The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045447	Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 chromosome, complete genome	4630202	1645738	1654910	4630202	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1645738_1646686_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824858.1|1646669_1647401_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1647381_1647489_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1647548_1648280_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1648502_1650188_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1650184_1650904_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1650950_1651418_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001221798.1|1651474_1652005_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703136.1|1652176_1652635_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_000195345.1|1652876_1654910_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 2
NZ_CP045447	Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 chromosome, complete genome	4630202	1722139	1732646	4630202		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111835.1|1722139_1723543_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1723720_1724614_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697850.1|1724990_1726076_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	9.4e-103
WP_001023663.1|1726075_1726975_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_024132299.1|1727022_1727901_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.2	3.5e-108
WP_000973712.1|1727901_1728453_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.9e-52
WP_000018225.1|1728458_1729433_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1729448_1730222_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565904.1|1730226_1731306_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	2.3e-16
WP_000126349.1|1731332_1732646_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 3
NZ_CP045447	Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 chromosome, complete genome	4630202	1826815	1834075	4630202		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1826815_1827235_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_152652504.1|1827237_1828506_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.7	5.4e-227
WP_000208509.1|1828960_1829173_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1829183_1829372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080663.1|1829632_1830835_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.3	4.4e-109
WP_000107430.1|1831484_1831784_+	membrane protein	NA	NA	NA	NA	NA
WP_000377042.1|1831875_1832571_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157312.1|1832644_1834075_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.5	3.5e-105
>prophage 4
NZ_CP045447	Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 chromosome, complete genome	4630202	1936725	1982870	4630202	head,lysis,plate,tail,transposase,integrase	Edwardsiella_phage(17.39%)	63	1938933:1938962	1986420:1986449
WP_000856224.1|1936725_1936956_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|1937093_1937468_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979695.1|1937468_1938344_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722363.1|1938360_1938714_+	YebY family protein	NA	NA	NA	NA	NA
1938933:1938962	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_022742740.1|1939097_1940177_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
WP_001575998.1|1940151_1940430_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_172966812.1|1940490_1940919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023139359.1|1941017_1941197_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	60.3	7.3e-13
WP_047598971.1|1941807_1942140_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	74.2	3.8e-15
WP_001033921.1|1942132_1942453_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_076735565.1|1942488_1943319_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.6	8.5e-104
WP_152652505.1|1943311_1946002_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	2.2e-116
WP_000799627.1|1946142_1946478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|1946553_1946760_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000103933.1|1946763_1947039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076166137.1|1947250_1947406_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	3.6e-08
WP_001574209.1|1947702_1948101_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_001033911.1|1948199_1948454_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001534383.1|1948440_1948935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079839505.1|1948978_1949986_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.8	1.1e-124
WP_157872077.1|1949897_1950440_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.1e-67
WP_079981260.1|1950845_1951118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001597144.1|1951321_1951477_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
WP_001300563.1|1951554_1952667_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000911592.1|1953075_1953324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079981259.1|1953497_1953935_+	recombination protein NinB	NA	G8C7V3	Escherichia_phage	68.8	5.2e-52
WP_050942040.1|1954122_1954404_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	84.8	1.2e-38
WP_065618882.1|1954753_1955107_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	82.3	8.4e-53
WP_080187836.1|1955115_1956156_-	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	39.5	4.8e-64
WP_088389688.1|1956168_1957950_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_058679888.1|1958408_1958615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130045103.1|1958605_1959151_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_001525456.1|1959342_1959645_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001534313.1|1959622_1960162_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	71.8	3.4e-77
WP_088389689.1|1960262_1960733_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	84.7	7.2e-60
WP_080176836.1|1960932_1961196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080187690.1|1961265_1961895_+	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.6	3.3e-108
WP_079898419.1|1961897_1963517_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	80.8	1.3e-260
WP_080187688.1|1963516_1965037_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.9	8.2e-105
WP_057519928.1|1965077_1965767_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.1	7.6e-58
WP_080187686.1|1965763_1967110_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.2	2.5e-68
WP_001525451.1|1967111_1967594_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
WP_001031913.1|1967593_1968622_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_000829560.1|1968625_1968973_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.9e-10
WP_000537614.1|1968979_1969426_+	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.6	2.3e-15
WP_058116336.1|1969419_1970004_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	4.2e-17
WP_001048637.1|1970000_1970366_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
WP_080187685.1|1970350_1970896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023257599.1|1970876_1972361_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.2	1.8e-96
WP_000016414.1|1972361_1972808_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|1972807_1973212_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228830.1|1973253_1973436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047598846.1|1973419_1975591_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_001525483.1|1975587_1976298_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	5.0e-28
WP_000890115.1|1976297_1976600_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|1976596_1977466_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_000068491.1|1977446_1978124_+	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.0	1.6e-31
WP_001191865.1|1978136_1978493_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_023234169.1|1978489_1979731_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.9	9.1e-102
WP_001181748.1|1979732_1980335_+	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	4.3e-33
WP_080187683.1|1980324_1981776_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	72.3	4.5e-44
WP_088389691.1|1981775_1982489_+	DUF4376 domain-containing protein	NA	A0A0M4RTP2	Salmonella_phage	77.8	6.7e-49
WP_088389692.1|1982495_1982870_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	41.5	1.1e-15
1986420:1986449	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
>prophage 5
NZ_CP045447	Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 chromosome, complete genome	4630202	2641948	2650228	4630202		Escherichia_phage(42.86%)	9	NA	NA
WP_000497451.1|2641948_2642188_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001036548.1|2642398_2642563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|2643060_2643870_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2643942_2644320_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|2644467_2645010_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_000733630.1|2645202_2645931_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.6e-61
WP_000275700.1|2645947_2646361_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	4.2e-19
WP_000917280.1|2647407_2648532_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000444506.1|2648977_2650228_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.0e-19
>prophage 6
NZ_CP045447	Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 chromosome, complete genome	4630202	3032321	3072547	4630202	protease,terminase,lysis,portal,tail,coat,holin,integrase	Salmonella_phage(56.67%)	61	3030313:3030334	3072613:3072634
3030313:3030334	attL	CGTTCAACTTAGTATAAAAAAG	NA	NA	NA	NA
WP_152652510.1|3032321_3034286_-|tail	phage tail protein	tail	A0A088F834	Salmonella_phage	79.1	2.4e-237
WP_152652511.1|3034497_3035400_-	phage antirepressor Ant	NA	A0A192Y6V0	Salmonella_phage	97.3	2.2e-169
WP_000677939.1|3035468_3035630_-	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_015975190.1|3035720_3035972_+	Arc family DNA-binding protein	NA	A0A192Y840	Salmonella_phage	100.0	9.9e-40
WP_015975201.1|3036071_3036251_+	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	100.0	6.2e-28
WP_000757526.1|3036264_3036630_-	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	100.0	2.1e-67
WP_015975200.1|3036660_3037155_+	hypothetical protein	NA	A8CGD7	Salmonella_phage	100.0	3.8e-83
WP_015975199.1|3037177_3039007_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	100.0	0.0e+00
WP_172966813.1|3039006_3040356_-	phage DNA ejection protein	NA	B9UDL0	Salmonella_phage	96.9	1.7e-239
WP_001531204.1|3040365_3041055_-	hypothetical protein	NA	B9UDK9	Salmonella_phage	93.4	6.6e-94
WP_063809527.1|3041057_3041513_-	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	98.7	3.3e-86
WP_000774927.1|3041512_3042214_-	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_001122424.1|3042217_3043636_-	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_001166098.1|3043595_3044096_-	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_000684729.1|3044079_3044289_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001196938.1|3044327_3045620_-|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_152652512.1|3045619_3046531_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	99.7	8.3e-161
WP_152652513.1|3046544_3048722_-|portal	portal protein	portal	A0A192Y922	Salmonella_phage	99.7	0.0e+00
WP_000417849.1|3048721_3050221_-|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000729925.1|3050198_3050687_-	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_152652514.1|3050690_3051095_-	Decoration protein	NA	C6ZR73	Salmonella_phage	98.5	1.5e-66
WP_000807793.1|3051097_3051340_-	DUF2560 family protein	NA	A0A1R3Y5V5	Salmonella_virus	100.0	1.7e-36
WP_060635078.1|3051487_3051697_-	DUF551 domain-containing protein	NA	A0A193GZ43	Enterobacter_phage	81.5	6.7e-26
WP_172966814.1|3051686_3051956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047668098.1|3052203_3052734_-	KilA-N domain-containing protein	NA	B8K1H1	Salmonella_phage	93.8	9.3e-88
WP_152652516.1|3052937_3053375_-|lysis	lysis protein	lysis	Q9MCN3	Enterobacteria_phage	93.8	1.0e-68
WP_046380608.1|3053371_3053809_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	1.4e-73
WP_000738703.1|3053792_3054119_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_022630928.1|3054343_3054862_-	HNH endonuclease	NA	A0A1V0E5R7	Salmonella_phage	66.9	6.3e-57
WP_000027545.1|3055132_3055621_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
WP_023167457.1|3055617_3055797_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	98.3	1.6e-23
WP_080187657.1|3055777_3055981_-	protein ninH	NA	Q5G8R8	Enterobacteria_phage	97.0	4.0e-31
WP_080187658.1|3055977_3056586_-	recombination protein NinG	NA	I6S604	Salmonella_phage	67.8	2.8e-56
WP_023217803.1|3056560_3056740_-	hypothetical protein	NA	I6R994	Salmonella_phage	96.6	3.6e-28
WP_043856233.1|3056736_3056913_-	NinE family protein	NA	I6RSI9	Salmonella_phage	98.3	1.5e-26
WP_152652517.1|3056909_3057437_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	3.6e-100
WP_080187660.1|3057433_3057874_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	5.9e-80
WP_001248406.1|3057947_3059324_-	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_058108951.1|3059320_3060136_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	97.4	8.2e-144
WP_001125981.1|3060128_3060275_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001103492.1|3060309_3060591_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000276884.1|3060700_3060886_-	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_001095984.1|3060966_3061617_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000216175.1|3061970_3062273_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001682202.1|3062293_3062872_-	super-infection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_152652518.1|3063064_3063751_+	hypothetical protein	NA	A0A2H4FRY7	Salmonella_phage	90.8	6.2e-84
WP_001199269.1|3063950_3064091_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	3.5e-18
WP_000361564.1|3064083_3064197_+	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_015976818.1|3064390_3065098_+	gp49	NA	Q5G8U0	Enterobacteria_phage	100.0	4.1e-139
WP_024142050.1|3065098_3065569_+	single-stranded DNA-binding protein	NA	Q5G8U1	Enterobacteria_phage	99.4	3.8e-61
WP_102136175.1|3065631_3066129_+	HNH endonuclease	NA	Q5G8U2	Enterobacteria_phage	100.0	5.3e-93
WP_152652519.1|3066196_3066490_+	DUF2856 family protein	NA	Q5G8U3	Enterobacteria_phage	99.0	2.1e-49
WP_015976814.1|3066500_3066788_+	hypothetical protein	NA	Q5G8U4	Enterobacteria_phage	100.0	2.1e-46
WP_015976813.1|3066784_3066955_+	DUF2737 family protein	NA	Q5G8U5	Enterobacteria_phage	100.0	6.1e-25
WP_058685126.1|3067020_3067569_+	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	99.5	5.2e-94
WP_152652520.1|3067565_3067931_+	hypothetical protein	NA	Q5G8U7	Enterobacteria_phage	99.2	1.9e-71
WP_152652522.1|3068721_3069195_+	SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.8	1.7e-69
WP_046594002.1|3070308_3070575_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	98.9	3.4e-46
WP_001281206.1|3070820_3071171_+	hypothetical protein	NA	I6R980	Salmonella_phage	98.3	1.2e-59
WP_001556007.1|3071280_3071499_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
WP_000533679.1|3071476_3072547_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
3072613:3072634	attR	CGTTCAACTTAGTATAAAAAAG	NA	NA	NA	NA
>prophage 1
NZ_CP045449	Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence	276739	60946	100321	276739	protease,transposase,integrase	Escherichia_phage(33.33%)	42	55593:55606	64437:64450
55593:55606	attL	CGGGATGAATATAA	NA	NA	NA	NA
WP_000795946.1|60946_62128_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|62298_62511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|62871_63954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|64120_65620_-	kinase	NA	NA	NA	NA	NA
64437:64450	attR	CGGGATGAATATAA	NA	NA	NA	NA
WP_000081622.1|65645_67283_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|67282_68323_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|68408_69047_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|69046_69688_-	TerD family protein	NA	NA	NA	NA	NA
WP_001388628.1|69710_70349_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|70811_71279_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|71296_72505_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|72515_73472_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182411.1|73471_74551_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	8.1e-38
WP_001040059.1|74552_75326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|75318_76461_-	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|76470_77529_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_000254136.1|77851_78433_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|78432_79590_+	TerD family protein	NA	NA	NA	NA	NA
WP_000007449.1|79612_80068_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|80090_81131_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116678.1|81179_81758_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	4.3e-06
WP_000301242.1|81825_82401_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|82829_84071_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000077926.1|84633_84915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|84964_85156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151575.1|85247_85589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|85961_86354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|86957_87251_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|87255_88581_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|88641_88848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985910.1|88949_89240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000480968.1|89281_90118_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|90117_90921_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_085959879.1|91027_92157_-|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
WP_000904906.1|92221_92836_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_001067856.1|94071_94776_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_000018323.1|94905_95721_+	APH(3')-I family aminoglycoside O-phosphotransferase	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	1.3e-160
WP_001183556.1|95857_96259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|96298_97003_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|97116_97893_+	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_000742814.1|98121_99147_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|99568_100321_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
