The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP035194	Klebsiella pneumoniae strain LH102-A chromosome, complete genome	5153352	24550	35437	5153352		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|24550_25171_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004190239.1|25163_26429_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002903955.1|26440_27343_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004209817.1|27603_28365_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.6	5.5e-134
WP_023282555.1|28385_29246_-	class A extended-spectrum beta-lactamase SHV-27	NA	A0A077SL40	Escherichia_phage	99.3	2.9e-155
WP_004183954.1|29543_29804_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_025368140.1|29890_30979_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.4e-210
WP_004176258.1|31009_32275_-	MFS transporter	NA	NA	NA	NA	NA
WP_065804957.1|32329_35437_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 2
NZ_CP035194	Klebsiella pneumoniae strain LH102-A chromosome, complete genome	5153352	1028089	1034994	5153352	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|1028089_1029568_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|1029564_1030287_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|1030605_1031967_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_002912636.1|1032212_1033106_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_040027268.1|1033346_1034120_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004180551.1|1034130_1034994_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 3
NZ_CP035194	Klebsiella pneumoniae strain LH102-A chromosome, complete genome	5153352	1234437	1315760	5153352	plate,tail,tRNA,holin,terminase,head,integrase,portal,capsid,protease	Enterobacteria_phage(14.58%)	91	1257168:1257191	1296739:1296762
WP_002913226.1|1234437_1235250_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002913227.1|1235249_1236263_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_152659724.1|1236326_1237463_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_021313698.1|1237573_1238551_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_004149211.1|1238637_1239813_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913291.1|1240022_1241243_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_020317299.1|1241401_1243390_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913338.1|1243451_1243733_-	YfcL family protein	NA	NA	NA	NA	NA
WP_002913339.1|1243764_1244313_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913340.1|1244312_1245122_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_004174960.1|1245121_1245946_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_009483974.1|1245948_1247034_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.4	1.3e-88
WP_002913346.1|1247075_1248008_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913348.1|1248175_1248727_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913355.1|1248747_1249233_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_004149220.1|1249442_1251587_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_004185010.1|1251586_1252897_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_002913359.1|1253056_1253341_-	DUF406 family protein	NA	NA	NA	NA	NA
WP_004149222.1|1253708_1255037_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002913362.1|1255098_1255860_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_060415764.1|1256149_1257079_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	3.0e-134
1257168:1257191	attL	TGTCCCCTTAGTTAAATGGATATA	NA	NA	NA	NA
WP_064182199.1|1257285_1257657_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	2.1e-25
WP_064182198.1|1257613_1257853_-	hypothetical protein	NA	I6PD82	Cronobacter_phage	53.2	4.9e-20
WP_004892499.1|1258266_1258689_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
WP_133060760.1|1259002_1259854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040150096.1|1260114_1260309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064182196.1|1261159_1261354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152659836.1|1261552_1263046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152659725.1|1263596_1266680_-	kinase	NA	A0A286S259	Klebsiella_phage	71.9	0.0e+00
WP_021313617.1|1266676_1267057_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	80.2	2.1e-57
WP_023301978.1|1267066_1267552_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	66.2	4.0e-53
WP_023301979.1|1267538_1268012_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.8	4.6e-54
WP_038806630.1|1268032_1271419_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	58.0	1.1e-303
WP_016530182.1|1271479_1271713_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_004177139.1|1271786_1272092_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_021313622.1|1272094_1272499_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_023313062.1|1272529_1273234_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	5.5e-80
WP_016530186.1|1273290_1273638_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_019705270.1|1273634_1274084_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_019705271.1|1274080_1274419_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	68.8	6.6e-39
WP_019705272.1|1274427_1274745_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.9	7.4e-24
WP_117271238.1|1274822_1276061_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	70.4	1.6e-159
WP_000999827.1|1276070_1276670_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_023313057.1|1276662_1277889_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.0	4.2e-208
WP_032737698.1|1278036_1279788_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.2	1.8e-252
WP_001119413.1|1279791_1280289_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	71.3	7.4e-63
WP_117247952.1|1280446_1280797_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.9	7.1e-52
WP_117247954.1|1280799_1281120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117247953.1|1281185_1281431_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	64.2	4.2e-19
WP_114475993.1|1281519_1281711_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	94.5	2.4e-22
WP_032448071.1|1281661_1281937_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	37.1	6.0e-06
WP_101415860.1|1281939_1282569_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	74.4	2.1e-86
WP_101983094.1|1282568_1282850_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	4.1e-18
WP_001294159.1|1282836_1283223_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_152659726.1|1283475_1284246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131091278.1|1284283_1284649_-	DUF1133 family protein	NA	K7PGW2	Enterobacterial_phage	81.7	4.3e-52
WP_152659727.1|1284667_1285648_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	3.2e-134
WP_032737684.1|1285660_1286038_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	1.8e-48
WP_061363443.1|1286047_1286857_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.7	1.6e-110
WP_060618150.1|1286853_1287768_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	57.3	2.4e-30
WP_071557781.1|1287724_1287937_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	6.4e-16
WP_004213338.1|1288174_1288636_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_024176406.1|1288661_1288871_-	cell division protein	NA	NA	NA	NA	NA
WP_019705289.1|1288965_1289610_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	8.2e-38
WP_048287748.1|1289881_1290799_+	hypothetical protein	NA	A0A1W6JP69	Morganella_phage	36.9	5.2e-46
WP_040181807.1|1290888_1291188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152659728.1|1291187_1291973_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.0	2.6e-62
WP_152659729.1|1292100_1292634_+	hypothetical protein	NA	E7C9P6	Salmonella_phage	51.0	1.8e-30
WP_075647491.1|1292630_1292888_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	74.1	5.6e-30
WP_152659730.1|1292884_1293637_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	84.8	4.9e-127
WP_152659731.1|1293647_1294166_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	81.6	9.8e-42
WP_077274609.1|1294173_1294359_+	hypothetical protein	NA	G3CFG7	Escherichia_phage	65.5	4.0e-14
WP_080870864.1|1294470_1295337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152659732.1|1295374_1296544_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.8	9.5e-202
WP_048985683.1|1297690_1298224_-	hypothetical protein	NA	NA	NA	NA	NA
1296739:1296762	attR	TGTCCCCTTAGTTAAATGGATATA	NA	NA	NA	NA
WP_129718279.1|1298220_1298670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071838925.1|1299458_1299857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136398120.1|1300364_1300922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049107563.1|1303680_1304163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086472102.1|1304405_1305143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317120.1|1305175_1305520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317121.1|1305513_1306017_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.7	5.1e-19
WP_083566682.1|1306013_1306766_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_048269345.1|1306793_1307537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048269696.1|1307577_1308123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074185282.1|1308191_1308788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053067564.1|1309510_1310065_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_083565429.1|1310066_1312382_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_083565430.1|1312386_1312911_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_083565433.1|1312944_1314027_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_083565435.1|1313990_1315760_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 4
NZ_CP035194	Klebsiella pneumoniae strain LH102-A chromosome, complete genome	5153352	4507636	4517099	5153352	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|4507636_4508752_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|4508748_4510689_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|4510765_4510987_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|4511312_4511630_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|4511660_4513940_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|4514059_4514278_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|4514631_4515333_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004179158.1|4515377_4517099_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
