The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP035202	Klebsiella pneumoniae strain LH94 chromosome, complete genome	5300315	32505	42103	5300315	integrase	Enterobacteria_phage(71.43%)	12	27255:27269	42470:42484
27255:27269	attL	TTTCATTTAACGCAA	NA	NA	NA	NA
WP_064145146.1|32505_33726_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.0	4.6e-106
WP_064145147.1|33722_34970_+	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_133241610.1|34985_35222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077267019.1|35203_36085_+	protein kinase	NA	A0A1M7XUH0	Cedratvirus	29.8	3.5e-07
WP_064145149.1|36302_36866_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.8	2.6e-56
WP_000984213.1|36865_37126_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	67.9	6.4e-26
WP_064145150.1|37122_37860_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	63.7	6.4e-79
WP_087786319.1|37874_38078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077267020.1|38662_39214_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_064145153.1|39210_39438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064145154.1|39434_39755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064145155.1|39769_42103_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.0	0.0e+00
42470:42484	attR	TTTCATTTAACGCAA	NA	NA	NA	NA
>prophage 2
NZ_CP035202	Klebsiella pneumoniae strain LH94 chromosome, complete genome	5300315	3069745	3079208	5300315	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|3069745_3070861_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|3070857_3072798_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|3072874_3073096_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|3073421_3073739_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|3073769_3076049_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|3076168_3076387_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|3076740_3077442_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_021441487.1|3077486_3079208_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 3
NZ_CP035202	Klebsiella pneumoniae strain LH94 chromosome, complete genome	5300315	3487696	3516106	5300315	integrase,transposase,holin	Enterobacteria_phage(29.73%)	45	3488383:3488396	3501119:3501132
WP_004140269.1|3487696_3488506_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
3488383:3488396	attL	TCTGCCGTTCGCGC	NA	NA	NA	NA
WP_004140266.1|3488507_3489500_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_152650695.1|3489499_3490390_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_096903177.1|3490566_3491754_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	8.4e-121
WP_072031515.1|3491650_3491965_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	2.1e-10
WP_004892750.1|3491974_3492214_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.1	8.0e-23
WP_016160778.1|3492221_3492530_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	56.9	3.2e-24
WP_072201173.1|3492526_3493183_-	hypothetical protein	NA	M1F3E2	Salmonella_phage	63.1	9.1e-69
WP_032416140.1|3493226_3494336_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	85.9	9.4e-183
WP_032416141.1|3494348_3497447_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.6	2.4e-292
WP_020804294.1|3497584_3497740_-	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	71.2	5.7e-14
WP_020804303.1|3497748_3497940_-	YebW family protein	NA	NA	NA	NA	NA
WP_022631176.1|3498046_3498145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032416142.1|3498236_3498545_-	hypothetical protein	NA	G8C7T6	Escherichia_phage	61.2	1.4e-24
WP_020805737.1|3498828_3499032_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	76.1	6.3e-21
WP_016831735.1|3499945_3500065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136085610.1|3500170_3500269_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004190707.1|3500286_3500682_-	helix-turn-helix transcriptional regulator	NA	K7PM35	Enterobacteria_phage	74.0	3.1e-48
WP_029503646.1|3500786_3501020_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
WP_032416144.1|3501022_3501559_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	68.3	2.8e-60
3501119:3501132	attR	TCTGCCGTTCGCGC	NA	NA	NA	NA
WP_032409425.1|3501906_3502827_+	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	61.2	2.8e-92
WP_032416145.1|3502823_3503567_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	55.2	4.1e-65
WP_016946299.1|3503559_3503895_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	4.4e-11
WP_032416146.1|3503887_3504673_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	9.6e-65
WP_020804603.1|3504669_3504873_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	3.8e-26
WP_020804604.1|3504865_3505120_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
WP_023286281.1|3505116_3505338_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	2.2e-11
WP_032416148.1|3505341_3505770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032416150.1|3505865_3506165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184503.1|3506916_3507150_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_072031516.1|3507245_3507494_+	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	69.1	6.6e-28
WP_032416152.1|3507528_3508125_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.6	3.5e-91
WP_019704503.1|3508124_3508331_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	72.3	5.3e-23
WP_032416384.1|3508333_3508630_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	1.9e-37
WP_152650696.1|3508626_3508995_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	62.9	2.2e-40
WP_032416154.1|3508991_3509774_+	molecular chaperone	NA	F1C595	Cronobacter_phage	78.7	8.5e-114
WP_032416155.1|3510090_3510537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940884.1|3511149_3511449_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_008807831.1|3511445_3511985_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	1.5e-101
WP_004190674.1|3511981_3512326_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|3512322_3512598_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_019405025.1|3512548_3512743_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
WP_152650697.1|3513442_3514610_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
WP_004218558.1|3514808_3515054_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_032416385.1|3515182_3516106_-|transposase	IS5-like element IS903 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	5.6e-173
>prophage 4
NZ_CP035202	Klebsiella pneumoniae strain LH94 chromosome, complete genome	5300315	3790083	3800970	5300315		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|3790083_3790704_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004224682.1|3790696_3791962_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_064145463.1|3791973_3792876_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	1.0e-158
WP_002210513.1|3793136_3793898_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|3793918_3794779_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_004176262.1|3795076_3795337_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620097.1|3795423_3796512_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_064145462.1|3796542_3797808_-	MFS transporter	NA	NA	NA	NA	NA
WP_064145461.1|3797862_3800970_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
>prophage 5
NZ_CP035202	Klebsiella pneumoniae strain LH94 chromosome, complete genome	5300315	4750538	4758919	5300315		Escherichia_phage(28.57%)	9	NA	NA
WP_040169196.1|4750538_4751543_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.4e-31
WP_046960482.1|4751611_4751806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004144151.1|4751942_4752065_+	small membrane protein	NA	NA	NA	NA	NA
WP_020804124.1|4752490_4753657_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	1.2e-111
WP_096912569.1|4753837_4754392_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.1	4.3e-51
WP_065518763.1|4754406_4755297_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	1.6e-28
WP_032735999.1|4755328_4756198_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	7.5e-111
WP_004189145.1|4756224_4757289_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
WP_096912568.1|4757512_4758919_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	8.0e-38
>prophage 6
NZ_CP035202	Klebsiella pneumoniae strain LH94 chromosome, complete genome	5300315	4799473	4806378	5300315	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|4799473_4800952_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|4800948_4801671_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_096912558.1|4801989_4803351_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	1.1e-206
WP_115376455.1|4803596_4804490_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004180550.1|4804730_4805504_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004175147.1|4805514_4806378_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 7
NZ_CP035202	Klebsiella pneumoniae strain LH94 chromosome, complete genome	5300315	5003629	5079561	5300315	tRNA,capsid,protease,terminase,integrase,plate,head,holin,portal,tail	Enterobacteria_phage(41.27%)	94	5026407:5026422	5063038:5063053
WP_015958766.1|5003629_5004442_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002913227.1|5004441_5005455_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002913228.1|5005518_5006655_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_048993425.1|5006765_5007743_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_004149211.1|5007829_5009005_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913291.1|5009215_5010436_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_032104830.1|5010594_5012583_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913338.1|5012644_5012926_-	YfcL family protein	NA	NA	NA	NA	NA
WP_004185005.1|5012957_5013506_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913340.1|5013505_5014315_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_004174960.1|5014314_5015139_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002913342.1|5015141_5016227_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
WP_002913346.1|5016268_5017201_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913348.1|5017368_5017920_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913355.1|5017940_5018426_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_064149809.1|5018635_5020780_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_096912622.1|5020779_5022090_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_002913359.1|5022249_5022534_-	DUF406 family protein	NA	NA	NA	NA	NA
WP_004149222.1|5022901_5024230_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002913362.1|5024291_5025053_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_004899603.1|5025342_5026272_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	5.2e-134
5026407:5026422	attL	TTGCAGGTTCGATTCC	NA	NA	NA	NA
WP_072617313.1|5026597_5027755_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	8.2e-222
WP_072617314.1|5027918_5028281_+	GtrA family protein	NA	U5P0S6	Shigella_phage	86.4	7.3e-52
WP_072617315.1|5028277_5029195_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	77.2	1.8e-131
WP_032419946.1|5029202_5030675_+	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	29.4	6.4e-38
WP_094316694.1|5030704_5031106_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	52.4	2.7e-15
WP_152650711.1|5031105_5032077_-	carbohydrate kinase	NA	U5P0I1	Shigella_phage	80.0	6.3e-50
WP_072617318.1|5032080_5032665_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	5.4e-113
WP_152650712.1|5032655_5033714_-|plate	phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	99.1	1.2e-200
WP_000424732.1|5033700_5034126_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259084.1|5034125_5034674_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000999510.1|5034673_5035753_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	100.0	5.3e-207
WP_134082275.1|5035749_5037078_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	2.9e-247
WP_072617320.1|5037138_5038974_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.3	2.9e-306
WP_023147733.1|5038966_5039149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661054.1|5039115_5039385_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090997.1|5039384_5039741_-	hypothetical protein	NA	U5P076	Shigella_phage	99.2	9.0e-63
WP_072617321.1|5039740_5041237_-|tail	phage tail protein	tail	S5FKL0	Shigella_phage	99.0	4.4e-276
WP_000497751.1|5041220_5041391_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779292.1|5041399_5041960_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224835.1|5041956_5042463_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_072617322.1|5042437_5042848_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	91.2	1.8e-67
WP_000927719.1|5042844_5043168_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601357.1|5043170_5043371_-	hypothetical protein	NA	S5FNU1	Shigella_phage	95.5	1.4e-25
WP_073546912.1|5043419_5044625_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.3	2.7e-223
WP_001193632.1|5044639_5045290_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	1.6e-118
WP_032252663.1|5045267_5046509_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.3e-241
WP_000605606.1|5046508_5046691_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_072617324.1|5046702_5048436_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_072617325.1|5048432_5048927_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	5.1e-88
WP_040073295.1|5049052_5049403_-	HNH endonuclease	NA	Q8SBD7	Shigella_phage	97.4	6.2e-64
WP_121855891.1|5049429_5049702_-	peptidase	NA	Q8SBD8	Shigella_phage	95.6	1.8e-39
WP_040073296.1|5049586_5049979_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	86.2	3.8e-54
WP_001570151.1|5049962_5050439_-	glycoside hydrolase family protein	NA	K7P7Y6	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|5050422_5050746_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001377516.1|5050856_5051039_+	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	95.0	1.2e-26
WP_001235461.1|5051179_5051803_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000994511.1|5051799_5051988_-	protein ninH	NA	A5VW84	Enterobacteria_phage	98.4	2.7e-26
WP_001008200.1|5051984_5052347_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_016063209.1|5052343_5052634_-	DUF1364 domain-containing protein	NA	K7PK25	Enterobacteria_phage	100.0	7.6e-52
WP_072617327.1|5053348_5053519_-	protein ninF	NA	A0A2I6PIG4	Escherichia_phage	98.2	1.6e-25
WP_001254251.1|5053515_5053698_-	NinE family protein	NA	Q716C5	Shigella_phage	100.0	1.3e-28
WP_000736907.1|5053694_5054135_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	3.5e-80
WP_063080445.1|5054208_5055585_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.6e-253
WP_001608293.1|5055581_5056403_-	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.6	2.0e-153
WP_000536662.1|5056586_5056868_-	hypothetical protein	NA	K7PMG0	Enterobacteria_phage	100.0	1.9e-44
WP_000067728.1|5056984_5057200_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	98.6	8.2e-35
WP_001519589.1|5057275_5057971_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.5	1.3e-129
WP_134083103.1|5058251_5058638_+	antitermination protein	NA	Q716D8	Shigella_phage	98.2	3.7e-54
WP_000597940.1|5059182_5059431_+	hypothetical protein	NA	K7P6N6	Enterobacteria_phage	100.0	1.6e-37
WP_000972063.1|5059514_5059649_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243353.1|5059633_5059786_+	host cell division inhibitory peptide Kil	NA	K7P837	Enterobacteria_phage	100.0	4.7e-21
WP_000604110.1|5059870_5060179_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	3.3e-53
WP_000065846.1|5060175_5061078_+	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	88.4	5.2e-147
WP_072617329.1|5061061_5061544_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	97.5	1.3e-77
WP_000753555.1|5061555_5061870_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_000773125.1|5061886_5062168_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	1.9e-44
WP_001214456.1|5062164_5062329_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_098734117.1|5062325_5062868_+	hypothetical protein	NA	K7P7V4	Enterobacteria_phage	71.7	2.7e-58
WP_001163428.1|5063072_5063273_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
5063038:5063053	attR	TTGCAGGTTCGATTCC	NA	NA	NA	NA
WP_050598596.1|5064238_5064772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135625064.1|5064768_5065218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071838925.1|5066006_5066405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064185938.1|5066912_5067470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096912623.1|5067459_5068344_-	glycine zipper family protein	NA	NA	NA	NA	NA
WP_049107563.1|5070228_5070711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117245140.1|5071538_5072255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096912627.1|5072251_5072989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317120.1|5073021_5073366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050484908.1|5073359_5073863_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.0	1.5e-18
WP_096912624.1|5073859_5076181_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	2.7e-14
WP_032425135.1|5076185_5076710_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_096912625.1|5076745_5077828_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_096912626.1|5077791_5079561_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 1
NZ_CP035203	Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence	202829	49811	106666	202829	integrase,transposase	Planktothrix_phage(16.67%)	48	48736:48753	66887:66904
48736:48753	attL	AAAAGTAACTTTTCTATC	NA	NA	NA	NA
WP_014386529.1|49811_50948_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004026552.1|51013_51331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197568.1|51481_51805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048298751.1|51801_52560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048298752.1|52556_53516_-	DNA replication protein	NA	NA	NA	NA	NA
WP_004186937.1|53558_53966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020477096.1|53975_54419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_093515582.1|54439_55668_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	79.1	7.5e-141
WP_048298753.1|55714_57307_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.6	6.1e-175
WP_048298754.1|57337_57688_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.9	1.2e-38
WP_048298755.1|57684_58125_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	59.0	1.3e-18
WP_004117790.1|60698_61670_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
WP_023287153.1|61669_62836_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	7.5e-223
WP_071600414.1|62791_63040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072198301.1|63254_63536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017900946.1|63565_64576_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
WP_023288364.1|66896_67433_-	hypothetical protein	NA	NA	NA	NA	NA
66887:66904	attR	GATAGAAAAGTTACTTTT	NA	NA	NA	NA
WP_032413397.1|70390_71335_-	ectoine utilization protein EutC	NA	A0A1V0SL93	Klosneuvirus	23.0	7.8e-13
WP_032731846.1|71331_72351_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_148662571.1|72445_73171_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	40.6	6.8e-33
WP_032413390.1|73275_74058_-	ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA	NA	G9BWD6	Planktothrix_phage	36.7	1.7e-29
WP_048281129.1|74072_74729_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
WP_032413447.1|74725_75385_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
WP_032413386.1|75509_76364_-	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
WP_032413385.1|76555_77965_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.8	1.2e-12
WP_032413383.1|78458_79649_+	ectoine hydrolase DoeA	NA	NA	NA	NA	NA
WP_032413381.1|79661_80660_+	N-alpha-acetyl diaminobutyric acid deacetylase DoeB	NA	NA	NA	NA	NA
WP_032413379.1|80706_81885_+	cystathionine gamma-synthase family protein	NA	A0A1V0SL56	Klosneuvirus	23.5	1.5e-16
WP_032413377.1|82021_82369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071571073.1|82929_83115_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	59.6	1.3e-09
WP_032413443.1|83827_84271_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_032413375.1|84267_84738_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_017901409.1|84847_85108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152650719.1|86235_87159_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_004118832.1|87393_89127_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_049013026.1|89134_90082_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	23.0	3.3e-11
WP_004152278.1|90126_91731_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|91743_92664_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118228.1|92663_93512_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_049013025.1|93508_94102_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|94098_95226_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_152650719.1|95620_96544_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_049013986.1|96836_99146_+	ATPase	NA	NA	NA	NA	NA
WP_049013985.1|99149_100466_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_049013984.1|100462_102658_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_001261276.1|104456_104687_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_049014623.1|104683_105100_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_085955508.1|105545_106666_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.4	3.9e-51
>prophage 2
NZ_CP035203	Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence	202829	113237	180995	202829	transposase	Enterobacteria_phage(21.74%)	51	NA	NA
WP_152650720.1|113237_114161_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	1.1e-171
WP_049013079.1|114603_115173_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_049013078.1|115231_115924_+	molecular chaperone	NA	NA	NA	NA	NA
WP_049013075.1|115938_118332_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_049013073.1|118352_119372_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_064171841.1|120258_120723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142286066.1|121431_122355_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	1.6e-172
WP_048298735.1|122821_124687_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_072072824.1|125740_126772_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_152650721.1|126890_128115_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	78.1	9.5e-136
WP_048298731.1|128557_129655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048298730.1|129701_131273_+	ATP--cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
WP_071993384.1|131269_131542_+	zinc/iron-chelating domain-containing protein	NA	NA	NA	NA	NA
WP_114139113.1|133010_134145_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.1	3.8e-46
WP_152650715.1|134185_135459_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.4	8.1e-146
WP_112162748.1|137354_138278_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	2.1e-172
WP_077267131.1|138836_138950_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	78.4	1.1e-09
WP_077267129.1|139041_140640_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.9	4.3e-19
WP_000149431.1|143122_144430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000895052.1|144426_146583_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	41.7	5.2e-36
WP_000227969.1|148300_149377_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077267130.1|149714_150080_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	62.8	3.8e-40
WP_012540252.1|150297_150648_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	5.3e-23
WP_012540111.1|150695_151058_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_064175016.1|151075_152827_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_012540054.1|152873_154163_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.5	4.6e-173
WP_012540118.1|154175_154601_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.5e-51
WP_116397520.1|154635_155172_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_035897911.1|155309_156233_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	6.6e-166
WP_003032889.1|156603_156954_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	1.2e-19
WP_000790483.1|157097_157529_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_049014823.1|157779_159255_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	6.1e-28
WP_001572351.1|159247_159928_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|160117_161503_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|161531_161885_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_001485328.1|161998_163291_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_048298744.1|163301_166448_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.6	6.1e-62
WP_008322815.1|166534_166975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152650722.1|167101_169549_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|169589_169787_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|169820_170558_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|170846_171296_-	copper resistance protein	NA	NA	NA	NA	NA
WP_048298742.1|171529_173347_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_130943622.1|173352_174243_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_040221028.1|174282_174663_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_000998778.1|174667_175597_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_009309896.1|175651_176332_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.8	3.0e-30
WP_004152084.1|176328_177729_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_048298741.1|177944_178379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049014828.1|178790_178877_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_152650720.1|180071_180995_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	1.1e-171
>prophage 1
NZ_CP035204	Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence	141746	57	37074	141746	integrase,transposase	Salmonella_phage(25.0%)	37	7106:7165	32251:33072
WP_039026396.1|57_372_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_039026397.1|368_1190_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	28.7	3.5e-09
WP_063102497.1|1714_2101_-	bleomycin binding protein	NA	NA	NA	NA	NA
WP_152650725.1|6096_6753_+	QnrS family quinolone resistance pentapeptide repeat protein	NA	NA	NA	NA	NA
WP_152650726.1|6765_7122_+	hypothetical protein	NA	NA	NA	NA	NA
7106:7165	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|7168_7873_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_011264039.1|7945_8185_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_000612791.1|8330_9194_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|9231_9477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|9945_10737_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_104772209.1|11591_11855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|11916_12249_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|12418_13210_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|13302_14562_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206356.1|14823_15615_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|15620_15911_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|16022_16520_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845048.1|16667_17681_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|17883_18234_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|18359_18920_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015344976.1|18922_21874_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|21882_22284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|22368_23073_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_074180790.1|23130_23967_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|23997_24882_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|25098_26313_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|26340_26646_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|26757_28251_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|28281_28533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|28426_28729_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|28815_29631_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_085940648.1|29720_30810_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_072202717.1|31007_31487_-	phenol hydroxylase	NA	NA	NA	NA	NA
WP_001067855.1|31542_32247_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_016338361.1|34127_35051_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.7	6.2e-172
32251:33072	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCACTTCGACGACTACCTGCTGCCGGCCGAGAAGTTCGCCGCACTCAAGCGCGAGCAGGCCCTGCCCCTGGCGATCAACCCGAACAGCGACCAGTACCTGGAAGAGCGTTTGCAGCTGCTGGACGAGCAGTTGGCCACCGTCACCCGCCTGGCCAAGGACAACGAGCTGCCCGATGCCATCCTCACCGAGTCAGGGCTGAAAATCACCCCGCTGGATGCGGCGGTGCCGGATCGGGCGCAGGCGCTGATCGACCAAACCAGCCAGTTACTGCCGCGCATCAAGATCACCGAACTGCTGATGGACGTGGACGACTGGACGGGCTTCAGCCGCCACTTCACCCACTTGAAGGACGGGGCCGAGGCCAAAGACAGGACGTTGCTGCTGTCCGCAATCCTCGGTGATGCGATCAACCTCGGGCTGACCAAGATGGCCGAGTCGAGCCCCGGCCTGACCTACGCCAAGCTGTCCTGGCTGCAAGCCTGGCACATCCGCGACGAAACCTATTCGGCGGCCTTGGCCGAGCTGGTCAACCACCAGTATCGCCACGCCTTTGCCGCCCACTGGGGCGACGGCACGACCTCATCCTCCGATGGCCAGCGCTTCCGCGCGGGTGGCCGGGGCGAGAGCACCGGGCACGTCAACCCGAAGTACGGTAGCGAGCCGGGACGGCTGTTCTATACCCATATCTCCGACCAGTACGCGCCGTTCAGCACCCGCGTGGTGAATGTCGGCGTCCGCGATTCCACCTATGTGCTCGACGGCC	NA	NA	NA	NA
WP_001039464.1|35190_35577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012695466.1|36150_37074_+|transposase	IS5-like element IS903B family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.7	4.6e-175
>prophage 2
NZ_CP035204	Klebsiella pneumoniae strain LH94 plasmid pLH94-8, complete sequence	141746	111257	118268	141746	integrase	Escherichia_phage(50.0%)	7	113141:113153	119861:119873
WP_001568038.1|111257_112229_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_001568036.1|112462_112894_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_004197646.1|112893_114165_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
113141:113153	attL	TGATGAACTGCCT	NA	NA	NA	NA
WP_004098982.1|114576_115452_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_004197649.1|116108_116735_+	ParA family plasmid-partitioning AAA ATPase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
WP_077253981.1|116854_117034_+	Par-like protein	NA	NA	NA	NA	NA
WP_004197635.1|117473_118268_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
119861:119873	attR	AGGCAGTTCATCA	NA	NA	NA	NA
