The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	357255	371920	5496151	integrase,tRNA,tail	Enterobacteria_phage(40.0%)	18	358536:358551	376065:376080
WP_000956557.1|357255_357789_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_001093918.1|358206_358488_-	hypothetical protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
358536:358551	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000829415.1|358832_359030_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_000145668.1|359365_359650_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_001242740.1|359646_359997_-	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000008211.1|359987_360524_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001230514.1|361845_362445_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268945.1|362509_363823_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001023355.1|363824_364094_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_001118000.1|364205_364778_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_072140863.1|364850_365480_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001143816.1|365561_366203_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_001217541.1|366363_366612_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000332269.1|366673_367771_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_000543819.1|367859_368897_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891404.1|369030_369273_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235522.1|369438_370422_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918366.1|370504_371920_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.1	8.3e-200
376065:376080	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
>prophage 2
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	508799	567827	5496151	protease,transposase	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|508799_510059_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|510061_511066_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|511147_511345_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|511448_512747_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|512951_513377_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076303.1|513415_515857_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001293282.1|516037_516769_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220128.1|516895_517297_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511966.1|517315_518014_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012572.1|518064_518724_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|518741_519140_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101670.1|519149_519788_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943960.1|519790_520954_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_001301849.1|521037_522663_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|522779_523055_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|523203_523533_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569696.1|523714_524464_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|524460_525216_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001301921.1|526742_528140_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218362.1|528155_528461_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776517.1|528470_528935_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|528948_529599_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|529608_530463_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|530462_531149_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000492914.1|531277_531553_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|531879_532275_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|532281_532596_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|532600_532828_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|532869_533319_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001301745.1|533389_534184_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604943.1|534806_535238_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_000826431.1|535245_536454_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_001119481.1|536588_537227_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|537444_538065_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|538373_539786_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331454.1|539830_540493_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001301505.1|540600_541566_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560631.1|541673_542534_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001302935.1|542622_543003_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589488.1|543120_545064_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886884.1|545253_545994_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000937658.1|546205_547144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175296.1|547206_547761_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|548085_548292_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935036.1|548387_549731_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001301936.1|550053_550692_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|550897_552631_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060930.1|552627_556407_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|556409_556751_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223210.1|556962_557214_+	type II toxin-antitoxin system ChpS family antitoxin	NA	NA	NA	NA	NA
WP_000239579.1|557207_557558_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|557637_558168_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265942.1|558477_559434_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205805.1|559573_561076_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001301928.1|561089_562112_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|562098_563094_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853749.1|563126_564125_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_001219792.1|564300_565674_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|565829_566381_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|566474_567827_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 3
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	600247	612823	5496151		Enterobacteria_phage(81.82%)	15	NA	NA
WP_000772662.1|600247_601522_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
WP_000936844.1|601689_601995_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001453880.1|602071_602806_+	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000095622.1|602843_604088_-	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_000446132.1|604413_604986_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638634.1|605059_605560_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283021.1|605556_606291_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_001149160.1|606842_607109_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980224.1|607105_607696_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001244670.1|607688_607976_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459287.1|607968_608424_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000856729.1|608559_608880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783684.1|608894_611228_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_044815386.1|611583_611778_+	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_001301682.1|611995_612823_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	40.4	4.3e-55
>prophage 4
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	952790	1026035	5496151	plate,tRNA,protease,transposase	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_001295561.1|952790_954143_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|954172_956605_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|956725_957211_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|957214_958240_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|958344_958800_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565963.1|958803_959592_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139661.1|959591_960740_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569419.1|960736_961333_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_001294772.1|961369_964852_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000055741.1|964864_965824_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020954.1|965922_968064_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|968120_968510_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176537.1|968574_969870_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|969922_970183_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|970169_970370_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185286.1|970535_971081_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635546.1|971077_971488_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239181.1|971501_972212_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001302206.1|972411_973236_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260720.1|973288_975007_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094000.1|975117_975825_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202328.1|975821_976226_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874227.1|976343_977159_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294606.1|977198_977852_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|977844_978876_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140187.1|979063_979639_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997018.1|985398_986202_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_000648586.1|986198_987113_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|987353_988154_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211693.1|988231_989002_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644686.1|989049_990408_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|990479_991235_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001301721.1|991268_991991_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|991987_992455_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301976.1|992519_993251_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_001302684.1|995066_995516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|995518_996115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002701.1|996193_996415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284958.1|996435_996915_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087743.1|996880_998290_-	membrane protein	NA	NA	NA	NA	NA
WP_001303798.1|998300_1001735_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240517.1|1001871_1003284_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088854.1|1003288_1004032_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614377.1|1004028_1006812_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	6.2e-82
WP_000343292.1|1006820_1007582_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246433.1|1007586_1008918_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080153.1|1008920_1009445_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113707.1|1009441_1010722_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348794.1|1010746_1011829_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|1011792_1013643_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000599596.1|1013646_1014060_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056994.1|1014150_1015542_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|1015592_1015817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037399.1|1015851_1016352_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|1017048_1017567_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103335.1|1017776_1019918_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_000509142.1|1019993_1024217_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000247943.1|1024418_1024682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795385.1|1024596_1024782_-	protein YncO	NA	NA	NA	NA	NA
WP_000027427.1|1024862_1026035_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	1044821	1125378	5496151	integrase,tail,head,protease,portal,terminase,capsid,plate,holin,lysis,transposase	Shigella_phage(45.9%)	95	1047360:1047376	1132206:1132222
WP_000749881.1|1044821_1045877_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|1046164_1047268_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893282.1|1047279_1048533_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
1047360:1047376	attL	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
WP_000051887.1|1048737_1049901_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_077769569.1|1049777_1050212_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	98.6	1.0e-76
WP_000206732.1|1050127_1050433_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|1050432_1050795_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008235.1|1050785_1051322_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_000917896.1|1051998_1052295_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_001020634.1|1052572_1053265_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|1053362_1053623_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|1053615_1054167_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250269.1|1054342_1054522_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104949.1|1054511_1055453_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_072141203.1|1055449_1055944_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_001303054.1|1055943_1056597_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_000210141.1|1056593_1056920_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_000767113.1|1056916_1057306_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061444.1|1057325_1058135_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001360050.1|1058142_1059132_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001008431.1|1059145_1059898_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_000484663.1|1060112_1060652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310393.1|1060795_1061029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449601.1|1061307_1061601_+	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001120501.1|1061737_1062073_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001197766.1|1062076_1062553_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001228695.1|1062769_1062952_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|1063042_1063336_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_085948178.1|1064034_1065248_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000929175.1|1065650_1066145_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_128484532.1|1066378_1067875_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000923141.1|1068022_1069249_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000999805.1|1069241_1069844_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000766100.1|1069854_1071084_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000924828.1|1071162_1071486_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000702395.1|1071482_1071893_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000224836.1|1071867_1072374_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000779288.1|1072370_1072931_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000497751.1|1072939_1073110_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000155728.1|1073093_1074590_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000090993.1|1074589_1074946_+	hypothetical protein	NA	U5P076	Shigella_phage	99.2	1.2e-62
WP_000661054.1|1074945_1075215_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000807197.1|1075356_1077192_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000219910.1|1077252_1078581_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000999513.1|1078577_1079657_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_001259066.1|1079656_1080205_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000424732.1|1080204_1080630_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_000785302.1|1080616_1081675_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000383550.1|1081665_1082250_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000554706.1|1082253_1083024_+|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000368084.1|1083023_1083626_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001008234.1|1083597_1084041_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_001145350.1|1084061_1084472_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	6.5e-65
WP_000905124.1|1084502_1085057_+	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_000355484.1|1085117_1085891_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000246059.1|1086715_1087459_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001130487.1|1088421_1089603_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000082144.1|1089606_1090023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|1089995_1090613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251694.1|1090612_1091071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|1091063_1091696_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000647284.1|1091726_1092317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000350115.1|1092316_1092883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001185340.1|1093292_1093565_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000968317.1|1093570_1094122_-	Polarity suppression protein	NA	NA	NA	NA	NA
WP_000154958.1|1094118_1094871_-	septation initiation protein	NA	NA	NA	NA	NA
WP_001244581.1|1095804_1096065_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000973389.1|1096061_1096619_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001071227.1|1096615_1096837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000562750.1|1096836_1097160_+	endopeptidase ClpB	NA	NA	NA	NA	NA
WP_000016225.1|1097173_1099507_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000205213.1|1099639_1100596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000687183.1|1101271_1102171_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000361969.1|1102269_1102992_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001301751.1|1103158_1103437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917758.1|1104139_1105042_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303808.1|1105287_1106346_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000171065.1|1106487_1107615_+	MFS transporter	NA	NA	NA	NA	NA
WP_000121344.1|1107793_1108750_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667043.1|1108759_1110958_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000643340.1|1110954_1111911_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000070685.1|1111907_1112597_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|1113014_1113629_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|1113876_1114206_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001301550.1|1114518_1115229_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001265657.1|1115197_1116841_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_000716386.1|1119382_1120051_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|1120108_1120696_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000389022.1|1120770_1121313_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147284.1|1122137_1122329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|1122398_1122539_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|1122538_1122802_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_054249760.1|1123065_1123446_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	2.1e-65
WP_000612591.1|1123442_1123790_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1123839_1125378_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
1132206:1132222	attR	GCTGGAAAAAATCGCCG	NA	NA	NA	NA
>prophage 6
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	1668542	1706637	5496151	integrase,tail,protease,portal,holin,lysis	Enterobacteria_phage(52.5%)	47	1657984:1657998	1690273:1690287
1657984:1657998	attL	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_024219169.1|1668542_1669424_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
WP_001303849.1|1669586_1669805_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545728.1|1669844_1670012_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_000120056.1|1670254_1670857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763363.1|1671067_1671289_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_023436627.1|1671387_1671669_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000548536.1|1671679_1671871_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_000682316.1|1671843_1672026_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000186844.1|1672022_1672703_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_001254218.1|1673400_1673583_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000567001.1|1673579_1673750_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001108055.1|1673742_1674363_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_001028857.1|1674359_1675025_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_000750155.1|1675236_1676196_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_032160865.1|1676533_1676656_+	YlcG family protein	NA	NA	NA	NA	NA
WP_001097238.1|1676670_1677360_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_001302581.1|1677543_1678287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499454.1|1678372_1678531_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_012578864.1|1678611_1679010_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000284524.1|1679152_1679368_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000075107.1|1679367_1679865_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000092302.1|1679861_1680329_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_001139679.1|1680316_1680469_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_001072975.1|1683732_1683945_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_010904538.1|1683872_1684997_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_127446149.1|1685118_1685454_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_153021225.1|1685398_1687426_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.1	0.0e+00
WP_001097050.1|1687512_1687836_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|1687828_1688104_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677094.1|1688115_1688694_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001079422.1|1688690_1689092_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000211123.1|1689102_1689846_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001300035.1|1689906_1690293_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
1690273:1690287	attR	CTGACGCCGGAAAAG	NA	NA	NA	NA
WP_001161009.1|1690301_1690631_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371994.1|1690602_1693668_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_000447253.1|1693667_1693997_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152360.1|1694006_1694705_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000194779.1|1694710_1695454_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090841.1|1695390_1695999_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_001233141.1|1699543_1700143_+	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000741874.1|1700202_1701519_+|tail	tail fiber protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001024022.1|1701520_1701790_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000950813.1|1701966_1702947_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_115801843.1|1702980_1704000_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_072127173.1|1704496_1704658_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_000951026.1|1704826_1705708_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_001247925.1|1705938_1706637_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 7
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	1828757	1839876	5496151	integrase,capsid,terminase	uncultured_Caudovirales_phage(25.0%)	14	1823219:1823233	1835969:1835983
1823219:1823233	attL	AATAACTTTTAACGC	NA	NA	NA	NA
WP_000188174.1|1828757_1830704_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1830776_1831001_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000085207.1|1831405_1832629_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.2	1.6e-127
WP_000775337.1|1832625_1833399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075374.1|1833490_1833715_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	64.2	1.9e-18
WP_100224852.1|1833724_1834432_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000659213.1|1834610_1834802_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	2.2e-07
WP_000770151.1|1835039_1835339_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761784.1|1835335_1837084_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.6	8.6e-90
1835969:1835983	attR	GCGTTAAAAGTTATT	NA	NA	NA	NA
WP_106904350.1|1837435_1837681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000391152.1|1837811_1838006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018605.1|1838009_1838171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001229493.1|1838301_1838790_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	3.5e-25
WP_000562896.1|1838952_1839876_+|capsid	phage capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.1	3.4e-13
>prophage 8
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	1932876	2002441	5496151	integrase,tail,head,protease,portal,holin,transposase	Escherichia_phage(26.67%)	79	1941364:1941379	1962730:1962745
WP_000156526.1|1932876_1934637_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|1934822_1935275_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|1935350_1936391_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|1936747_1937257_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839159.1|1937475_1938105_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875023.1|1938067_1940230_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261230.1|1940239_1940686_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_001301436.1|1940808_1942863_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
1941364:1941379	attL	GCGGATTTTTTCCGCC	NA	NA	NA	NA
WP_000424181.1|1942894_1943353_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847791.1|1943448_1944111_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000665217.1|1944283_1944697_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001295356.1|1944741_1945059_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116288.1|1945116_1946307_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|1946401_1946680_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|1946676_1947006_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375128.1|1947096_1947756_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
WP_001299351.1|1948163_1949183_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000273151.1|1949160_1949403_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|1949470_1951942_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_001098307.1|1952035_1952227_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000413705.1|1952223_1952412_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001133046.1|1952985_1953171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394511.1|1953357_1953747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1953888_1954044_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001303876.1|1954321_1954609_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000536233.1|1954608_1954800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000986592.1|1954827_1955229_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000887453.1|1955337_1955610_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000693855.1|1955593_1956019_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000273724.1|1956225_1956681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001205823.1|1956759_1957851_+	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000788751.1|1957857_1958604_+	replication protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_000450992.1|1958625_1959396_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_001151233.1|1959411_1959825_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000160654.1|1960176_1960950_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000955173.1|1961315_1961453_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_001013642.1|1961497_1961710_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
WP_001341388.1|1961877_1962156_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265172.1|1962157_1963207_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
1962730:1962745	attR	GGCGGAAAAAATCCGC	NA	NA	NA	NA
WP_001217436.1|1963219_1963591_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090264.1|1963580_1963952_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_000265265.1|1964103_1964922_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001303877.1|1965208_1965448_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
WP_000261909.1|1965542_1966256_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000874392.1|1967022_1968873_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_085948178.1|1969048_1970261_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001303878.1|1970466_1970781_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|1971308_1971494_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|1971715_1971829_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|1972049_1972583_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|1972742_1973015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000411791.1|1973270_1973477_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000235421.1|1974227_1974503_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|1974578_1974959_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1974955_1975303_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|1975352_1976891_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001301919.1|1976940_1977183_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000259002.1|1979067_1979274_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1979270_1980863_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1980852_1982358_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1982394_1982742_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1982799_1983066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029208397.1|1983047_1983788_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1983801_1984233_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1984259_1984673_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082473.1|1984653_1987233_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847298.1|1987229_1987559_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302968.1|1987558_1988257_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000194760.1|1988267_1989011_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_115445438.1|1988956_1989589_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.5	5.8e-105
WP_000649827.1|1989779_1990307_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_000515109.1|1990440_1993914_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_001230444.1|1993981_1994581_+	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268855.1|1994645_1995959_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001023407.1|1995960_1996230_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001301613.1|1998222_1999341_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|1999337_2001131_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|2001149_2001857_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|2001853_2002441_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 9
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	2253425	2373975	5496151	integrase,tail,head,tRNA,protease,portal,terminase,capsid,holin,lysis,transposase	Enterobacteria_phage(38.18%)	155	2319336:2319351	2347590:2347605
WP_000952736.1|2253425_2254247_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|2254402_2255449_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|2255445_2256240_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|2256406_2257525_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|2257493_2257763_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|2257824_2258214_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|2258346_2258862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|2258976_2259129_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|2259444_2259921_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2260045_2260369_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693962.1|2260352_2260778_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_137049477.1|2260846_2261884_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	81.4	5.5e-92
WP_001301518.1|2261915_2262338_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
WP_000451012.1|2262371_2263088_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_000017339.1|2263084_2263402_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
WP_001310212.1|2263398_2263701_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|2263690_2264008_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|2263961_2264279_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|2264265_2264703_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|2264704_2264896_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|2264898_2265486_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|2265601_2265706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2265894_2266107_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|2266274_2266553_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265159.1|2266554_2267604_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001217410.1|2267616_2267991_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|2267987_2268809_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|2269405_2269573_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023147.1|2269887_2271825_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	76.6	4.8e-291
WP_001213059.1|2271972_2272155_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|2272192_2272462_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|2272537_2272753_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|2272757_2273102_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2273152_2273686_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2273956_2274526_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2274525_2274672_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|2274899_2275106_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2275170_2275395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2275751_2275892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|2276021_2276207_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279796.1|2276248_2276614_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|2276905_2277469_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2277465_2279127_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2279190_2281128_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2281172_2281394_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2281339_2283841_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2283920_2284247_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2284256_2284607_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2284603_2285050_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2285046_2285391_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2285449_2286166_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2286180_2286555_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2286650_2286860_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2286907_2290150_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2290142_2290484_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|2290483_2291182_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|2291198_2291453_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|2291562_2291673_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2291975_2292854_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|2292907_2293645_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|2293590_2293827_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2293839_2293929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2293948_2296297_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2296887_2300289_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301834.1|2302392_2302518_+	hypothetical protein	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
WP_001303921.1|2302597_2302873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2302933_2304295_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|2304658_2305522_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2305505_2306642_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2306891_2308118_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2308166_2309288_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_085952403.1|2309649_2310863_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_032174463.1|2310861_2312079_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_000953272.1|2312443_2312632_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_125090562.1|2312681_2313008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106745.1|2313132_2313306_-	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	51.2	8.4e-06
WP_000226782.1|2313436_2313634_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|2313626_2313839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|2313828_2314293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|2314285_2314519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|2314524_2314824_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833626.1|2314820_2316221_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.3	3.6e-115
WP_000192401.1|2316421_2316673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|2316669_2317080_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|2317090_2317363_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|2317489_2317714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|2317965_2318172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153021227.1|2318171_2319227_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.9e-68
WP_000380883.1|2319239_2319575_+|head	head decoration protein	head	NA	NA	NA	NA
2319336:2319351	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|2319587_2320001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2320206_2320749_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|2321004_2321286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2321886_2323347_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2323346_2324018_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2324186_2325557_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2325560_2326202_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2326237_2327344_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2327397_2327859_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2327868_2328522_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2328693_2329944_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2330057_2331200_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088657.1|2331189_2331426_-	excisionase	NA	NA	NA	NA	NA
WP_000945520.1|2331529_2332354_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
WP_000788869.1|2332350_2333052_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2333048_2333351_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2333418_2333751_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2333815_2333938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|2333995_2335522_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|2336023_2336479_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2336478_2336649_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2336641_2336932_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2336928_2337291_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2337287_2337428_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2337424_2338114_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|2338435_2338741_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2338727_2339204_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2339420_2339603_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2339693_2339987_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|2340278_2340689_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2340974_2341181_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2341345_2341540_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2341928_2342474_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|2342448_2344374_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|2344370_2344577_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2344573_2346175_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2346155_2347475_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2347484_2347817_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
2347590:2347605	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063265.1|2347871_2348897_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2348938_2349337_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2349348_2349702_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|2349713_2350292_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|2350288_2350684_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|2350691_2351432_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2351447_2351870_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2351851_2352286_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|2352278_2354828_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|2354824_2355154_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2355153_2355852_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|2355857_2356601_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|2356537_2357170_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|2357230_2360629_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|2360695_2361295_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|2361359_2364275_+	membrane protein	NA	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|2364274_2364856_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|2364975_2365866_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2365884_2366391_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2366427_2366928_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2367006_2367189_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|2367686_2368355_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|2368411_2368660_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|2368735_2369116_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2369112_2369460_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2369509_2371048_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|2371350_2372835_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2373021_2373975_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 10
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	2458265	2656324	5496151	integrase,tail,head,protease,portal,terminase,capsid,holin,plate,transposase	Escherichia_phage(27.36%)	249	2462167:2462214	2609201:2609248
WP_000113674.1|2458265_2459396_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2459373_2459622_-	excisionase	NA	NA	NA	NA	NA
WP_000048549.1|2459686_2462158_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
2462167:2462214	attL	ACCTCATTACAGATTTAAGGGTGAACAAATCCCTGCCATTGCTGGCAT	NA	NA	NA	NA
WP_001090200.1|2462250_2462442_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2462438_2462627_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2463024_2463192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2463185_2463419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2463396_2463804_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2463826_2464045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2464117_2464417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2464680_2465088_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2465164_2465392_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2465375_2465927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2465898_2466939_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_001302276.1|2466970_2467393_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
WP_000774808.1|2467579_2468161_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|2468157_2468322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2469020_2469779_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2470057_2470270_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|2470490_2470748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2470817_2471096_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2471097_2472144_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2472156_2472516_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2472524_2473055_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2473296_2473494_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|2473644_2474703_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143067.1|2475499_2477353_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|2477502_2477718_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|2477722_2478067_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2478117_2478651_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2478921_2479491_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2479490_2479637_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2479864_2480050_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2480474_2480702_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2480743_2481109_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_137049461.1|2481398_2481962_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	83.9	3.8e-71
WP_001303049.1|2481958_2483620_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_000172999.1|2483683_2485621_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2485665_2485887_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2485832_2488334_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2488413_2488740_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2488749_2489100_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2489096_2489543_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2489539_2489884_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2489942_2490659_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2490664_2491039_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453746.1|2491134_2491344_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2491391_2494634_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2494626_2494968_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2494967_2495666_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_046671488.1|2495676_2496420_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_050439450.1|2496365_2496998_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2497340_2498516_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|2498467_2500813_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|2500880_2501480_+	outer membrane protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_024748516.1|2501631_2502945_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
WP_001023474.1|2502946_2503216_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2504242_2505568_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_000998048.1|2508232_2509771_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2509820_2510168_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2510164_2510545_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2510884_2511163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2511590_2511737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2511873_2512521_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2512704_2513295_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001302903.1|2515023_2515452_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	42.1	1.4e-22
WP_000147167.1|2516045_2516264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001500821.1|2516751_2517882_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	50.9	4.9e-102
WP_000113189.1|2517859_2518108_-	excisionase	NA	NA	NA	NA	NA
WP_000102181.1|2518172_2520617_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000092782.1|2520709_2520898_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2520894_2521083_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000380314.1|2521570_2521723_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000367559.1|2521892_2522282_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|2522384_2522660_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693888.1|2522643_2523069_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095667.1|2523091_2524045_+	DNA-binding protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000790456.1|2524051_2524792_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000450888.1|2524821_2525592_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_001118161.1|2525607_2526003_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|2526059_2526416_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|2526464_2526677_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|2526712_2527084_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610379.1|2527080_2527443_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_001278450.1|2527558_2527663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2527851_2528064_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001304183.1|2528593_2528872_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000904137.1|2529935_2530310_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762904.1|2530306_2531128_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000917735.1|2531354_2531552_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|2531702_2532761_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_137049463.1|2533252_2535103_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_000411802.1|2535550_2535757_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.4e-31
WP_000075112.1|2535756_2536254_+	lysozyme	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_001208680.1|2536470_2536656_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|2537183_2537498_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|2537579_2537804_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|2537845_2538211_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958387.1|2538499_2539063_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2539059_2540721_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2540784_2542722_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2542766_2542988_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2542933_2545435_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2545514_2545841_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2545850_2546201_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2546197_2546644_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2546640_2546985_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2547043_2547760_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2547765_2548140_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2548235_2548445_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2548497_2551740_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2551732_2552074_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000528251.1|2552234_2552972_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001310452.1|2552925_2553126_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|2553240_2553705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|2553743_2553989_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|2554024_2554207_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|2554353_2556393_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|2556492_2557053_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|2557275_2557479_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|2557558_2558080_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|2558114_2559026_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|2559025_2559586_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|2559576_2560659_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|2560658_2561096_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|2561088_2561703_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|2561692_2562817_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|2562800_2564150_-	DMT family permease	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113523.1|2564136_2566212_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	3.7e-71
WP_000213225.1|2566338_2566815_-	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|2566829_2567195_-|tail	phage tail protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|2567203_2568706_-|tail	tail protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|2568702_2568948_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|2568948_2569509_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|2569505_2569925_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_153021229.1|2569921_2570380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|2570423_2571371_-|head	head protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_000850811.1|2571370_2572495_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_000094804.1|2572671_2573145_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000046893.1|2573263_2574589_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000532593.1|2574572_2576162_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_001057672.1|2576161_2577826_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000360581.1|2577825_2578407_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279084.1|2578409_2578700_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000270159.1|2578696_2579005_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342746.1|2578985_2579213_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|2579222_2579441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|2579424_2579853_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|2579887_2580388_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|2580459_2580885_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214362.1|2580954_2581464_-	DUF1018 domain-containing protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000370523.1|2581460_2581757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|2581746_2581944_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000021235.1|2581936_2582269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|2582307_2582493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977060.1|2582489_2583041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465559.1|2583044_2583560_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000564283.1|2583559_2584093_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000323222.1|2584096_2584639_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_001129553.1|2584736_2585267_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049304.1|2585278_2585572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|2585576_2585849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|2585845_2586127_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|2586128_2586383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268103.1|2586395_2586617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|2586619_2587552_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000289290.1|2587622_2589713_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_001310454.1|2589714_2589963_-	transcriptional regulator	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000077537.1|2590153_2590684_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_153021230.1|2590965_2591343_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	98.0	4.9e-51
WP_000998048.1|2591464_2593003_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2593052_2593400_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_054249760.1|2593396_2593777_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	2.1e-65
WP_085949318.1|2593914_2595128_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	6.5e-169
WP_012779365.1|2595293_2598554_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_001304111.1|2598556_2598772_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2598839_2599439_+	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_137049465.1|2599503_2600817_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001023362.1|2600818_2601088_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2601203_2601779_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2602488_2603139_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2603721_2605260_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2605309_2605657_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2605653_2606034_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_016241229.1|2606996_2607311_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2607949_2609194_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2609286_2609475_-	DUF1482 family protein	NA	NA	NA	NA	NA
2609201:2609248	attR	ACCTCATTACAGATTTAAGGGTGAACAAATCCCTGCCATTGCTGGCAT	NA	NA	NA	NA
WP_000449175.1|2609471_2609660_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2610224_2610434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2610434_2611073_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2611084_2611237_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2611529_2611868_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2612259_2612502_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2612485_2612911_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2612979_2614023_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_001379651.1|2614054_2614477_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
WP_000450627.1|2614510_2615227_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2615259_2615541_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2615537_2615765_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2615757_2616069_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2616196_2616415_+	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2616416_2616974_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2617207_2617420_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2617539_2617884_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2618005_2618278_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2618279_2619329_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2619341_2619647_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2619709_2620264_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2620488_2620686_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2620822_2621536_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303509.1|2621990_2622419_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023185.1|2622896_2624747_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_000411805.1|2625195_2625402_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_000731259.1|2625406_2625751_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2625801_2626335_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2626605_2627175_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2627174_2627321_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2627543_2627729_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2628254_2628569_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2628650_2628875_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2629261_2629807_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2629781_2631707_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2631703_2631910_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2631906_2633508_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2633488_2634808_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2634817_2635150_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2635205_2636231_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2636272_2636671_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2636682_2637036_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2637050_2637584_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2637580_2637976_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2637983_2638736_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2638749_2639172_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2639198_2639612_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000847298.1|2642201_2642531_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001303044.1|2642530_2643229_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_001303043.1|2643239_2643983_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_129137391.1|2643928_2644561_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_137049467.1|2644807_2648287_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230509.1|2648354_2648954_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_024748460.1|2649018_2650332_+|tail	tail fiber protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001023407.1|2650333_2650603_+|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2650716_2651292_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2651364_2651994_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2652075_2652717_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_016241229.1|2652878_2653193_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2653252_2654536_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2654624_2656085_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2656120_2656324_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 11
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	2838216	2887836	5496151	integrase,tail,tRNA,protease,portal,terminase,holin	Escherichia_phage(46.0%)	56	2837616:2837641	2882475:2882500
2837616:2837641	attL	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_001023407.1|2838216_2838486_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_153021231.1|2838487_2839801_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
WP_001230496.1|2839865_2840465_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	1.3e-109
WP_153021232.1|2840531_2844011_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	95.9	0.0e+00
WP_153021239.1|2844251_2844881_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	97.6	3.3e-108
WP_153021233.1|2844826_2845570_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	97.6	1.2e-146
WP_131086657.1|2845580_2846279_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	2.4e-131
WP_000847298.1|2846278_2846608_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_153021234.1|2846604_2849250_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.5	0.0e+00
WP_000532075.1|2849293_2849602_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479059.1|2849628_2850051_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.9	1.3e-71
WP_000235090.1|2850064_2850817_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2850824_2851223_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_153021235.1|2851235_2851859_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	99.5	1.9e-100
WP_001281347.1|2851861_2852143_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	98.9	1.3e-45
WP_001097065.1|2852135_2852462_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001365078.1|2852549_2854529_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_000974567.1|2854518_2856021_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_000102415.1|2856020_2856233_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|2856229_2858353_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|2858349_2858826_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|2859343_2859529_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001092872.1|2860047_2860581_-	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	6.2e-100
WP_001041949.1|2861092_2861884_-	DUF1327 domain-containing protein	NA	Q08JA0	Stx2-converting_phage	85.5	5.7e-33
WP_000284523.1|2861887_2862103_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	98.6	5.9e-33
WP_001290230.1|2862180_2862426_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000142777.1|2862466_2862646_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_113589336.1|2862782_2864729_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	97.1	0.0e+00
WP_000640170.1|2866269_2866824_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	1.8e-70
WP_000228018.1|2866820_2867111_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	1.5e-47
WP_000940340.1|2867110_2867710_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.5	1.2e-107
WP_000818166.1|2868171_2868657_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119356.1|2868675_2868855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000128513.1|2869063_2869276_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	3.6e-27
WP_001278450.1|2869464_2869569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206794.1|2869684_2870269_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	83.5	5.5e-33
WP_001141093.1|2870325_2870718_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	61.9	5.9e-39
WP_050923614.1|2870733_2871504_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	67.6	5.7e-86
WP_000788990.1|2871525_2872272_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.9	2.8e-114
WP_000702023.1|2873147_2873570_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	5.3e-70
WP_000171139.1|2873553_2873829_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	65.9	1.4e-23
WP_001253182.1|2873933_2874398_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	69.5	1.2e-54
WP_057728717.1|2874637_2874790_+	DUF1391 domain-containing protein	NA	NA	NA	NA	NA
WP_000887681.1|2875201_2876050_+	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000560226.1|2876096_2876318_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_086259206.1|2876317_2876488_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.1	2.3e-24
WP_153021236.1|2876940_2879613_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	83.6	0.0e+00
WP_000166318.1|2879605_2880415_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.1	2.6e-105
WP_001302840.1|2880658_2880847_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2880946_2881162_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_024185869.1|2881163_2882399_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	6.7e-238
WP_001157382.1|2882450_2883386_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
2882475:2882500	attR	AAGAAAGAACAATACAACCTGAACAA	NA	NA	NA	NA
WP_000123746.1|2883514_2884888_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001625136.1|2884920_2885091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2885365_2886349_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2886603_2887836_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 12
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	2971462	3029747	5496151	tail,head,protease,portal,terminase,capsid,holin	Stx2-converting_phage(37.78%)	59	NA	NA
WP_000422055.1|2971462_2972512_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2972731_2973490_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2973486_2974077_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2974116_2974989_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2975201_2976785_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2976812_2977433_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2977429_2978311_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2978448_2978493_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2978584_2980147_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763503.1|2980146_2981742_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001416116.1|2981745_2983104_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.3	7.3e-36
WP_000209521.1|2983115_2984309_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2984308_2985115_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2985495_2985675_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2985760_2986261_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2986306_2986813_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_101972944.1|2992897_2993167_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_137049470.1|2993168_2994482_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.8	8.2e-85
WP_001230495.1|2994546_2995146_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	3.7e-109
WP_137049471.1|2995212_2998692_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.0	0.0e+00
WP_137049495.1|2998938_2999571_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	94.7	1.8e-106
WP_001303043.1|2999516_3000260_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_115442178.1|3000270_3000969_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	7.3e-133
WP_000807954.1|3000968_3001310_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3001302_3004545_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3004592_3004802_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_001030063.1|3004897_3005272_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3005277_3005994_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3006052_3006397_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3006393_3006840_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3006836_3007187_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3007196_3007523_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3007602_3010104_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3010049_3010271_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3010315_3012253_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001303049.1|3012316_3013978_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_001303051.1|3013974_3014538_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|3014827_3015193_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|3015234_3015462_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3015886_3016072_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3016299_3016446_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3016445_3017015_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3017285_3017819_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3017869_3018214_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000411805.1|3018218_3018425_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
WP_024748470.1|3018873_3020724_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_001303509.1|3021202_3021631_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|3022267_3022957_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|3022953_3023313_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|3023325_3024375_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|3024376_3024655_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3024822_3025035_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3025223_3025328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|3025443_3026028_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|3026084_3026480_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788936.1|3027290_3028031_-	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_000095670.1|3028037_3029000_-	DNA-binding protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000693943.1|3029022_3029448_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|3029444_3029747_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 13
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	3343315	3394437	5496151	integrase,tRNA,transposase,tail	Enterobacteria_phage(63.33%)	59	3336539:3336554	3394516:3394531
3336539:3336554	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|3343315_3345049_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|3345225_3345714_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|3345833_3346226_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|3346225_3348304_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|3348296_3349445_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|3349646_3350291_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3350301_3350691_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|3350705_3351755_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|3351757_3352618_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|3352636_3354238_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|3354283_3355945_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|3356087_3356591_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|3356611_3358576_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3358580_3359507_-	motility protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|3359503_3360391_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3360517_3361096_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|3361098_3361449_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|3362228_3362657_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|3362663_3364088_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|3364062_3364863_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|3365029_3366016_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_137049453.1|3366030_3367545_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	5.7e-13
WP_000548680.1|3367614_3368604_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|3369400_3369904_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|3369983_3370235_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3370349_3370436_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|3370697_3371021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3371191_3371689_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|3371725_3371965_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|3372156_3373368_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|3373429_3374095_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001303019.1|3374451_3375453_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
WP_000865208.1|3375458_3375806_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|3375835_3376486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|3376501_3376906_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|3376995_3377133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3377204_3377408_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3377429_3377780_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|3377790_3378069_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|3378080_3378323_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|3378319_3378433_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|3378525_3378942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3378965_3379169_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|3379165_3379432_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|3379428_3379728_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000775057.1|3380050_3380281_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
WP_000599379.1|3380353_3380719_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|3380725_3383548_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|3383624_3384584_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|3384588_3384903_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000257965.1|3386108_3386525_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	3.6e-63
WP_000954203.1|3386568_3387141_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|3387297_3387786_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000763327.1|3390588_3390717_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665314.1|3390752_3391118_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|3391172_3391685_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|3391684_3392869_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|3393026_3393350_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_032161583.1|3393300_3394437_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3394516:3394531	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 14
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	3452021	3519087	5496151	integrase,tail,head,portal,terminase,holin,transposase	Enterobacteria_phage(33.33%)	68	3467674:3467689	3523432:3523447
WP_001023396.1|3452021_3452291_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_088136427.1|3452292_3453462_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001230509.1|3453526_3454126_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_115333685.1|3454193_3456707_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.8	0.0e+00
WP_129137391.1|3457908_3458541_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_000194801.1|3458486_3459230_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|3459240_3459939_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3459938_3460268_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_128484525.1|3460264_3462844_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000533402.1|3462824_3463238_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3463264_3463696_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_137049450.1|3463709_3464450_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	6.1e-130
WP_001301534.1|3464431_3464698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000256723.1|3464755_3465103_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3465139_3466645_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3466634_3468227_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
3467674:3467689	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000259002.1|3468223_3468430_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3468413_3470342_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000235436.1|3470313_3470823_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001299328.1|3471217_3471442_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_001302690.1|3471523_3471838_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3472364_3472550_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001280929.1|3472777_3472909_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|3472921_3473104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992126.1|3473259_3473793_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_000731204.1|3473843_3474188_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000411809.1|3474192_3474399_-|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.4e-31
WP_085948178.1|3474718_3475931_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000023257.1|3476013_3477864_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_001059369.1|3479403_3480093_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000904141.1|3480089_3480449_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001265075.1|3480461_3481511_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_001310296.1|3481512_3481791_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_000902687.1|3481958_3482171_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001278460.1|3482357_3482462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137954.1|3482571_3483135_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_000111243.1|3483261_3483573_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_001414276.1|3483569_3483722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290006.1|3483754_3484111_-	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_000702797.1|3484107_3484332_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_000450610.1|3484353_3485052_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000373320.1|3485086_3485509_-	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_137049448.1|3485540_3486584_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	82.8	7.7e-86
WP_000693816.1|3486652_3487078_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261752.1|3487074_3487302_-	cell division protein	NA	NA	NA	NA	NA
WP_000444607.1|3487399_3488044_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_000367376.1|3488318_3488471_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000449168.1|3488951_3489140_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199485.1|3489136_3489325_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034457.1|3489420_3491892_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000094838.1|3491950_3492154_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_046671474.1|3492153_3493188_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.1e-99
WP_001302302.1|3493398_3494196_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_014714124.1|3494685_3502668_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_000480501.1|3502929_3503982_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378596.1|3504295_3505612_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|3505713_3507168_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532909.1|3507510_3508227_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122989775.1|3508852_3510496_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011000.1|3510613_3511564_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011474.1|3511665_3512583_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986334.1|3513039_3513975_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001193830.1|3514036_3515116_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|3515127_3515871_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973176.1|3515867_3516413_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001171554.1|3516774_3517155_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3517151_3517499_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3517548_3519087_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
3523432:3523447	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
>prophage 15
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	3620966	3721905	5496151	integrase,tail,tRNA,protease,portal,terminase,holin	Enterobacteria_phage(50.0%)	109	3674461:3674481	3719411:3719431
WP_000476014.1|3620966_3622328_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001303579.1|3622657_3622975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|3623380_3624280_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178551.1|3624361_3625141_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|3625240_3626281_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490697.1|3626328_3627684_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|3627687_3627972_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|3628002_3628455_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001301486.1|3629755_3630610_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|3630908_3631961_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000859148.1|3632217_3633495_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846238.1|3633491_3634496_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011970.1|3634492_3635458_+	kinase	NA	NA	NA	NA	NA
WP_000434038.1|3635431_3636178_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301907.1|3636229_3637048_-	glycosyl hydrolase 25 family protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000822268.1|3637112_3637913_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195634.1|3637909_3638698_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000141034.1|3639031_3639271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836936.1|3640321_3640669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735648.1|3640678_3640993_+	outer membrane protein	NA	NA	NA	NA	NA
WP_000019944.1|3641102_3641375_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134630.1|3641495_3642341_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153070.1|3642558_3642897_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001301545.1|3642978_3644013_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000945390.1|3644023_3646504_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677409.1|3646519_3647194_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000682830.1|3647281_3647824_-	fimbrial protein	NA	NA	NA	NA	NA
WP_010904812.1|3648115_3648397_-	DUF2574 family protein	NA	NA	NA	NA	NA
WP_001005448.1|3648658_3649768_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001301615.1|3649899_3651933_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001411921.1|3655895_3657176_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_000356841.1|3658889_3662519_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_000636932.1|3662580_3662898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|3664138_3665227_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_001294377.1|3665237_3666767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528951.1|3666785_3667517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302810.1|3667509_3668646_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_001416817.1|3668642_3670646_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	99.9	0.0e+00
WP_001295429.1|3670770_3671232_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3671273_3671744_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3671790_3672510_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001301761.1|3672506_3674192_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
3674461:3674481	attL	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001261939.1|3674706_3674955_+	DNA damage-inducible protein DinI	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001143784.1|3675116_3675758_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_072142879.1|3675839_3676256_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001023396.1|3676416_3676686_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_088136427.1|3676687_3677857_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001230508.1|3677921_3678521_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_024748476.1|3678588_3682068_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_071601640.1|3682308_3682938_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_000194801.1|3682883_3683627_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|3683637_3684336_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3684335_3684665_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000532073.1|3687350_3687659_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|3687685_3688108_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_137049441.1|3688121_3688874_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	8.4e-135
WP_000682716.1|3688881_3689280_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|3689292_3689916_-	hypothetical protein	NA	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|3689918_3690200_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|3690192_3690519_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114421.1|3690606_3692631_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_000974568.1|3692575_3694078_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_000102415.1|3694077_3694290_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077626.1|3694286_3696410_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000348565.1|3696406_3696883_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_012816791.1|3697400_3697586_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3697813_3697960_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3697959_3698529_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|3698799_3699333_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|3699337_3699553_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|3699630_3699876_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|3699916_3700096_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_000142932.1|3700233_3702180_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_001356551.1|3702983_3703136_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_001204769.1|3703384_3703819_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000971055.1|3703904_3704045_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001099712.1|3704041_3704404_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774504.1|3704400_3704691_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3704683_3704854_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053021.1|3704853_3705309_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072141214.1|3705305_3705407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|3705497_3705779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001481254.1|3705822_3706020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145928.1|3706247_3706532_-	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_000788906.1|3706528_3707230_-	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_001417283.1|3707226_3708156_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	8.9e-110
WP_001182876.1|3708242_3708782_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000712399.1|3709145_3709838_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001362421.1|3709944_3711552_+	hypothetical protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_023148105.1|3712055_3712346_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995395.1|3712421_3712718_+	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_000100847.1|3712723_3713509_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186740.1|3713505_3714183_+	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_032195523.1|3714182_3714365_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000548547.1|3714337_3714529_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001444000.1|3714539_3714821_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000763383.1|3714919_3715141_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001289954.1|3715137_3716085_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_001356547.1|3716086_3716263_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_000207903.1|3716596_3716953_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_000610375.1|3716949_3717312_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000457728.1|3717399_3717642_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000556583.1|3717645_3717780_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_001193437.1|3717798_3718053_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000063648.1|3718086_3719373_+|integrase	site-specific integrase	integrase	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_027868261.1|3719393_3720095_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
3719411:3719431	attR	CCCTGTCACGTTACGCGCGTG	NA	NA	NA	NA
WP_001216963.1|3720154_3720262_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3720242_3720974_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569336.1|3720978_3721905_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 16
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	3967499	3974199	5496151	integrase,transposase	Enterobacteria_phage(33.33%)	6	3957950:3957966	3969914:3969930
3957950:3957966	attL	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_000368131.1|3967499_3968432_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958700.1|3968743_3969901_+|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000257010.1|3970075_3971212_-	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
3969914:3969930	attR	TTCTTATAAAAAAGAAA	NA	NA	NA	NA
WP_085948178.1|3971413_3972626_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000403517.1|3973201_3973669_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_001005794.1|3973668_3974199_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
>prophage 17
NZ_CP040307	Escherichia coli strain F1 E4 chromosome, complete genome	5496151	4215913	4275293	5496151	integrase,tail,tRNA,holin,transposase	Enterobacteria_phage(31.58%)	60	4233361:4233375	4280252:4280266
WP_000997403.1|4215913_4216951_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4217157_4217577_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|4217645_4218344_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082974.1|4218375_4221036_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|4221149_4222505_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001322343.1|4222550_4222874_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852126.1|4222870_4224169_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001235102.1|4229944_4232518_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040152.1|4232647_4233379_-	polyphenol oxidase	NA	NA	NA	NA	NA
4233361:4233375	attL	GGACAATCAGCTTAC	NA	NA	NA	NA
WP_000079092.1|4233375_4234356_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|4234490_4235228_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|4235498_4235840_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|4235943_4235991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200120.1|4236089_4237250_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225204.1|4237292_4238414_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168032.1|4238424_4239495_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_001301878.1|4239704_4240070_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|4240219_4240738_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000969012.1|4240727_4241954_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|4241969_4242452_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|4242528_4242876_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|4242917_4243685_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|4243715_4244264_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|4244282_4244531_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|4244667_4246029_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|4246195_4246987_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077626229.1|4247008_4248295_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|4248349_4248943_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059175.1|4249065_4249944_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880924.1|4250029_4251691_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|4251839_4252181_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117844.1|4252242_4252533_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|4252522_4252999_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|4253130_4253613_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001217542.1|4254458_4254707_+	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001132157.1|4255208_4255799_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144077.1|4255981_4256632_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001301665.1|4256710_4257769_+	T3SS effector EspW	NA	NA	NA	NA	NA
WP_000442132.1|4257898_4258321_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001023396.1|4258481_4258751_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_001303014.1|4258752_4259319_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.3	7.9e-69
WP_000612591.1|4259368_4259716_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4259712_4260093_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000731241.1|4260449_4260794_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|4260798_4261014_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|4261163_4263017_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000499458.1|4263424_4263592_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
WP_001302581.1|4263677_4264421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|4264673_4265297_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028854.1|4265293_4265959_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001223948.1|4265955_4266567_-	protein ninG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001108081.1|4266541_4267108_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001254939.1|4267437_4268193_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001417601.1|4268228_4268531_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000150579.1|4268606_4269839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|4270234_4270648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001052051.1|4270745_4271144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059531.1|4271144_4272776_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000428092.1|4272772_4274086_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000540864.1|4274087_4275293_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4280252:4280266	attR	GGACAATCAGCTTAC	NA	NA	NA	NA
>prophage 1
NZ_CP040308	Escherichia coli strain F1 E4 plasmid pO157, complete sequence	95642	8200	60704	95642	protease,transposase,integrase	Macacine_betaherpesvirus(35.71%)	46	NA	NA
WP_001034097.1|8200_12103_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_071525077.1|13499_13679_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001302199.1|14280_15102_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|15101_16208_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|16297_18019_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|18092_19091_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000998048.1|19409_20948_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|20997_21345_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|21341_21722_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_072141201.1|22423_25120_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|25206_26082_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001449993.1|26139_28050_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|28049_29555_+	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_001173152.1|29556_30780_+	type II secretion system protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|30810_31245_+	type II secretion system protein GspG	NA	NA	NA	NA	NA
WP_000082929.1|31241_31796_+	type II secretion system protein GspH	NA	NA	NA	NA	NA
WP_000173396.1|31810_32158_+	type II secretion system protein GspI	NA	NA	NA	NA	NA
WP_000082782.1|32154_32754_+	type II secretion system protein GspJ	NA	NA	NA	NA	NA
WP_000776550.1|32750_33728_+	general secretion pathway protein GspK	NA	NA	NA	NA	NA
WP_071525076.1|33766_34939_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|34925_35438_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|35495_36329_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|36420_36822_+	lipoprotein, PulS/OutS family	NA	NA	NA	NA	NA
WP_000839950.1|38712_39228_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000217739.1|39229_42226_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|42275_44396_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|44399_45839_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_001303402.1|45905_46100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358890.1|46129_46414_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010891288.1|46582_46813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|46933_47674_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|47958_48936_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|49343_49544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|49540_50161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|50157_50841_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|51299_51518_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|51519_51825_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|51825_52632_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_077631973.1|53308_53389_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	1.5e-07
WP_085948178.1|53354_54568_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_000852148.1|54643_55399_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|55986_57153_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|57152_58124_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|58732_59635_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|59638_59944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|60020_60704_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
