_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|3367488_3367692_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533600.1|3367691_3368714_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_001302302.1|3368949_3369747_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_149016422.1|3370236_3378219_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_000480501.1|3378480_3379533_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|3379846_3381163_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|3381264_3382719_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|3383061_3383778_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|3384403_3386047_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|3386164_3387115_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_062946143.1|3387216_3388134_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|3388590_3389526_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|3389587_3390667_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|3390678_3391422_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|3391418_3391964_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|3392325_3392706_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3392702_3393050_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3393099_3394638_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
3398983:3398998	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 12
NZ_CP040311	Escherichia coli strain F3398 chromosome, complete genome	5381728	3496517	3611265	5381728	tRNA,holin,transposase,protease,terminase,portal,tail,integrase	Enterobacteria_phage(46.91%)	130	3550019:3550039	3608771:3608791
WP_000476014.1|3496517_3497879_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|3498208_3498526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|3498931_3499831_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|3499912_3500692_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|3500791_3501832_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490679.1|3501879_3503235_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|3503238_3503523_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|3503553_3504006_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853846.1|3504015_3505278_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001301486.1|3505306_3506161_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|3506459_3507512_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000859148.1|3507768_3509046_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|3509042_3510047_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|3510043_3511009_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|3510982_3511729_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301907.1|3511780_3512599_-	glycosyl hydrolase 25 family protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000822268.1|3512663_3513464_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|3513460_3514249_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|3514582_3514822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|3515872_3516220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|3516229_3516544_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|3516653_3516926_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134629.1|3517046_3517898_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153070.1|3518115_3518454_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|3518535_3519570_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000945390.1|3519580_3522061_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677408.1|3522076_3522751_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000682830.1|3522838_3523381_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|3523672_3523954_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|3524215_3525325_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001301615.1|3525456_3527490_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001411921.1|3531452_3532733_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_122989774.1|3532896_3534438_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000356841.1|3534447_3538077_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|3538138_3538456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|3539696_3540785_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|3540795_3542325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|3542343_3543075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|3543067_3544204_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001087225.1|3544200_3546204_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001295429.1|3546328_3546790_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3546831_3547302_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3547348_3548068_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|3548064_3549750_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
3550019:3550039	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261937.1|3550264_3550513_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001023381.1|3550880_3551150_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_000268979.1|3551151_3552465_-|tail	tail fiber protein	tail	Q9EYE8	Enterobacteria_phage	99.1	2.4e-76
WP_001228302.1|3552529_3553129_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_000514991.1|3553196_3556670_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.8	0.0e+00
WP_071601640.1|3556910_3557540_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_000194801.1|3557485_3558229_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|3558239_3558938_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3558937_3559267_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918269.1|3559263_3561909_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000438877.1|3561952_3562261_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000479043.1|3562287_3562710_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|3562723_3563476_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|3563483_3563882_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3563894_3564518_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|3564520_3564802_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|3564794_3565121_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|3565208_3567233_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|3567177_3568680_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|3568679_3568892_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000133409.1|3570384_3570666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149009402.1|3570784_3570991_-	hypothetical protein	NA	S5M7R1	Escherichia_phage	80.8	8.5e-05
WP_000860403.1|3570923_3572813_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000126660.1|3573470_3573893_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_001399692.1|3573889_3574135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761774.1|3574422_3576237_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	5.7e-129
WP_000728901.1|3576233_3576476_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000551748.1|3576672_3577266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000335965.1|3577258_3577483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088136225.1|3577475_3578195_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001038670.1|3578175_3578757_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.3	1.5e-51
WP_000229066.1|3578816_3579041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000114064.1|3579033_3580272_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_001077621.1|3580433_3581441_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_000348565.1|3581437_3581914_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|3582431_3582617_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3582844_3582991_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3582990_3583560_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3583830_3584364_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3584368_3584584_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|3584661_3584907_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3584947_3585127_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142932.1|3585263_3587210_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_001356551.1|3588013_3588166_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|3588417_3588852_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|3588937_3589078_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3589074_3589437_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774488.1|3589433_3589724_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224916.1|3589716_3589887_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054341.1|3589886_3590342_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_001303586.1|3590338_3590440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|3590556_3591354_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001302427.1|3591363_3591915_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|3592379_3593906_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_032102575.1|3593963_3594071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070451.1|3594162_3594495_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3594562_3594865_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788810.1|3594861_3595563_-	Replication protein P	NA	M1FJ72	Enterobacteria_phage	98.7	1.4e-128
WP_001415640.1|3595559_3596489_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	3.6e-111
WP_001182899.1|3596575_3597115_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067457.1|3597184_3597415_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_000858974.1|3597519_3598209_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000380252.1|3598289_3599351_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000866321.1|3599328_3599706_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000233576.1|3600186_3600393_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3600468_3600765_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3600770_3601556_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|3601552_3602230_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_001303590.1|3602229_3602412_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000548547.1|3602384_3602576_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3602586_3602868_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|3602966_3603188_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_153023034.1|3603184_3603763_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	99.5	2.6e-99
WP_085948178.1|3603788_3605001_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_153023035.1|3604998_3605445_+	hypothetical protein	NA	A0A0P0ZBW7	Stx2-converting_phage	94.5	3.1e-76
WP_001356547.1|3605446_3605623_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|3605956_3606313_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|3606309_3606672_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|3606759_3607002_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556581.1|3607005_3607140_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_001193437.1|3607158_3607413_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|3607446_3608733_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|3608753_3609455_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
3608771:3608791	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|3609514_3609622_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3609602_3610334_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|3610338_3611265_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 13
NZ_CP040311	Escherichia coli strain F3398 chromosome, complete genome	5381728	3855727	3861114	5381728	integrase	Enterobacteria_phage(50.0%)	6	3846178:3846194	3858142:3858158
3846178:3846194	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3855727_3856660_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3856971_3858129_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3858303_3859440_-	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3858142:3858158	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000960724.1|3859449_3860130_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000403517.1|3860116_3860584_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_001005794.1|3860583_3861114_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
>prophage 14
NZ_CP040311	Escherichia coli strain F3398 chromosome, complete genome	5381728	4101516	4160968	5381728	tRNA,holin,transposase,tail,integrase	Enterobacteria_phage(31.58%)	59	4118962:4118976	4167241:4167255
WP_000997403.1|4101516_4102554_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4102760_4103180_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|4103248_4103947_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|4103978_4106639_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|4106752_4108108_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|4108153_4108477_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|4108473_4109772_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|4115545_4118119_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|4118248_4118980_-	polyphenol oxidase	NA	NA	NA	NA	NA
4118962:4118976	attL	GGACAATCAGCTTAC	NA	NA	NA	NA
WP_000079092.1|4118976_4119957_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|4120091_4120829_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|4121099_4121441_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|4121544_4121592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|4121690_4122851_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|4122893_4124015_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|4124025_4125096_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|4125305_4125671_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|4125820_4126339_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000969012.1|4126328_4127555_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589827.1|4127570_4128053_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|4128129_4128477_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|4128518_4129286_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|4129316_4129865_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|4129883_4130132_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|4130268_4131630_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|4131796_4132588_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|4132609_4133896_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301442.1|4133950_4134544_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|4134666_4135545_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880923.1|4135630_4137292_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|4137440_4137782_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|4137843_4138134_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|4138123_4138600_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|4138731_4139214_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|4140059_4140308_+	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001144077.1|4141584_4142235_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|4142313_4143372_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|4143501_4143924_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|4144084_4144354_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_001303014.1|4144355_4144922_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
WP_000612591.1|4144971_4145319_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4145315_4145696_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|4146052_4146397_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|4146401_4146617_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143068.1|4146766_4148620_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000499458.1|4149027_4149195_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|4149280_4150024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|4150276_4150900_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|4150896_4151562_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|4151558_4152170_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|4152144_4152711_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001254939.1|4153058_4153814_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001417601.1|4153849_4154152_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_064234917.1|4154227_4155514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|4155909_4156323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|4156420_4156819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059531.1|4156819_4158451_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000428092.1|4158447_4159761_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|4159762_4160968_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4167241:4167255	attR	GGACAATCAGCTTAC	NA	NA	NA	NA
>prophage 1
NZ_CP040312	Escherichia coli strain F3398 plasmid pO157, complete sequence	92909	8200	60424	92909	protease,transposase,integrase	Macacine_betaherpesvirus(30.77%)	44	NA	NA
WP_001034100.1|8200_12103_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_071525077.1|13501_13681_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|14282_15104_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|15103_16210_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|16299_18021_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001171554.1|19459_19840_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|19836_20184_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|20233_21772_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001358886.1|22429_25126_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|25212_26088_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|26145_28056_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|28055_29561_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001173152.1|29562_30786_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|30816_31251_+	type II secretion system protein GspG	NA	NA	NA	NA	NA
WP_000082929.1|31247_31802_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_000173396.1|31816_32164_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082782.1|32160_32760_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000776550.1|32756_33734_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_071525076.1|33772_34945_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|34931_35444_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|35501_36335_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|36426_36828_+	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_000839950.1|38718_39234_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000217733.1|39235_42232_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|42281_44402_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|44405_45845_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|45911_46106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|46135_46420_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010891288.1|46588_46819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|46939_47680_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|47964_48942_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|49349_49550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|49546_50167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|50163_50847_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|51305_51524_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|51525_51831_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|51831_52638_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|53314_53395_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_085948178.1|53360_54574_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000772446.1|55577_56744_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|56743_57715_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|58452_59355_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|59358_59664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|59740_60424_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
