The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045389	Roseivivax sp. THAF30 chromosome, complete genome	3832321	778038	827101	3832321	integrase,capsid,terminase	Cedratvirus(14.29%)	49	819124:819171	830295:830342
WP_172974929.1|778038_779343_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_152461483.1|779372_781457_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_152461484.1|781487_781715_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_152461485.1|781964_784109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152461487.1|784989_785634_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152463636.1|785759_786593_+	FAD binding domain-containing protein	NA	NA	NA	NA	NA
WP_152461488.1|786589_787090_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_152461489.1|787086_789468_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_152461490.1|789516_790569_+	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
WP_152461491.1|790640_791207_+	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_152461492.1|791203_792532_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_152461493.1|792690_793557_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_152461494.1|793567_794425_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152461495.1|794428_795415_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_152461496.1|795423_796956_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	28.4	2.6e-13
WP_152461497.1|797031_798078_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_152463637.1|798120_799011_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_152461498.1|799535_800168_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	28.3	1.3e-06
WP_152461499.1|800524_800806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152461500.1|800891_801386_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_152461501.1|801382_801844_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_152461502.1|801977_802250_-	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_152461503.1|802368_803196_+	glutaredoxin	NA	NA	NA	NA	NA
WP_152461504.1|803741_804215_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	44.3	3.0e-13
WP_152463638.1|804592_805204_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_152461505.1|805673_806060_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_152461506.1|806123_807638_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_152461507.1|807659_808091_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_152461508.1|808087_809059_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_152461509.1|809276_810233_+	hydroxymethylglutaryl-CoA lyase	NA	A0A1V0SKU2	Klosneuvirus	33.6	8.4e-31
WP_152461510.1|810229_811438_+	CoA transferase	NA	NA	NA	NA	NA
WP_152461511.1|812079_812367_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_152461512.1|812431_812920_+	GFA family protein	NA	NA	NA	NA	NA
WP_152461513.1|813205_813568_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_152461514.1|813743_814796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152461515.1|815080_815437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152461516.1|815849_816164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152461517.1|816697_818992_-	hypothetical protein	NA	NA	NA	NA	NA
819124:819171	attL	TTGGCTCCGGCGGTAGGGATCGAACCTACGACCAATTGATTAACAGTC	NA	NA	NA	NA
WP_152461518.1|819337_820570_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1W6JPG6	Morganella_phage	30.1	1.0e-36
WP_152461519.1|820566_821307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152461520.1|821375_821597_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_152461521.1|821593_821998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152461522.1|821994_822213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152463639.1|822251_822524_+	hypothetical protein	NA	A0A1W6JT39	Escherichia_phage	44.8	4.1e-15
WP_152461523.1|823113_823659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152461524.1|823651_825184_+|terminase	terminase	terminase	NA	NA	NA	NA
WP_152461525.1|825174_825522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152461526.1|825518_825848_+	HNH endonuclease	NA	A0A2I7SC46	Paenibacillus_phage	35.5	3.8e-07
WP_152461527.1|825850_827101_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
830295:830342	attR	TTGGCTCCGGCGGTAGGGATCGAACCTACGACCAATTGATTAACAGTC	NA	NA	NA	NA
>prophage 2
NZ_CP045389	Roseivivax sp. THAF30 chromosome, complete genome	3832321	1579054	1586306	3832321		uncultured_Mediterranean_phage(66.67%)	9	NA	NA
WP_152463683.1|1579054_1580170_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	38.3	8.1e-33
WP_152462044.1|1580316_1580994_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_093012425.1|1581205_1581424_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	49.1	6.9e-05
WP_152462045.1|1581435_1581891_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_093012431.1|1581887_1582772_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	37.2	9.5e-37
WP_152462046.1|1582768_1583611_+	DUF815 domain-containing protein	NA	NA	NA	NA	NA
WP_152462047.1|1583626_1584808_-	peptidoglycan DD-metalloendopeptidase family protein	NA	G9FHH0	Rhodococcus_phage	38.5	5.2e-06
WP_152462048.1|1584879_1585524_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.1	4.5e-28
WP_152462049.1|1585520_1586306_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	34.6	8.2e-32
>prophage 3
NZ_CP045389	Roseivivax sp. THAF30 chromosome, complete genome	3832321	2840192	2875763	3832321	protease,head,portal,tail,tRNA,capsid	Paracoccus_phage(18.18%)	39	NA	NA
WP_152462897.1|2840192_2841266_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	33.5	6.1e-30
WP_093009352.1|2841444_2841729_+	YrhK family protein	NA	NA	NA	NA	NA
WP_152462898.1|2841798_2844195_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_093009354.1|2844260_2844710_+	YtoQ family protein	NA	NA	NA	NA	NA
WP_093009411.1|2844817_2845240_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_152462899.1|2845360_2846248_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_152462900.1|2846250_2846973_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_093009413.1|2846972_2847296_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_093009414.1|2847408_2847798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152463740.1|2847945_2848383_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_152462901.1|2848444_2849995_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.1	1.4e-22
WP_152462902.1|2850072_2850261_-	DUF2065 family protein	NA	NA	NA	NA	NA
WP_152462903.1|2850271_2851417_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_152462904.1|2851416_2852580_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_152462905.1|2852643_2854125_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_093009420.1|2854318_2855107_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_152462906.1|2855290_2856664_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_152462907.1|2856724_2857681_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_152462908.1|2857670_2858963_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_093009718.1|2858959_2859214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152462909.1|2859102_2859705_+	E3 binding domain-containing protein	NA	NA	NA	NA	NA
WP_172975012.1|2859774_2860932_-	porin	NA	NA	NA	NA	NA
WP_152462911.1|2861033_2861852_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_152462912.1|2861933_2862269_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_152462913.1|2866170_2866638_-	C40 family peptidase	NA	A0A1V0DYB6	Dinoroseobacter_phage	46.4	1.1e-28
WP_152462914.1|2866634_2867522_-	DUF2163 domain-containing protein	NA	A0A0K0PVK1	Roseobacter_phage	40.2	2.0e-58
WP_152462915.1|2867518_2868151_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	47.1	8.0e-54
WP_152462916.1|2868161_2868815_-|tail	phage tail tape measure protein	tail	D6PFD6	uncultured_phage	32.7	1.7e-14
WP_152462917.1|2868811_2869006_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_152462918.1|2868995_2869325_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_093009435.1|2869328_2869748_-|tail	phage major tail protein, TP901-1 family	tail	A0A1J0GVL1	Pseudoalteromonas_phage	32.1	7.8e-05
WP_152462919.1|2869762_2870179_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_152462920.1|2870175_2870514_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_152462921.1|2870510_2871104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152462922.1|2871183_2872368_-|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	44.5	4.5e-66
WP_152462923.1|2872397_2872943_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	48.4	1.1e-30
WP_152462924.1|2872966_2873194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152462925.1|2873186_2874371_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	36.9	1.8e-59
WP_152463741.1|2874521_2875763_-	ATP-binding protein	NA	A0A0K1LMR9	Caulobacter_phage	41.8	2.3e-73
