The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045444	Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 chromosome, complete genome	4631209	1645732	1654904	4631209	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1645732_1646680_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824858.1|1646663_1647395_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1647375_1647483_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1647542_1648274_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1648496_1650182_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1650178_1650898_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1650944_1651412_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001221798.1|1651468_1651999_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703136.1|1652170_1652629_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_000195345.1|1652870_1654904_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 2
NZ_CP045444	Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 chromosome, complete genome	4631209	1722133	1732640	4631209		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111835.1|1722133_1723537_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1723714_1724608_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697850.1|1724984_1726070_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	9.4e-103
WP_001023663.1|1726069_1726969_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_024132299.1|1727016_1727895_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.2	3.5e-108
WP_000973712.1|1727895_1728447_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.9e-52
WP_000018225.1|1728452_1729427_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1729442_1730216_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565904.1|1730220_1731300_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	2.3e-16
WP_000126349.1|1731326_1732640_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 3
NZ_CP045444	Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 chromosome, complete genome	4631209	1826809	1834069	4631209		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1826809_1827229_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_152652504.1|1827231_1828500_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.7	5.4e-227
WP_000208509.1|1828954_1829167_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1829177_1829366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080663.1|1829626_1830829_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.3	4.4e-109
WP_000107430.1|1831478_1831778_+	membrane protein	NA	NA	NA	NA	NA
WP_000377042.1|1831869_1832565_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157312.1|1832638_1834069_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.5	3.5e-105
>prophage 4
NZ_CP045444	Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 chromosome, complete genome	4631209	1936719	1954801	4631209	integrase	Escherichia_phage(31.58%)	28	1934171:1934184	1940978:1940991
1934171:1934184	attL	AATTAACCGTAAAA	NA	NA	NA	NA
WP_000856224.1|1936719_1936950_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|1937087_1937462_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979695.1|1937462_1938338_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722363.1|1938354_1938708_+	YebY family protein	NA	NA	NA	NA	NA
WP_022742740.1|1939091_1940171_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
WP_001575998.1|1940145_1940424_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_172966812.1|1940484_1940913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023139359.1|1941011_1941191_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	60.3	7.3e-13
1940978:1940991	attR	TTTTACGGTTAATT	NA	NA	NA	NA
WP_047598971.1|1941801_1942134_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	74.2	3.8e-15
WP_001033921.1|1942126_1942447_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_076735565.1|1942482_1943313_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	8.5e-104
WP_088389687.1|1943305_1945996_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	2.2e-116
WP_000799627.1|1946136_1946472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|1946547_1946754_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000103933.1|1946757_1947033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076166137.1|1947244_1947400_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	3.6e-08
WP_001574209.1|1947696_1948095_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_001033911.1|1948193_1948448_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001534383.1|1948434_1948929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079839505.1|1948972_1949980_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.8	1.1e-124
WP_157872077.1|1949891_1950434_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.1e-67
WP_079981260.1|1950839_1951112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001597144.1|1951315_1951471_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
WP_000911592.1|1951720_1951969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079981259.1|1952142_1952580_+	recombination protein NinB	NA	G8C7V3	Escherichia_phage	68.8	5.2e-52
WP_050942040.1|1952767_1953049_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	84.8	1.2e-38
WP_065618882.1|1953398_1953752_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	82.3	8.4e-53
WP_080187836.1|1953760_1954801_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	39.5	4.8e-64
>prophage 5
NZ_CP045444	Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 chromosome, complete genome	4631209	1958267	1991349	4631209	plate,lysis,head,integrase,tail	Salmonella_phage(25.0%)	38	1973422:1973435	1986839:1986852
WP_001534313.1|1958267_1958807_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	71.8	3.4e-77
WP_088389689.1|1958907_1959378_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	84.7	7.2e-60
WP_080176836.1|1959577_1959841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080187690.1|1959910_1960540_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.6	3.3e-108
WP_079898419.1|1960542_1962162_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	80.8	1.3e-260
WP_080187688.1|1962161_1963682_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.9	8.2e-105
WP_057519928.1|1963722_1964412_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.1	7.6e-58
WP_080187686.1|1964408_1965755_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.2	2.5e-68
WP_001525451.1|1965756_1966239_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
WP_001031913.1|1966238_1967267_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_000829560.1|1967270_1967618_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
WP_000537614.1|1967624_1968071_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.6	2.3e-15
WP_058116336.1|1968064_1968649_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	4.2e-17
WP_001048637.1|1968645_1969011_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
WP_080187685.1|1968995_1969541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023257599.1|1969521_1971006_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.2	1.8e-96
WP_000016414.1|1971006_1971453_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|1971452_1971857_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228830.1|1971898_1972081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047598846.1|1972064_1974236_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
1973422:1973435	attL	AGAAAGAGATGGAG	NA	NA	NA	NA
WP_001525483.1|1974232_1974943_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	5.0e-28
WP_000890115.1|1974942_1975245_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|1975241_1976111_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_000068491.1|1976091_1976769_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.0	1.6e-31
WP_001191865.1|1976781_1977138_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_023234169.1|1977134_1978376_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.9	9.1e-102
WP_001181748.1|1978377_1978980_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	4.3e-33
WP_080187683.1|1978969_1980421_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	72.3	4.5e-44
WP_088389691.1|1980420_1981134_+	DUF4376 domain-containing protein	NA	A0A0M4RTP2	Salmonella_phage	77.8	6.7e-49
WP_088389692.1|1981140_1981515_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	41.5	1.1e-15
WP_080187682.1|1981755_1982610_+	protein YibB	NA	NA	NA	NA	NA
WP_080187681.1|1982678_1984220_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_000087641.1|1985220_1986300_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.9	1.3e-101
WP_152658634.1|1986296_1987403_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	Q9QF34	Lambdoid_phage	66.7	3.3e-55
1986839:1986852	attR	CTCCATCTCTTTCT	NA	NA	NA	NA
WP_001014089.1|1987433_1987721_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	95.1	1.9e-39
WP_000789530.1|1988506_1988674_-	lytic enzyme	NA	NA	NA	NA	NA
WP_000348547.1|1988976_1989468_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	1.9e-42
WP_001530906.1|1990020_1991349_+|tail	tail fiber assembly protein	tail	E5G6P0	Salmonella_phage	46.7	1.1e-68
>prophage 6
NZ_CP045444	Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 chromosome, complete genome	4631209	2640593	2648873	4631209		Escherichia_phage(42.86%)	9	NA	NA
WP_000497451.1|2640593_2640833_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001036548.1|2641043_2641208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|2641705_2642515_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2642587_2642965_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|2643112_2643655_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_000733630.1|2643847_2644576_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.6e-61
WP_000275700.1|2644592_2645006_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	4.2e-19
WP_000917280.1|2646052_2647177_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000444506.1|2647622_2648873_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.0e-19
>prophage 7
NZ_CP045444	Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 chromosome, complete genome	4631209	3030966	3073554	4631209	transposase,lysis,protease,integrase,holin,tail,terminase,portal,coat	Salmonella_phage(53.23%)	63	3028958:3028979	3073620:3073641
3028958:3028979	attL	CGTTCAACTTAGTATAAAAAAG	NA	NA	NA	NA
WP_152652510.1|3030966_3032931_-|tail	phage tail protein	tail	A0A088F834	Salmonella_phage	79.1	2.4e-237
WP_152652511.1|3033142_3034045_-	phage antirepressor Ant	NA	A0A192Y6V0	Salmonella_phage	97.3	2.2e-169
WP_000677939.1|3034113_3034275_-	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_015975190.1|3034365_3034617_+	Arc family DNA-binding protein	NA	A0A192Y840	Salmonella_phage	100.0	9.9e-40
WP_015975201.1|3034716_3034896_+	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	100.0	6.2e-28
WP_000757526.1|3034909_3035275_-	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	100.0	2.1e-67
WP_015975200.1|3035305_3035800_+	hypothetical protein	NA	A8CGD7	Salmonella_phage	100.0	3.8e-83
WP_015975199.1|3035822_3037652_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	100.0	0.0e+00
WP_172966813.1|3037651_3039001_-	phage DNA ejection protein	NA	B9UDL0	Salmonella_phage	96.9	1.7e-239
WP_001531204.1|3039010_3039700_-	hypothetical protein	NA	B9UDK9	Salmonella_phage	93.4	6.6e-94
WP_063809527.1|3039702_3040158_-	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	98.7	3.3e-86
WP_000774927.1|3040157_3040859_-	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_001122424.1|3040862_3042281_-	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_001166098.1|3042240_3042741_-	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_000684729.1|3042724_3042934_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001196938.1|3042972_3044265_-|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_152652512.1|3044264_3045176_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.7	8.3e-161
WP_152652513.1|3045189_3047367_-|portal	portal protein	portal	A0A192Y922	Salmonella_phage	99.7	0.0e+00
WP_000417849.1|3047366_3048866_-|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000729925.1|3048843_3049332_-	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_152652514.1|3049335_3049740_-	Decoration protein	NA	C6ZR73	Salmonella_phage	98.5	1.5e-66
WP_000807793.1|3049742_3049985_-	DUF2560 family protein	NA	A0A1R3Y5V5	Salmonella_virus	100.0	1.7e-36
WP_060635078.1|3050132_3050342_-	DUF551 domain-containing protein	NA	A0A193GZ43	Enterobacter_phage	81.5	6.7e-26
WP_172966814.1|3050331_3050601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047668098.1|3050848_3051379_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	93.8	9.3e-88
WP_152652516.1|3051582_3052020_-|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	93.8	1.0e-68
WP_046380608.1|3052016_3052454_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	1.4e-73
WP_000738703.1|3052437_3052764_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_022630928.1|3052988_3053507_-	HNH endonuclease	NA	A0A1V0E5R7	Salmonella_phage	66.9	6.3e-57
WP_000255946.1|3053854_3054877_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_001297096.1|3054876_3055656_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000027545.1|3055734_3056223_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
WP_023167457.1|3056219_3056399_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	98.3	1.6e-23
WP_080187657.1|3056379_3056583_-	protein ninH	NA	Q5G8R8	Enterobacteria_phage	97.0	4.0e-31
WP_080187658.1|3056579_3057188_-	recombination protein NinG	NA	I6S604	Salmonella_phage	67.8	2.8e-56
WP_023217803.1|3057162_3057342_-	hypothetical protein	NA	I6R994	Salmonella_phage	96.6	3.6e-28
WP_043856233.1|3057338_3057515_-	NinE family protein	NA	I6RSI9	Salmonella_phage	98.3	1.5e-26
WP_152652517.1|3057511_3058039_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	3.6e-100
WP_080187660.1|3058035_3058476_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	5.9e-80
WP_001248406.1|3058549_3059926_-	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_058108951.1|3059922_3060738_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	97.4	8.2e-144
WP_001125981.1|3060730_3060877_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001103492.1|3060911_3061193_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000276884.1|3061302_3061488_-	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_001095984.1|3061568_3062219_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000216175.1|3062572_3062875_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001682202.1|3062895_3063474_-	super-infection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_152658637.1|3063666_3064758_+	hypothetical protein	NA	Q5G8T6	Enterobacteria_phage	74.9	7.8e-73
WP_001199269.1|3064957_3065098_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	3.5e-18
WP_000361564.1|3065090_3065204_+	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_015976818.1|3065397_3066105_+	gp49	NA	Q5G8U0	Enterobacteria_phage	100.0	4.1e-139
WP_024142050.1|3066105_3066576_+	single-stranded DNA-binding protein	NA	Q5G8U1	Enterobacteria_phage	99.4	3.8e-61
WP_102136175.1|3066638_3067136_+	HNH endonuclease	NA	Q5G8U2	Enterobacteria_phage	100.0	5.3e-93
WP_152652519.1|3067203_3067497_+	DUF2856 family protein	NA	Q5G8U3	Enterobacteria_phage	99.0	2.1e-49
WP_015976814.1|3067507_3067795_+	hypothetical protein	NA	Q5G8U4	Enterobacteria_phage	100.0	2.1e-46
WP_015976813.1|3067791_3067962_+	DUF2737 family protein	NA	Q5G8U5	Enterobacteria_phage	100.0	6.1e-25
WP_058685126.1|3068027_3068576_+	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	99.5	5.2e-94
WP_152652520.1|3068572_3068938_+	hypothetical protein	NA	Q5G8U7	Enterobacteria_phage	99.2	1.9e-71
WP_152652522.1|3069728_3070202_+	SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.8	1.7e-69
WP_046594002.1|3071315_3071582_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	98.9	3.4e-46
WP_001281206.1|3071827_3072178_+	hypothetical protein	NA	I6R980	Salmonella_phage	98.3	1.2e-59
WP_001556007.1|3072287_3072506_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
WP_000533679.1|3072483_3073554_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
3073620:3073641	attR	CGTTCAACTTAGTATAAAAAAG	NA	NA	NA	NA
>prophage 1
NZ_CP045446	Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence	276821	60947	100322	276821	transposase,integrase,protease	Escherichia_phage(33.33%)	42	55594:55607	64438:64451
55594:55607	attL	CGGGATGAATATAA	NA	NA	NA	NA
WP_000795946.1|60947_62129_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|62299_62512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|62872_63955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|64121_65621_-	kinase	NA	NA	NA	NA	NA
64438:64451	attR	CGGGATGAATATAA	NA	NA	NA	NA
WP_000081622.1|65646_67284_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|67283_68324_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|68409_69048_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|69047_69689_-	TerD family protein	NA	NA	NA	NA	NA
WP_001388628.1|69711_70350_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|70812_71280_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|71297_72506_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|72516_73473_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182411.1|73472_74552_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	8.1e-38
WP_001040059.1|74553_75327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|75319_76462_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|76471_77530_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_000254136.1|77852_78434_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|78433_79591_+	TerD family protein	NA	NA	NA	NA	NA
WP_000007449.1|79613_80069_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|80091_81132_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_152658639.1|81180_81759_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	4.3e-06
WP_000301242.1|81826_82402_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|82830_84072_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000077926.1|84634_84916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|84965_85157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151575.1|85248_85590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|85962_86355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|86958_87252_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|87256_88582_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|88642_88849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985910.1|88950_89241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000480968.1|89282_90119_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|90118_90922_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_085959879.1|91028_92158_-|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
WP_000904906.1|92222_92837_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_001067856.1|94072_94777_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_000018323.1|94906_95722_+	APH(3')-I family aminoglycoside O-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	1.3e-160
WP_001183556.1|95858_96260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|96299_97004_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|97117_97894_+	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_000742814.1|98122_99148_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|99569_100322_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
