The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045538	Proteus mirabilis strain CRE14IB chromosome, complete genome	4018329	51872	113152	4018329	integrase,head,terminase,tRNA,protease,plate,holin,portal,tail,lysis,capsid	Salmonella_phage(32.5%)	70	66737:66784	96117:96164
WP_004246449.1|51872_52376_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_017628693.1|52387_53554_-	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	56.9	3.8e-118
WP_152964409.1|53787_54735_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_152964410.1|55724_56858_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_152964411.1|56854_57262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964412.1|57991_59119_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_152964413.1|59085_60252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964414.1|60229_61468_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_152964415.1|61480_61897_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	43.2	6.9e-14
WP_152964416.1|61893_63414_-	asparagine synthase	NA	A0A1V0SGM7	Hokovirus	31.1	9.6e-29
WP_004249722.1|63786_65178_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	27.3	3.4e-20
WP_004246432.1|65190_65889_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	8.1e-07
WP_004249721.1|66072_66639_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
66737:66784	attL	GACACCATCCCTGTCTTTTGCAGCCCCTCTGGAGAGGGGCTTTTTTTT	NA	NA	NA	NA
WP_113976860.1|66934_67915_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	62.9	9.7e-115
WP_071233827.1|67981_68275_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	59.8	1.1e-26
WP_152964417.1|68404_68677_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	56.7	1.6e-22
WP_049220106.1|68678_68867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964418.1|68863_69016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964419.1|69032_69302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113976858.1|69351_69747_+	DUF5347 family protein	NA	NA	NA	NA	NA
WP_152964420.1|69764_70022_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_012368208.1|70014_70236_+	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	52.1	2.6e-12
WP_152964421.1|70237_71065_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.8	3.0e-61
WP_036908532.1|71064_71388_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_152964422.1|71387_73766_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.2	2.7e-163
WP_152964423.1|73972_74653_+	hypothetical protein	NA	V9IQL5	Stenotrophomonas_phage	27.7	1.4e-16
WP_152964424.1|74723_75119_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_152964425.1|75599_76628_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	68.1	2.1e-136
WP_087726283.1|76627_78382_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	73.4	1.8e-260
WP_152964426.1|78554_79364_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.8	1.4e-66
WP_152964427.1|79379_80525_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	67.3	6.8e-128
WP_087726281.1|80524_81193_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.6	9.4e-45
WP_109397510.1|81270_81726_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.9	8.4e-29
WP_012368195.1|81725_81932_+|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	52.9	1.3e-16
WP_109397508.1|81951_82266_+|holin	holin	holin	NA	NA	NA	NA
WP_168713134.1|82252_82663_+	M15 family metallopeptidase	NA	K4F776	Cronobacter_phage	60.5	8.6e-41
WP_152964429.1|82659_83163_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_152964430.1|83137_83575_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	48.6	9.2e-33
WP_152964431.1|83564_84200_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	35.3	4.4e-28
WP_152964637.1|84265_84892_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	59.1	5.9e-57
WP_036907670.1|84888_85227_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	49.5	8.4e-26
WP_152964432.1|85226_86135_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	66.6	2.8e-108
WP_152964638.1|86127_86739_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	69.4	6.5e-77
WP_152964433.1|86728_88381_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	46.1	3.3e-59
WP_152964434.1|88470_89643_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	70.6	2.1e-164
WP_152964435.1|89646_90162_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	55.6	2.5e-53
WP_152964436.1|90181_90529_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	54.5	1.3e-18
WP_072070684.1|90489_90663_+|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	52.6	5.6e-10
WP_152964437.1|90655_93490_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	38.3	3.3e-99
WP_036907694.1|93489_93954_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.4	3.3e-41
WP_152964438.1|93953_95054_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	54.7	4.7e-110
WP_006536728.1|95106_95325_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	70.3	2.2e-19
WP_064505875.1|95371_95575_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	6.6e-10
WP_081353461.1|95760_95994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163939956.1|96229_97015_-	glycosyltransferase family 25 protein	NA	A0A1V0SAA0	Catovirus	25.7	2.2e-05
96117:96164	attR	GACACCATCCCTGTCTTTTGCAGCCCCTCTGGAGAGGGGCTTTTTTTT	NA	NA	NA	NA
WP_036895948.1|98445_99201_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_004246429.1|99739_100717_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_004249900.1|101010_102015_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004249716.1|102110_102881_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_012368676.1|102987_103623_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_112843197.1|103734_104163_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_004249898.1|104223_104970_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_004246423.1|105308_106493_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.2	2.0e-13
WP_004246422.1|106602_108135_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_004246421.1|108177_108993_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	28.4	2.9e-16
WP_012368679.1|109289_109532_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_004246419.1|109625_110144_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_020946557.1|110252_111170_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_004246417.1|111268_112609_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	27.1	8.7e-42
WP_004246416.1|112621_113152_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP045538	Proteus mirabilis strain CRE14IB chromosome, complete genome	4018329	347339	397112	4018329	tRNA,integrase,transposase	Paramecium_bursaria_Chlorella_virus(12.5%)	49	343618:343634	391110:391126
343618:343634	attL	AATATATCAATTTTATT	NA	NA	NA	NA
WP_152964447.1|347339_347756_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	64.8	2.9e-44
WP_152964448.1|347778_348987_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.3	4.4e-186
WP_004249589.1|349064_349943_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_004246211.1|349957_350953_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_004249588.1|351168_351702_+	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_020946636.1|351695_352199_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_036894069.1|352215_352497_-	GIY-YIG nuclease family protein	NA	Q06VJ4	Trichoplusia_ni_ascovirus	47.2	6.1e-14
WP_004246207.1|352783_353035_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004246206.1|353150_353591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246205.1|353599_353977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246204.1|354143_354353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246203.1|354379_354844_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2H5BH04	Vibrio_virus	60.4	5.0e-53
WP_004246202.1|354848_356987_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	63.8	1.6e-263
WP_017628758.1|356976_357291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004246200.1|357332_357719_-	RidA family protein	NA	NA	NA	NA	NA
WP_004246198.1|358056_358515_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_004246197.1|358528_359464_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	2.9e-52
WP_004252960.1|359456_359636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246195.1|359815_360820_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_004246194.1|361001_361433_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_152964449.1|361529_362399_-	pirin family protein	NA	NA	NA	NA	NA
WP_004246189.1|362707_362875_-	YhfL family protein	NA	NA	NA	NA	NA
WP_004249583.1|363289_363799_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004252953.1|364199_367088_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.8	3.7e-146
WP_004246185.1|367101_367551_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_004246183.1|367631_369140_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	8.3e-49
WP_004249580.1|369426_370524_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_004246180.1|370523_371603_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_168713135.1|371691_372909_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_004915968.1|374782_376048_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	42.2	1.7e-87
WP_008913927.1|376496_376781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964450.1|377107_377692_+	antirestriction protein ArdA	NA	A0A0A8WIV6	Clostridium_phage	40.9	1.1e-25
WP_152964451.1|378363_379803_-	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_152964452.1|380733_380931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964453.1|380954_381977_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	49.5	1.1e-89
WP_113532875.1|382085_382847_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.9	7.5e-14
WP_152964454.1|382874_384953_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_014657219.1|384987_385416_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
WP_152964455.1|385421_386567_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_042117123.1|386671_387433_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	46.8	2.6e-19
WP_152964456.1|387436_388603_-	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	55.8	9.4e-117
WP_152964457.1|388633_389482_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_152914939.1|389481_390261_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_152914938.1|390250_391384_-	glycosyltransferase	NA	NA	NA	NA	NA
391110:391126	attR	AATATATCAATTTTATT	NA	NA	NA	NA
WP_152914937.1|391385_392261_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_163939957.1|392260_393448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163939958.1|393425_394244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964286.1|394298_395507_-|transposase	IS4 family transposase	transposase	Q9E8P4	Bluetongue_virus	98.8	4.8e-233
WP_152964459.1|396414_397112_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.0e-62
>prophage 3
NZ_CP045538	Proteus mirabilis strain CRE14IB chromosome, complete genome	4018329	1126235	1138201	4018329		Mycobacterium_phage(25.0%)	13	NA	NA
WP_004246075.1|1126235_1127435_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_004247427.1|1128043_1129012_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_075206322.1|1129037_1131164_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.2e-205
WP_004246072.1|1131192_1131597_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|1131608_1131833_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_017827772.1|1132114_1132588_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1132785_1132995_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_163939955.1|1133178_1133319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|1134064_1134439_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|1134454_1135420_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|1135521_1136166_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|1136527_1136791_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|1136989_1138201_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 4
NZ_CP045538	Proteus mirabilis strain CRE14IB chromosome, complete genome	4018329	1337368	1416324	4018329	plate,protease,tRNA	Bacillus_phage(17.65%)	58	NA	NA
WP_004244558.1|1337368_1337683_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|1337713_1340008_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|1340127_1340346_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004247616.1|1340665_1341358_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_112843271.1|1341359_1343111_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	3.0e-18
WP_020945408.1|1343113_1344883_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004252032.1|1345024_1345984_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	3.4e-64
WP_004244566.1|1346526_1347021_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_152964533.1|1347148_1350946_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|1351058_1351664_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|1351674_1353024_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244571.1|1353157_1354447_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_004252020.1|1354626_1354959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020945410.1|1355357_1356407_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_152964534.1|1356479_1357385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|1357744_1358485_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|1358592_1360875_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|1360929_1361784_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_152964535.1|1362453_1364211_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_004244579.1|1364438_1365476_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_049221441.1|1365550_1366825_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_143474787.1|1366961_1368392_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.6	1.2e-07
WP_004244582.1|1368528_1369617_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_004252010.1|1369813_1371100_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_020945417.1|1371388_1372066_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|1372247_1373921_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|1373985_1374273_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_143474786.1|1374694_1377064_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.7	3.6e-22
WP_004244589.1|1377100_1378846_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	8.4e-61
WP_004244590.1|1378842_1379844_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|1380339_1380555_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|1380969_1381149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|1381153_1381915_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_046335153.1|1382038_1382869_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004244596.1|1383248_1384022_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|1384031_1385354_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|1385334_1386066_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_152964536.1|1386062_1390520_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_060554589.1|1390801_1391455_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	79.9	2.4e-101
WP_041701075.1|1391860_1392574_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_112843276.1|1392916_1394632_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|1394963_1395512_+	YcbK family protein	NA	NA	NA	NA	NA
WP_004247640.1|1395561_1396212_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|1396304_1396778_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004244608.1|1396868_1398605_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_004244609.1|1398597_1399953_-	membrane protein	NA	NA	NA	NA	NA
WP_004244610.1|1399990_1403539_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_152964537.1|1403541_1405005_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|1405010_1405661_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|1405662_1406451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964538.1|1406454_1409166_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
WP_004244617.1|1409174_1409930_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004247647.1|1409922_1411281_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|1411282_1411834_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|1411835_1413104_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244621.1|1413108_1414146_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_017628432.1|1414109_1415885_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244624.1|1415892_1416324_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP045538	Proteus mirabilis strain CRE14IB chromosome, complete genome	4018329	1495853	1532205	4018329	integrase,head,terminase,tRNA,lysis	Pectobacterium_phage(24.32%)	50	1486331:1486344	1506294:1506307
1486331:1486344	attL	ATTTATCAGCATTA	NA	NA	NA	NA
WP_060557151.1|1495853_1497029_-|integrase	site-specific integrase	integrase	A0A2D1GN00	Marinobacter_phage	32.2	5.5e-32
WP_152964545.1|1497030_1497243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164527448.1|1497657_1497828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250516.1|1497855_1498035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074924453.1|1498082_1498583_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	56.4	2.1e-41
WP_150452763.1|1498582_1500550_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.1	1.0e-115
WP_004250523.1|1500562_1500823_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	45.3	7.9e-08
WP_036908171.1|1500822_1501155_-	hypothetical protein	NA	H9C158	Pectobacterium_phage	39.2	2.1e-05
WP_074924455.1|1501710_1502493_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_074924456.1|1502551_1503205_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	67.0	7.7e-76
WP_074924457.1|1503286_1503472_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	49.2	5.1e-09
WP_074924458.1|1503551_1504007_+|tRNA	tRNA-(guanine-N1)-methyltransferase	tRNA	H9C162	Pectobacterium_phage	54.7	3.8e-29
WP_004250533.1|1504024_1504249_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	9.5e-18
WP_152964546.1|1504250_1505081_+	replication protein	NA	H9C164	Pectobacterium_phage	59.3	4.4e-36
WP_041701082.1|1505070_1506489_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	61.2	1.4e-170
1506294:1506307	attR	TAATGCTGATAAAT	NA	NA	NA	NA
WP_049210194.1|1506543_1506720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335187.1|1506722_1506956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250545.1|1506952_1507564_+	hypothetical protein	NA	H2BDG4	Pseudomonas_virus	48.0	7.0e-47
WP_046335186.1|1507609_1507948_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	57.9	8.7e-31
WP_152964547.1|1508025_1508619_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	55.3	6.6e-58
WP_109910691.1|1508630_1508942_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	69.8	2.6e-34
WP_109910690.1|1508976_1509528_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	44.9	7.5e-32
WP_152964548.1|1509643_1510276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964549.1|1510396_1510558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250558.1|1510867_1511137_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	3.3e-17
WP_104836572.1|1511136_1511607_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	57.5	2.9e-48
WP_109910688.1|1511749_1512214_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	76.0	1.0e-45
WP_115353734.1|1512801_1513812_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	36.1	6.4e-37
WP_168713138.1|1514019_1515624_+	TerL protein	NA	A9YWZ6	Burkholderia_phage	64.1	2.1e-199
WP_088206688.1|1515628_1517131_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	42.0	6.0e-100
WP_049197370.1|1517168_1517882_+|head	head protein	head	A0A2H5BG15	Pseudoalteromonas_phage	35.6	7.9e-34
WP_087726615.1|1517878_1519138_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	51.3	1.2e-45
WP_049209851.1|1519137_1519635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250578.1|1519634_1520702_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.3	1.1e-52
WP_109023906.1|1520771_1521113_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	35.5	2.7e-08
WP_082151820.1|1521115_1521547_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	32.4	1.5e-11
WP_049256452.1|1521546_1522005_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	39.6	1.1e-12
WP_020945484.1|1522004_1522376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109910684.1|1522362_1522878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109927582.1|1522886_1524374_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	38.3	4.6e-84
WP_004250586.1|1524384_1524837_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.1	5.8e-22
WP_004250588.1|1524877_1525336_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
WP_152964550.1|1525419_1527714_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	26.2	6.1e-19
WP_109910682.1|1527710_1528238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109910681.1|1528237_1528555_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	4.3e-08
WP_109910680.1|1528520_1529336_+	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.0	2.4e-10
WP_109910679.1|1529338_1530031_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	5.3e-35
WP_004250600.1|1530027_1530372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109910678.1|1530364_1531552_+	hypothetical protein	NA	Q6IWQ3	Burkholderia_phage	40.6	2.6e-69
WP_152964551.1|1531548_1532205_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.3	9.9e-39
>prophage 6
NZ_CP045538	Proteus mirabilis strain CRE14IB chromosome, complete genome	4018329	1617325	1667551	4018329	integrase,terminase,tRNA,protease,portal,lysis,tail,transposase	Enterobacteria_phage(29.41%)	54	1617147:1617162	1660987:1661002
1617147:1617162	attL	TATTTGATTACCATAA	NA	NA	NA	NA
WP_152964561.1|1617325_1618429_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|1618534_1618987_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_020945526.1|1618979_1619609_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004247120.1|1619747_1621001_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
WP_036894692.1|1621165_1622461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964562.1|1622457_1623585_-|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	60.9	8.8e-128
WP_110229340.1|1623565_1623808_-	excisionase	NA	NA	NA	NA	NA
WP_108717285.1|1624064_1624712_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	44.0	3.7e-46
WP_063073918.1|1625042_1626116_+	hypothetical protein	NA	A0A2H4JEZ8	uncultured_Caudovirales_phage	36.3	6.4e-27
WP_129623633.1|1626128_1626527_+	antitermination protein Q	NA	B6SCZ7	Bacteriophage	54.5	1.3e-30
WP_012367807.1|1626748_1627009_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049202015.1|1627163_1627421_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004247850.1|1627426_1627699_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	67.2	1.3e-16
WP_004247851.1|1628005_1628212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109372922.1|1630241_1630436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964563.1|1630509_1631532_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	70.1	6.9e-132
WP_049210581.1|1631781_1631979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964646.1|1632124_1632388_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	46.5	1.6e-16
WP_063073925.1|1632387_1632858_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	59.9	4.0e-50
WP_063073926.1|1633000_1633462_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.7	5.5e-12
WP_063073927.1|1633701_1634277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073928.1|1634343_1634622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247866.1|1635092_1635605_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	64.0	1.1e-58
WP_126656776.1|1635617_1636112_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	65.6	1.3e-48
WP_152964564.1|1636108_1638211_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	68.9	1.7e-294
WP_004247869.1|1638207_1638423_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	64.3	1.2e-17
WP_152964565.1|1638419_1639910_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	67.4	1.5e-191
WP_152964566.1|1639875_1641906_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	62.0	1.4e-240
WP_152964567.1|1641994_1642345_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	48.6	5.3e-15
WP_152964568.1|1642355_1642628_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	44.9	3.1e-15
WP_063073895.1|1642637_1643201_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	57.1	6.2e-50
WP_036973524.1|1643200_1643596_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	59.5	2.2e-41
WP_152964569.1|1643607_1644129_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	74.7	2.9e-65
WP_074561718.1|1644140_1644530_+|tail	phage minor tail protein G	tail	K7PJY4	Enterobacterial_phage	41.0	3.1e-16
WP_152964570.1|1644550_1644871_+|tail	phage tail assembly protein T	tail	K7PHE1	Enterobacteria_phage	41.5	3.3e-16
WP_152964571.1|1644839_1647833_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	31.5	8.3e-109
WP_152964572.1|1647833_1648163_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	55.0	5.1e-28
WP_152964573.1|1648183_1648477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964574.1|1648523_1649228_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	51.1	1.6e-66
WP_110229325.1|1649249_1649978_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	61.5	2.3e-89
WP_080973411.1|1649947_1650532_+|tail	tail assembly protein	tail	K7PH50	Enterobacteria_phage	48.0	3.1e-44
WP_152964575.1|1650546_1653750_+	DUF1983 domain-containing protein	NA	A0A0P0ZBW1	Stx2-converting_phage	55.3	1.9e-276
WP_049209900.1|1653739_1654072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964576.1|1654071_1654758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247891.1|1654754_1655021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964577.1|1655037_1655370_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	60.8	5.5e-22
WP_152964578.1|1655359_1656634_+	hypothetical protein	NA	A0A2H4PRH0	Proteus_phage	52.8	8.2e-98
WP_108717017.1|1657440_1658070_-	TIGR02646 family protein	NA	NA	NA	NA	NA
WP_108717016.1|1658066_1659656_-	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	34.5	5.4e-14
WP_152964579.1|1659636_1660599_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_004247902.1|1661092_1661257_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-22
1660987:1661002	attR	TTATGGTAATCAAATA	NA	NA	NA	NA
WP_049221303.1|1662091_1662409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049221300.1|1662481_1663642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964580.1|1666390_1667551_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.9	1.2e-39
>prophage 7
NZ_CP045538	Proteus mirabilis strain CRE14IB chromosome, complete genome	4018329	1910464	1920456	4018329		Escherichia_phage(66.67%)	8	NA	NA
WP_004242885.1|1910464_1912522_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	4.8e-31
WP_004248043.1|1912533_1914234_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|1914569_1915256_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|1915255_1915717_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242890.1|1915769_1916381_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_004242891.1|1916520_1917381_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.5	3.7e-25
WP_004242892.1|1917382_1918000_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_020945635.1|1918011_1920456_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	3.3e-220
>prophage 8
NZ_CP045538	Proteus mirabilis strain CRE14IB chromosome, complete genome	4018329	2444339	2461645	4018329	holin	Burkholderia_phage(21.43%)	21	NA	NA
WP_004243609.1|2444339_2444957_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_152964242.1|2444960_2445737_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.4	2.5e-41
WP_063108406.1|2445852_2446395_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	3.2e-19
WP_017628013.1|2446963_2447143_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_112843326.1|2447298_2447721_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_112843325.1|2447861_2448098_-	hypothetical protein	NA	F1BUK2	Cronobacter_phage	33.8	1.4e-06
WP_004243615.1|2449409_2450066_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_049197274.1|2450062_2451250_-	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.9	1.4e-72
WP_004243617.1|2451242_2451587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049197272.1|2451583_2452276_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	37.1	1.6e-34
WP_004243622.1|2452278_2453091_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2453059_2453380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243624.1|2453392_2453881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112843323.1|2453883_2456187_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	1.1e-15
WP_004243627.1|2456269_2456728_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_004243628.1|2456787_2457240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020945912.1|2457250_2458738_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.4e-77
WP_012368090.1|2458746_2459259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112843322.1|2459740_2460145_-	structural protein	NA	A0A1B1IQT0	uncultured_Mediterranean_phage	40.8	3.5e-18
WP_004248367.1|2460147_2460447_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_112843321.1|2460829_2461645_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.1	2.1e-54
>prophage 9
NZ_CP045538	Proteus mirabilis strain CRE14IB chromosome, complete genome	4018329	2651408	2727598	4018329	integrase,head,tRNA,terminase,protease,tail,portal,lysis,transposase,capsid	Morganella_phage(19.23%)	85	2660593:2660610	2741255:2741272
WP_004248453.1|2651408_2651939_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	31.5	1.4e-06
WP_004243886.1|2652251_2652512_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	47.7	4.6e-16
WP_004243887.1|2652541_2652922_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004243888.1|2652921_2653653_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004243889.1|2653722_2654463_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_152964250.1|2654475_2655384_-	GTPase Era	NA	NA	NA	NA	NA
WP_004248457.1|2655380_2656061_-	ribonuclease III	NA	A0A0P0BX11	Ostreococcus_lucimarinus_virus	31.9	8.1e-20
WP_004248458.1|2656256_2657228_-	signal peptidase I	NA	NA	NA	NA	NA
WP_004243894.1|2657242_2659039_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.2	2.7e-22
WP_004243895.1|2659360_2659825_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_004243896.1|2659837_2660809_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
2660593:2660610	attL	CAGGTTTACCATCGACAA	NA	NA	NA	NA
WP_004243897.1|2660857_2661517_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_004243899.1|2661518_2662097_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_020945959.1|2662397_2663156_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_004248459.1|2664931_2665315_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	67.0	2.0e-31
WP_149127602.1|2665326_2665551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368143.1|2665649_2666330_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	47.2	1.7e-57
WP_004243909.1|2666421_2667033_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004243910.1|2667134_2668034_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_004248462.1|2668119_2669781_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004243912.1|2669894_2670257_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004243913.1|2670389_2670683_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004243914.1|2670675_2671110_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004243915.1|2671266_2671749_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	49.4	4.3e-31
WP_104836561.1|2672535_2672910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836562.1|2673300_2673606_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_152964251.1|2673798_2675097_-	hypothetical protein	NA	A0A1W6JNZ8	Morganella_phage	31.1	3.3e-54
WP_152964252.1|2675170_2676184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964253.1|2676173_2679911_-	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	48.1	3.6e-186
WP_049210594.1|2679911_2680310_-	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	47.7	4.1e-32
WP_152964254.1|2680364_2680640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964255.1|2680653_2681235_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	8.4e-50
WP_152964256.1|2681231_2681831_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	55.4	6.9e-55
WP_152964257.1|2681831_2685134_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	44.3	5.4e-194
WP_017827267.1|2685390_2685741_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	40.5	6.2e-16
WP_152964258.1|2685740_2686217_-|tail	phage tail protein	tail	Q7Y403	Yersinia_phage	75.5	1.5e-57
WP_026164627.1|2686239_2686632_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	57.9	1.2e-31
WP_017827270.1|2686640_2687030_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	50.0	1.0e-30
WP_071233556.1|2687016_2687343_-|head	phage head closure protein	head	Q7Y406	Yersinia_phage	45.8	2.0e-16
WP_036901048.1|2687342_2687648_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	56.2	1.9e-24
WP_071233557.1|2687741_2688950_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	65.7	2.2e-145
WP_036904957.1|2688963_2689614_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	80.0	5.6e-95
WP_071233558.1|2689585_2690815_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	74.0	2.9e-177
WP_049219082.1|2690814_2690994_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	57.4	1.2e-10
WP_152964259.1|2691003_2692737_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	95.9	0.0e+00
WP_049218005.1|2692740_2693211_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	81.4	7.7e-70
WP_049218006.1|2693358_2693556_-	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	87.7	6.4e-26
WP_087741133.1|2693552_2693903_-	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	95.6	2.4e-60
WP_087741132.1|2693968_2694334_-	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	73.3	3.3e-44
WP_049218009.1|2694380_2694689_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	65.7	1.4e-32
WP_004250565.1|2695199_2695661_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.0	8.5e-13
WP_049257301.1|2695803_2696274_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	57.5	2.2e-48
WP_004250558.1|2696273_2696543_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	3.3e-17
WP_129623577.1|2696905_2697169_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_152964260.1|2697148_2697328_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_152964261.1|2697441_2698464_-	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	67.8	1.8e-132
WP_152964262.1|2698537_2698732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060961278.1|2698890_2699571_-	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	50.5	3.3e-53
WP_152964263.1|2699598_2700624_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	48.0	4.4e-86
WP_152964264.1|2700620_2701424_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	63.1	8.8e-90
WP_060961275.1|2701442_2701829_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	52.4	2.4e-29
WP_152964265.1|2701891_2702293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964629.1|2702289_2702928_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	63.6	5.6e-79
WP_152964266.1|2702924_2704046_-	replication protein 15	NA	K7PLZ7	Enterobacterial_phage	56.6	5.2e-48
WP_036904897.1|2704055_2704235_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	56.9	8.1e-12
WP_004251659.1|2704231_2704405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036900998.1|2704492_2704951_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	6.0e-27
WP_036904893.1|2705019_2705232_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	65.2	6.6e-21
WP_152964267.1|2705272_2705935_+	helix-turn-helix domain-containing protein	NA	A0A1R3Y604	Salmonella_virus	54.4	3.3e-18
WP_036900991.1|2706287_2706491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074924366.1|2706718_2707615_+	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	59.7	1.7e-97
WP_017827302.1|2708221_2708719_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	64.9	7.4e-47
WP_152964630.1|2708752_2708932_+	hypothetical protein	NA	A0A1P8DTH9	Proteus_phage	98.2	6.8e-27
WP_152964268.1|2708934_2709630_+	hypothetical protein	NA	R9VWB9	Serratia_phage	51.5	4.4e-61
WP_064506363.1|2709629_2710025_+	hypothetical protein	NA	S4TTI6	Salmonella_phage	53.2	2.6e-26
WP_126656794.1|2710249_2711431_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	69.9	4.8e-153
WP_152964269.1|2711729_2712929_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	47.5	2.2e-105
WP_152964270.1|2713103_2714480_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_152964271.1|2714701_2716057_-	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_152964272.1|2717701_2718610_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_152964273.1|2718612_2719902_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_152964274.1|2720527_2720767_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	1.7e-20
WP_152964275.1|2722715_2722943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964276.1|2723876_2724440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964277.1|2726437_2727598_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.9	1.2e-39
2741255:2741272	attR	TTGTCGATGGTAAACCTG	NA	NA	NA	NA
>prophage 10
NZ_CP045538	Proteus mirabilis strain CRE14IB chromosome, complete genome	4018329	2987897	3065507	4018329	integrase,terminase,tRNA,protease,holin,tail,lysis,capsid	Morganella_phage(30.16%)	106	3002442:3002488	3051458:3051504
WP_152964300.1|2987897_2990909_-|tail	phage tail tape measure protein	tail	A0A2H4P6I1	Salmonella_phage	35.5	2.4e-124
WP_152964301.1|2990896_2991238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964302.1|2991247_2991424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964303.1|2991631_2992069_-	osmoprotectant transporter ProQ	NA	A0A1W6JPI6	Morganella_phage	60.3	3.3e-14
WP_152964304.1|2992388_2995136_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	47.8	4.8e-228
WP_036907517.1|2995132_2995477_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.9	3.7e-45
WP_152964305.1|2995491_2996088_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.8	4.9e-29
WP_049257504.1|2996087_2996273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162837557.1|2996272_2996446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334701.1|2996442_2997054_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	46.3	3.3e-20
WP_036907509.1|2997050_2997260_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
WP_152964306.1|2997256_2997451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151252795.1|2997453_2997627_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_152964632.1|2997619_2998117_-	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	65.2	3.5e-44
WP_036907503.1|2998667_2999261_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	76.1	1.5e-81
WP_036918890.1|2999273_2999669_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	56.9	2.1e-28
WP_099432957.1|2999668_2999887_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.3	6.6e-08
WP_099432956.1|3000127_3000523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964307.1|3000555_3000855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064497271.1|3001066_3002278_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.0	2.2e-129
3002442:3002488	attL	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_152964308.1|3002662_3002887_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	86.6	8.8e-24
WP_152964309.1|3002891_3004232_-	hypothetical protein	NA	A0A1W6JNZ8	Morganella_phage	31.1	2.0e-54
WP_152964252.1|3004305_3005319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964310.1|3005308_3009487_-	DUF1983 domain-containing protein	NA	A0A1W6JNW2	Morganella_phage	75.8	0.0e+00
WP_036935929.1|3009486_3010053_-|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	77.4	1.4e-49
WP_152964311.1|3009989_3010709_-|tail	phage tail protein	tail	A0A1W6JNU8	Morganella_phage	74.0	2.4e-110
WP_049199072.1|3010712_3011411_-|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	83.6	1.8e-115
WP_063109161.1|3011407_3011737_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	72.5	7.3e-43
WP_036908263.1|3011882_3012092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908264.1|3012081_3012306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964312.1|3012321_3015654_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	47.2	1.3e-214
WP_135024820.1|3015718_3016027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036908824.1|3016149_3016944_-	hypothetical protein	NA	A0A2I7RX10	Vibrio_phage	42.7	8.0e-43
WP_152964633.1|3017021_3017591_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	61.1	2.0e-32
WP_135024822.1|3017661_3017835_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_135024823.1|3017990_3018311_+	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	75.5	1.8e-14
WP_072502330.1|3018366_3018870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074924196.1|3018907_3019756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964313.1|3019998_3020691_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	72.4	4.0e-91
WP_152964314.1|3020740_3021496_-	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	68.9	1.0e-92
WP_096043088.1|3021560_3021929_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	30.3	1.1e-10
WP_096043087.1|3021925_3022297_-	hypothetical protein	NA	G0ZNE3	Cronobacter_phage	65.0	1.1e-39
WP_004247766.1|3022298_3022640_-	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	52.4	9.4e-25
WP_096043086.1|3022639_3023038_-	hypothetical protein	NA	I6S619	Salmonella_phage	78.6	2.3e-54
WP_004247764.1|3023094_3023268_-	hypothetical protein	NA	I6R9A3	Salmonella_phage	51.8	1.4e-08
WP_152964315.1|3023277_3024372_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.9	2.0e-145
WP_152964316.1|3024388_3024826_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	69.9	6.5e-47
WP_152964317.1|3024825_3026103_-	hypothetical protein	NA	A0A1V0E5Q9	Salmonella_phage	69.4	1.4e-166
WP_152964318.1|3026106_3027036_-|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	55.7	1.0e-89
WP_152964319.1|3026986_3028342_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	64.2	1.7e-162
WP_152964320.1|3028341_3029586_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E5Q3	Salmonella_phage	73.8	1.6e-186
WP_152964321.1|3029566_3029989_-	hypothetical protein	NA	A0A068CGC1	Acinetobacter_phage	63.0	3.4e-32
WP_152964322.1|3030005_3030191_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	70.5	3.7e-20
WP_168713140.1|3030180_3030342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049257606.1|3030384_3030648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168713141.1|3030678_3030837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964323.1|3030853_3031636_-	DNA-binding protein	NA	K7PH51	Enterobacterial_phage	43.3	1.9e-52
WP_152964324.1|3032075_3032531_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	84.7	9.8e-54
WP_036905450.1|3032527_3032932_-	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.0	1.3e-25
WP_036906009.1|3032928_3033225_-|holin	holin	holin	E7C9S8	Salmonella_phage	45.4	1.0e-19
WP_152964325.1|3033734_3034574_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	45.3	2.0e-60
WP_152964326.1|3034570_3034771_-	NinH	NA	A5VW84	Enterobacteria_phage	50.0	6.1e-08
WP_152964327.1|3034760_3035354_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	87.3	9.4e-89
WP_152964328.1|3035325_3035469_-	hypothetical protein	NA	A0A1P8DTE6	Proteus_phage	91.5	9.3e-19
WP_124743777.1|3035465_3035825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964329.1|3035845_3036289_-	recombination protein NinB	NA	A0A1W6JNZ4	Morganella_phage	62.4	7.6e-43
WP_152964330.1|3036456_3036648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964331.1|3036858_3037104_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_152964332.1|3037549_3037717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964333.1|3037727_3037931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964634.1|3037950_3039327_-	AAA family ATPase	NA	E5AGF0	Erwinia_phage	58.3	5.4e-156
WP_152964635.1|3039326_3040064_-	hypothetical protein	NA	E5AGE9	Erwinia_phage	55.9	3.8e-63
WP_164484703.1|3040491_3040668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964334.1|3040764_3041106_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	92.8	9.3e-49
WP_036895075.1|3041241_3041427_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	58.3	2.3e-09
WP_152964335.1|3041522_3042233_+	helix-turn-helix domain-containing protein	NA	A4KWV9	Enterobacteria_phage	62.1	3.3e-80
WP_004247718.1|3042280_3043309_+	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	53.7	4.7e-96
WP_036970054.1|3043704_3043974_+	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	72.5	6.2e-24
WP_145930935.1|3043989_3044478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102086776.1|3044986_3045262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168713142.1|3045258_3045411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964336.1|3045407_3045728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964337.1|3045729_3046614_+	AAA family ATPase	NA	A0A1B1P9H8	Acinetobacter_phage	52.4	6.6e-62
WP_152964338.1|3046603_3047107_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	84.3	2.4e-53
WP_152964339.1|3047197_3047518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168713143.1|3047517_3047691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964340.1|3047690_3047984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964341.1|3047993_3048362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168713144.1|3048748_3048922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964343.1|3048914_3049256_+	DUF2591 family protein	NA	A0A2I7QNI7	Vibrio_phage	37.7	1.4e-12
WP_152964344.1|3049242_3049845_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	56.7	2.3e-58
WP_036976956.1|3049852_3050047_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	92.2	3.5e-29
WP_049206334.1|3050280_3051438_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	75.1	1.4e-176
WP_004244243.1|3051726_3052599_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
3051458:3051504	attR	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004244244.1|3052602_3052815_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004244246.1|3053450_3054392_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_020946115.1|3054457_3055849_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	2.7e-38
WP_004244249.1|3056240_3056735_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_020946116.1|3056747_3057470_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_020946117.1|3057602_3058124_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_041701236.1|3058120_3059188_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_004244255.1|3059311_3060580_+	MFS transporter	NA	NA	NA	NA	NA
WP_020946119.1|3060657_3061683_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_004250298.1|3061782_3064224_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004250296.1|3064220_3064907_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.9	4.6e-31
WP_012368271.1|3064877_3065507_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 11
NZ_CP045538	Proteus mirabilis strain CRE14IB chromosome, complete genome	4018329	3890436	3945281	4018329	integrase,transposase,tRNA	Virus_Rctr41k(18.18%)	44	3910521:3910535	3949604:3949618
WP_004246627.1|3890436_3891465_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004246625.1|3891505_3892180_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004249861.1|3892297_3892921_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.5	6.4e-64
WP_004249862.1|3893288_3895247_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	3.7e-89
WP_004246621.1|3895411_3895723_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_004246620.1|3895719_3897375_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_064506089.1|3897676_3899308_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_152964391.1|3899326_3900019_-	LUD domain-containing protein	NA	NA	NA	NA	NA
WP_004246616.1|3900022_3901441_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_017628596.1|3901431_3902169_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004249867.1|3908347_3909034_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012368605.1|3909114_3910512_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
3910521:3910535	attL	GATATAAAAATAAAA	NA	NA	NA	NA
WP_004246607.1|3910593_3911520_-	ribokinase	NA	NA	NA	NA	NA
WP_152964392.1|3911800_3913300_+	ATPase RavA	NA	A0A0N9PBE1	Sulfolobus_monocaudavirus	37.3	1.5e-21
WP_046335304.1|3913307_3914765_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_004246604.1|3914765_3915758_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.5	1.3e-50
WP_004246603.1|3915918_3916380_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_004249871.1|3916480_3916921_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_152964393.1|3917300_3919199_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_004246599.1|3919195_3919822_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004249988.1|3920436_3920814_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004246597.1|3920845_3921670_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246596.1|3921715_3921955_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004246595.1|3922016_3922487_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004246594.1|3922499_3923033_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004246592.1|3923047_3924589_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004246591.1|3924646_3925510_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004246589.1|3925544_3926927_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004246588.1|3926948_3927365_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_004246587.1|3927515_3928889_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.3	9.6e-28
WP_004246586.1|3929046_3930873_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	44.6	1.2e-131
WP_001029679.1|3931032_3931854_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_000267723.1|3931840_3933949_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|3933945_3935613_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001243518.1|3935615_3937142_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_152964394.1|3937396_3938564_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	88.2	6.7e-163
WP_001271300.1|3940241_3940619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|3941028_3941400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444089.1|3941460_3941958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206315.1|3942033_3942822_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000704156.1|3942879_3943404_-	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_000777554.1|3943498_3943972_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000071896.1|3944303_3944840_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|3944954_3945281_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
3949604:3949618	attR	GATATAAAAATAAAA	NA	NA	NA	NA
>prophage 1
NZ_CP045540	Proteus mirabilis strain CRE14IB plasmid pIB_NDM_1, complete sequence	99278	1508	41197	99278	integrase,transposase	Salmonella_phage(11.76%)	41	27836:27852	41938:41954
WP_001138073.1|1508_4481_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|4483_5041_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845039.1|5346_6360_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|6515_6989_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000237816.1|7099_7552_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_000846390.1|7847_8648_+	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_152964650.1|8664_9456_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|9619_9967_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|9960_10800_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|11204_12746_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_004993232.1|13111_13564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019768104.1|13625_14108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386410.1|15408_16188_+	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	34.7	6.9e-31
WP_004683689.1|16354_17365_+|transposase	IS30-like element ISAba125 family transposase	transposase	W5R8L2	Staphylococcus_phage	38.4	4.1e-52
WP_004201164.1|17465_18278_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_000259031.1|18566_19406_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|19533_20034_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001339197.1|21064_22273_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000428546.1|22786_23380_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089072.1|23492_24698_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000088605.1|24779_25403_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_110592899.1|25380_26061_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_148099023.1|25993_26419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024008858.1|26415_27240_+	patatin family protein	NA	NA	NA	NA	NA
WP_094963231.1|27298_28504_+	MFS transporter	NA	NA	NA	NA	NA
27836:27852	attL	TTAACTTTATTAAAAAA	NA	NA	NA	NA
WP_024008860.1|28859_30347_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	77.3	5.2e-213
WP_024008861.1|30357_31209_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.1	1.5e-50
WP_109910892.1|31849_32860_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	63.9	9.9e-123
WP_072070749.1|33211_34258_+	ParB/RepB/Spo0J family partition protein	NA	D5LGX9	Escherichia_phage	31.8	1.0e-29
WP_023159966.1|34260_34605_+	single-stranded DNA-binding protein	NA	A0A291LA01	Bordetella_phage	39.3	3.6e-08
WP_048821775.1|34597_35020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109910891.1|35029_35422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109910890.1|35771_36140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096864993.1|36237_36465_-	DNA partition complex ParG	NA	NA	NA	NA	NA
WP_109910889.1|36565_37189_-	AAA family ATPase	NA	D4HTX7	Vibrio_phage	35.4	1.6e-22
WP_096864992.1|37458_37704_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023159957.1|37703_38036_+	endoribonuclease MazF	NA	A0A1S5SEX8	Streptococcus_phage	32.4	5.6e-06
WP_096864991.1|38066_38447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071547955.1|38532_38676_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_048607643.1|39040_39838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163939961.1|40408_41197_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	29.3	6.3e-24
41938:41954	attR	TTAACTTTATTAAAAAA	NA	NA	NA	NA
