The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045258	Yersinia pestis strain SCPM-O-B-5942 (I-2638) chromosome, complete genome	4635506	384292	451721	4635506	transposase	Escherichia_phage(40.0%)	51	NA	NA
WP_000255944.1|384292_385315_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|385314_386094_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211540.1|386132_386468_+	deoxyribonuclease	NA	NA	NA	NA	NA
WP_002211541.1|386482_387505_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_002211542.1|387614_388103_-	transcription/translation regulatory transformer protein RfaH	NA	NA	NA	NA	NA
WP_002215917.1|388350_389847_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_002215918.1|389901_390603_+	NAD(P)H-flavin reductase	NA	NA	NA	NA	NA
WP_002211545.1|390762_391926_-	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
WP_002211546.1|391937_394127_-	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
WP_002211547.1|394453_395785_+	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_002211548.1|395784_395994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213759.1|396098_396557_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211550.1|397145_398597_+	Trk system potassium transporter TrkH	NA	NA	NA	NA	NA
WP_002215920.1|398618_399152_+	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_002218887.1|399435_399621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212288.1|405288_406326_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_002212289.1|406322_407282_+	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_002212290.1|407316_408267_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.2	8.7e-28
WP_002217850.1|408477_409029_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255944.1|409118_410141_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|410140_410920_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210669.1|411976_413161_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
WP_002210670.1|413411_413795_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002210671.1|413796_414342_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
WP_002210672.1|414532_414961_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002210673.1|414964_415669_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002210674.1|416033_416531_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002210675.1|416597_416966_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002210676.1|417308_421337_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
WP_002210677.1|421465_425686_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
WP_002213775.1|425812_426271_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210678.1|426702_427833_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002228257.1|427825_428641_-	thiazole synthase	NA	NA	NA	NA	NA
WP_002217275.1|428642_428858_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_002210680.1|428854_429652_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.8	1.6e-11
WP_002210681.1|429641_430316_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_002210682.1|430302_432348_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_002210683.1|432723_433233_-	sigma D regulator	NA	NA	NA	NA	NA
WP_002210684.1|433329_434112_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_002210685.1|434204_434990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210686.1|435108_436176_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_002210687.1|436205_436946_+	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_002210688.1|436991_437582_+	YjaG family protein	NA	NA	NA	NA	NA
WP_002210689.1|437770_438046_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
WP_002355296.1|438095_438749_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210691.1|438896_440183_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002210692.1|440242_441832_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.2e-68
WP_002218887.1|442299_442485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086016626.1|448155_449254_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	2.2e-46
WP_001297096.1|449919_450699_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|450698_451721_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 2
NZ_CP045258	Yersinia pestis strain SCPM-O-B-5942 (I-2638) chromosome, complete genome	4635506	877852	973929	4635506	protease,tRNA,transposase,plate	Escherichia_phage(50.0%)	56	NA	NA
WP_002213759.1|877852_878311_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002354744.1|878448_879729_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002209455.1|879800_880592_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002209456.1|880757_882119_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002209458.1|882346_882595_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002209459.1|882616_883165_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002222284.1|883203_883944_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002209461.1|884024_884372_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002213759.1|884583_885042_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209462.1|885344_886112_-	YdiY family protein	NA	NA	NA	NA	NA
WP_002223245.1|888207_888924_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_002228238.1|889156_890227_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.4	1.5e-89
WP_002209465.1|890239_891361_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001297096.1|891936_892716_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|892715_893738_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211632.1|897315_899388_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_002211633.1|899775_901008_-	peptidase T	NA	A0A0K2CPK3	Brevibacillus_phage	39.1	1.2e-05
WP_002211634.1|901085_902642_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_002211636.1|903360_905178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002214025.1|905386_906262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011055744.1|906342_906429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211637.1|906824_908705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211638.1|908807_919925_-	autotransporter adhesin YapH	NA	A0A2L1IV18	Escherichia_phage	37.8	1.6e-133
WP_002211640.1|920778_921366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211641.1|921643_923134_+	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_002211642.1|923268_926388_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002211643.1|926400_927678_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002214016.1|928116_928314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211645.1|932496_933921_+	MFS transporter	NA	NA	NA	NA	NA
WP_016678666.1|934179_936360_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_002211647.1|936431_937760_-	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_002211648.1|937756_939505_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_002211649.1|939501_940452_-	acetyltransferase	NA	NA	NA	NA	NA
WP_002211651.1|942346_943570_+	MFS transporter	NA	NA	NA	NA	NA
WP_002228661.1|943517_943712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211652.1|943859_944693_-	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_002211654.1|945069_946446_-	peptidase	NA	NA	NA	NA	NA
WP_002211655.1|947007_947751_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002215903.1|947731_948382_-	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
WP_002215902.1|949556_950207_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002215900.1|950657_951053_+	lipoprotein	NA	NA	NA	NA	NA
WP_002211662.1|953328_953829_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215896.1|953871_955416_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211664.1|955427_956780_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210015.1|956776_957463_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002228049.1|957462_959199_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002210014.1|959202_959694_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002210013.1|960111_962760_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_002210012.1|962756_965105_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	3.1e-18
WP_002210011.1|965119_967342_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_016257642.1|967485_967842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216110.1|968015_968210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210010.1|969434_970070_+	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002210009.1|970085_972383_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210008.1|972369_973137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016632.1|973232_973929_+|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
>prophage 3
NZ_CP045258	Yersinia pestis strain SCPM-O-B-5942 (I-2638) chromosome, complete genome	4635506	1396902	1478646	4635506	plate,protease,tail,transposase,coat	Pseudomonas_phage(17.86%)	70	NA	NA
WP_002210815.1|1396902_1397412_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_002210816.1|1397446_1397704_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210817.1|1397707_1398838_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210818.1|1399000_1401289_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210820.1|1401782_1402511_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210821.1|1402772_1405448_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.0e-102
WP_002228028.1|1405635_1408509_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210824.1|1408576_1409230_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_002216094.1|1409232_1409805_-	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_002216093.1|1409972_1411925_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002210825.1|1411948_1413103_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210826.1|1414205_1415321_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002213759.1|1415522_1415981_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002228026.1|1416770_1417937_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002208870.1|1418211_1419738_-	MFS transporter	NA	NA	NA	NA	NA
WP_002208869.1|1420114_1421143_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208868.1|1421216_1423004_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208867.1|1423425_1424361_-	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208866.1|1424532_1424775_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208864.1|1424980_1425703_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002215470.1|1425976_1426456_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208862.1|1426666_1427971_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002208861.1|1428679_1429492_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208860.1|1429467_1430262_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208859.1|1430892_1431183_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208858.1|1431228_1431846_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208857.1|1431850_1432045_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208856.1|1432041_1433550_+|tail	tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208855.1|1433571_1433940_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002208854.1|1433941_1434241_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208853.1|1434361_1435855_+|coat	coat protein	coat	NA	NA	NA	NA
WP_002208852.1|1436121_1437528_+	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208850.1|1437524_1438580_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002215460.1|1438595_1439192_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208848.1|1439188_1439644_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002208847.1|1439647_1440784_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002215458.1|1440780_1441041_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208846.1|1441037_1441385_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002208845.1|1441481_1442261_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208843.1|1442558_1443299_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208842.1|1443589_1445026_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208841.1|1445151_1445514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208840.1|1446213_1446702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208839.1|1446714_1447863_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_002230704.1|1448219_1448603_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208837.1|1448833_1450630_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002208836.1|1450657_1450885_-	YejL family protein	NA	NA	NA	NA	NA
WP_002208835.1|1451062_1452067_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002213775.1|1452267_1452726_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208834.1|1452864_1453149_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_002208833.1|1453310_1455068_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	2.3e-98
WP_002208832.1|1455581_1456289_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_002208831.1|1456407_1457607_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.1	1.3e-23
WP_002208829.1|1458573_1458918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208828.1|1458978_1460571_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	1.3e-20
WP_002208827.1|1460572_1461601_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002208826.1|1461600_1462701_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_002208825.1|1462710_1464519_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_071525527.1|1464600_1466118_-	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_002208822.1|1466768_1467353_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	2.8e-13
WP_002208820.1|1467794_1468496_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002208819.1|1468554_1469538_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_002208816.1|1470345_1471089_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208815.1|1471232_1472705_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	7.1e-45
WP_002208813.1|1473289_1474483_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002228019.1|1474622_1475195_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_002208812.1|1475298_1476543_-	tryptophan permease	NA	NA	NA	NA	NA
WP_002208811.1|1476917_1477172_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_134811445.1|1477240_1478080_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.6	9.1e-13
WP_002213759.1|1478187_1478646_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP045258	Yersinia pestis strain SCPM-O-B-5942 (I-2638) chromosome, complete genome	4635506	1531964	1575622	4635506	protease,transposase,coat	Escherichia_phage(14.29%)	36	NA	NA
WP_000255944.1|1531964_1532987_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215943.1|1533393_1533783_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_002210859.1|1533892_1534132_-	YebV family protein	NA	NA	NA	NA	NA
WP_002210858.1|1534339_1535329_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_002210857.1|1535534_1537982_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210856.1|1538152_1538905_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002216611.1|1538935_1539493_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|1539513_1540044_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_134816660.1|1540049_1540604_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216616.1|1541082_1543734_-	PqiB family protein	NA	NA	NA	NA	NA
WP_002367629.1|1543702_1544950_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002210850.1|1545181_1545679_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002210849.1|1545774_1546488_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210848.1|1546507_1548580_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210847.1|1549053_1549935_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_002210846.1|1550592_1551135_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002215118.1|1551287_1552067_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_002210844.1|1552148_1554761_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002215120.1|1554757_1555921_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002210843.1|1555917_1556721_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002210842.1|1556774_1558142_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210841.1|1558468_1559635_+	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_002210840.1|1559821_1560613_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_002210839.1|1560997_1561849_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
WP_002210838.1|1562063_1563455_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_002210837.1|1563658_1564207_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
WP_002210836.1|1564686_1565397_-	porin	NA	NA	NA	NA	NA
WP_002210835.1|1565694_1566987_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002210834.1|1567002_1568130_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_002210833.1|1568143_1569064_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002210832.1|1569056_1569947_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002210831.1|1569987_1571655_-	pectate disaccharide-lyase	NA	NA	NA	NA	NA
WP_002210830.1|1571990_1572752_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
WP_002210829.1|1572843_1573680_-	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_002210828.1|1574015_1574366_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|1574413_1575622_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 5
NZ_CP045258	Yersinia pestis strain SCPM-O-B-5942 (I-2638) chromosome, complete genome	4635506	1979751	2080026	4635506	lysis,integrase,tail,tRNA,transposase	Escherichia_phage(14.81%)	102	1990303:1990333	2031317:2031347
WP_002211184.1|1979751_1980450_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002211183.1|1980586_1981192_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_087768167.1|1981192_1981300_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002220632.1|1981834_1983523_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
WP_002211181.1|1983682_1984804_+	ribonuclease D	NA	NA	NA	NA	NA
WP_002211180.1|1985040_1985310_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211179.1|1985313_1986126_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002220631.1|1986150_1986837_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211743.1|1987557_1987830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215627.1|1987970_1989056_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211740.1|1989126_1989783_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002211739.1|1989885_1990332_+	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
1990303:1990333	attL	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211738.1|1990358_1991597_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_000255944.1|1991666_1992689_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|1992688_1993468_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215632.1|1993635_1993896_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_071525537.1|1994195_1994945_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002211736.1|1994920_1995367_+	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_002211735.1|1995440_1996046_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002215636.1|1996046_1996436_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002215638.1|1996439_1996658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|1996706_1997270_+	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002211731.1|1997693_1997903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215644.1|1997899_1998175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002430108.1|1998420_1998618_+	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002211730.1|1998648_1999161_+	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002211729.1|1999145_1999604_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211727.1|2000149_2000863_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211725.1|2001319_2001955_+	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211724.1|2001985_2002435_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211723.1|2002438_2003023_+	hypothetical protein	NA	A0A0R6PHH0	Moraxella_phage	70.7	4.8e-69
WP_002209743.1|2003070_2004279_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211722.1|2004283_2005258_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	81.1	2.3e-153
WP_002228445.1|2005257_2005986_+	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002228446.1|2006004_2006646_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002211721.1|2006646_2007759_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002211720.1|2007880_2008654_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211719.1|2008667_2009873_+	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211718.1|2009920_2010403_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211717.1|2010399_2010654_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211716.1|2010655_2011006_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211715.1|2011007_2011592_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211714.1|2011588_2011996_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211713.1|2012061_2012982_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211712.1|2012994_2013306_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_071525538.1|2013353_2013614_+	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211711.1|2013614_2017118_+|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_002211710.1|2017120_2017462_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002211709.1|2017635_2018388_+|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002211708.1|2018390_2019101_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211707.1|2019361_2019994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211706.1|2020072_2020504_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211705.1|2020627_2020795_+	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211704.1|2020868_2021876_+	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002214482.1|2021974_2022526_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211701.1|2022668_2022884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|2022939_2023560_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002359202.1|2023734_2023956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|2024131_2027335_+	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002211697.1|2027334_2028333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211696.1|2028349_2029267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097608205.1|2029328_2029697_+|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002209743.1|2029917_2031126_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002214492.1|2031430_2032603_-	MFS transporter	NA	NA	NA	NA	NA
2031317:2031347	attR	ATATTGAATAAGCCGAGTTGGGCTAAATAAC	NA	NA	NA	NA
WP_002211693.1|2032606_2033806_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002211692.1|2033822_2034563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214494.1|2035654_2036011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002227934.1|2036427_2036958_-	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002211689.1|2037193_2038768_-	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002211688.1|2039011_2039731_+	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211687.1|2039948_2041484_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211686.1|2041949_2043254_+	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_038951884.1|2043269_2044472_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	5.8e-29
WP_002211685.1|2044736_2045606_-	pirin family protein	NA	NA	NA	NA	NA
WP_002211684.1|2045803_2046709_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211683.1|2046743_2047862_-	DMT family transporter	NA	NA	NA	NA	NA
WP_002216501.1|2047969_2049244_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211681.1|2049393_2051328_-	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002430110.1|2051771_2052521_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211679.1|2052593_2053469_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002224141.1|2053782_2054778_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211677.1|2055125_2055539_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002217933.1|2055609_2055882_+	YeaC family protein	NA	NA	NA	NA	NA
WP_002211676.1|2056015_2056663_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002211675.1|2056677_2057694_-	asparaginase	NA	NA	NA	NA	NA
WP_002211674.1|2057810_2059661_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211673.1|2059823_2060375_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211671.1|2060599_2061646_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002211670.1|2061707_2063633_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211669.1|2063629_2063920_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211668.1|2063932_2064319_-	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211667.1|2064416_2065223_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211665.1|2066031_2066892_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152406422.1|2067146_2068352_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.7	1.5e-40
WP_002210667.1|2070253_2071123_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	5.5e-13
WP_002210666.1|2071206_2071671_-	YchJ family protein	NA	NA	NA	NA	NA
WP_002210665.1|2073004_2074021_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210664.1|2074327_2075674_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002223593.1|2076108_2076516_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002210659.1|2077265_2077856_+	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	55.8	1.5e-54
WP_001297096.1|2078224_2079004_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2079003_2080026_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 6
NZ_CP045258	Yersinia pestis strain SCPM-O-B-5942 (I-2638) chromosome, complete genome	4635506	2412357	2456875	4635506	lysis,tRNA,transposase,plate	Indivirus(14.29%)	36	NA	NA
WP_002211870.1|2412357_2414385_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
WP_002213775.1|2414548_2415007_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002228565.1|2415224_2415887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211975.1|2416584_2417661_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211974.1|2417678_2418932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211973.1|2419264_2420446_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211971.1|2420687_2421095_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002211970.1|2421091_2421787_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_002211969.1|2422112_2422997_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_002211968.1|2423352_2425050_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002211966.1|2425330_2426068_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_002211965.1|2426512_2427523_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_002211964.1|2427543_2429064_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.6e-10
WP_002211963.1|2429293_2430286_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002211961.1|2431033_2432200_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_002211960.1|2432254_2432917_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_002211959.1|2433100_2434252_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211958.1|2434387_2435257_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211957.1|2435530_2436670_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.9	5.2e-35
WP_002211956.1|2436690_2437533_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002227980.1|2437789_2438002_+	peptide antibiotic darobactin C	NA	NA	NA	NA	NA
WP_002215886.1|2438085_2440446_+	darobactin export ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002211952.1|2440447_2441710_+	darobactin export ABC transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002211951.1|2441711_2442380_+	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
WP_002211950.1|2442389_2443700_+	darobactin maturation radical SAM/SPASM protein DarE	NA	NA	NA	NA	NA
WP_002211949.1|2444234_2445509_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_002211948.1|2445510_2446281_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_002209743.1|2446416_2447625_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211947.1|2447668_2448322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|2448549_2450145_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211945.1|2450827_2451451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211944.1|2451662_2453030_-	membrane protein	NA	NA	NA	NA	NA
WP_002211943.1|2453054_2453507_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002214552.1|2453506_2454088_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211941.1|2454062_2455148_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211940.1|2455111_2456875_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 7
NZ_CP045258	Yersinia pestis strain SCPM-O-B-5942 (I-2638) chromosome, complete genome	4635506	2481738	2548858	4635506	tRNA,protease,plate,transposase	Streptococcus_phage(20.0%)	56	NA	NA
WP_002213011.1|2481738_2483091_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002214707.1|2483102_2484653_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213014.1|2484695_2485196_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002213016.1|2486184_2487033_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002213017.1|2487131_2487380_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_002228570.1|2487417_2487858_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213024.1|2487944_2488733_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213025.1|2488735_2489488_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_002213026.1|2489489_2490209_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213028.1|2490201_2491440_-	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|2491455_2492193_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213032.1|2492194_2493478_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213034.1|2493467_2493992_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213036.1|2494255_2494474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213038.1|2495204_2495951_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213039.1|2496104_2498522_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213046.1|2502167_2502497_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213049.1|2502548_2502827_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002213052.1|2502920_2504111_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213054.1|2504171_2504489_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213056.1|2504597_2505014_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213058.1|2505329_2506010_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213060.1|2506188_2506653_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002221095.1|2506713_2508768_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.8	1.5e-16
WP_002213062.1|2508961_2509408_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002213063.1|2509437_2511576_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213064.1|2511677_2512313_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213065.1|2512541_2513048_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213066.1|2513405_2514467_+	porin OmpA	NA	NA	NA	NA	NA
WP_002213775.1|2514656_2515115_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002226586.1|2515283_2515739_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002224683.1|2515949_2517701_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002220006.1|2517769_2518288_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002211286.1|2518553_2518742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|2519375_2520398_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2520397_2521177_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213775.1|2522337_2522796_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002228015.1|2522993_2523161_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_002211289.1|2523430_2524009_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_002211290.1|2524382_2526035_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_002211291.1|2526021_2527308_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_002211292.1|2527436_2529350_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.5e-47
WP_016678671.1|2529355_2531476_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_002363919.1|2531578_2532688_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_002211295.1|2532713_2533265_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_002211296.1|2533447_2534458_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_002220013.1|2535093_2537709_-	aminopeptidase N	NA	NA	NA	NA	NA
WP_002228013.1|2538424_2539630_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002211301.1|2540128_2541529_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.2	6.5e-80
WP_002354007.1|2541829_2542909_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	56.5	3.2e-111
WP_002211303.1|2543165_2544356_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002430096.1|2544509_2544626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211304.1|2544779_2545427_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.3	2.2e-22
WP_002211305.1|2545487_2546036_-	YcbK family protein	NA	A0A0K1LLY2	Rhodobacter_phage	34.7	7.8e-05
WP_002217987.1|2546259_2548116_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002213759.1|2548399_2548858_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP045258	Yersinia pestis strain SCPM-O-B-5942 (I-2638) chromosome, complete genome	4635506	2919483	2989377	4635506	tRNA,transposase,plate	Escherichia_phage(25.0%)	60	NA	NA
WP_032465663.1|2919483_2920314_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002209726.1|2920364_2921375_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002209725.1|2921544_2922672_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A285PXZ1	Cedratvirus	27.9	6.1e-20
WP_002209724.1|2922718_2923504_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002209722.1|2923729_2924647_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002209721.1|2924931_2925969_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_002209720.1|2926310_2926841_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002209717.1|2928731_2929955_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_002209716.1|2930126_2932196_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002209715.1|2932373_2932652_-	YfcL family protein	NA	NA	NA	NA	NA
WP_002209714.1|2932709_2933252_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002209713.1|2933351_2934158_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_002225365.1|2934161_2934989_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002209711.1|2934994_2936080_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.4	2.7e-89
WP_002209710.1|2936156_2937089_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002227846.1|2937458_2937989_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_152406425.1|2938169_2938415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209707.1|2938494_2938986_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_002209705.1|2939554_2941879_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002209704.1|2941878_2943189_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_002227845.1|2943475_2943772_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_002209702.1|2944185_2945451_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_002209701.1|2945557_2946322_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_002209700.1|2946357_2947584_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_002214855.1|2947583_2948096_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_002209699.1|2948092_2948659_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_002209698.1|2948655_2950626_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_002209697.1|2950622_2951117_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_002209696.1|2951113_2951416_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_002209695.1|2951412_2952150_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_002209694.1|2952212_2952872_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_002209693.1|2952841_2953498_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A1V0SE00	Indivirus	24.7	4.8e-09
WP_002209692.1|2953942_2954410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209691.1|2955025_2955568_+	LemA family protein	NA	NA	NA	NA	NA
WP_002209690.1|2955572_2957612_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_002209688.1|2957987_2958329_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_002209687.1|2958403_2958751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209686.1|2958775_2959255_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002209685.1|2959367_2960174_-	ImpE family protein	NA	NA	NA	NA	NA
WP_002354537.1|2960193_2961036_-	TagK domain-containing protein	NA	NA	NA	NA	NA
WP_002209684.1|2961041_2961302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013060340.1|2961400_2964007_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.1	3.3e-29
WP_002214843.1|2964333_2968161_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_002209681.1|2968169_2969006_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_001297096.1|2969021_2969801_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2969800_2970823_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211571.1|2971501_2972851_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_038952315.1|2972854_2973394_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211573.1|2973667_2974153_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211574.1|2974478_2975981_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211575.1|2976004_2976529_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211576.1|2976633_2977242_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211577.1|2977226_2978417_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|2978441_2979650_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002215157.1|2979671_2981222_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211579.1|2981349_2982111_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002211580.1|2982267_2982813_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002215317.1|2983013_2985689_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211582.1|2986471_2988352_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002211583.1|2988351_2989377_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 9
NZ_CP045258	Yersinia pestis strain SCPM-O-B-5942 (I-2638) chromosome, complete genome	4635506	3402748	3448119	4635506	tRNA,protease,integrase,transposase	Escherichia_phage(22.22%)	46	3418493:3418507	3446078:3446092
WP_002213775.1|3402748_3403207_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_138921619.1|3403452_3405765_+	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_002209745.1|3405977_3406223_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	7.2e-19
WP_002216002.1|3406895_3407477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209746.1|3407744_3408146_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_002209748.1|3408377_3408779_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_002209749.1|3408790_3409363_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002227852.1|3409386_3409638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209751.1|3409676_3409916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209752.1|3410724_3412641_+	autotransporter adhesin YapC	NA	NA	NA	NA	NA
WP_002224869.1|3412764_3412887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209753.1|3413175_3413757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209743.1|3414158_3415367_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209756.1|3415818_3418026_+	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_002209757.1|3418018_3418549_+	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
3418493:3418507	attL	TCGGCGTTGCTGACC	NA	NA	NA	NA
WP_002209758.1|3418707_3421089_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002209759.1|3421167_3422796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209762.1|3423268_3424120_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	1.2e-49
WP_002209763.1|3424145_3425135_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002209764.1|3425189_3426083_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000255944.1|3426176_3427199_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3427198_3427978_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002215253.1|3428344_3428650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209765.1|3428746_3429148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209766.1|3429129_3430449_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_002209767.1|3430441_3432205_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002209768.1|3432201_3432834_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002209769.1|3432843_3433773_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002209770.1|3433765_3434368_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_002354559.1|3434767_3434974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079866998.1|3435185_3435464_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	73.5	4.2e-31
WP_002215266.1|3435546_3435885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228356.1|3436020_3436518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215268.1|3436631_3436832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215270.1|3437090_3437273_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_002209774.1|3437627_3438494_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
WP_002209775.1|3438508_3438721_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_002213775.1|3438867_3439326_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_016678838.1|3439672_3441058_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.5	3.8e-40
WP_002208567.1|3441268_3441763_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_002208568.1|3441773_3442496_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_002208569.1|3442771_3443296_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_002208570.1|3443292_3444357_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002208571.1|3444400_3446830_-	ABC transporter permease	NA	NA	NA	NA	NA
3446078:3446092	attR	GGTCAGCAACGCCGA	NA	NA	NA	NA
WP_002208572.1|3446826_3447513_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.6e-31
WP_002208573.1|3447483_3448119_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 10
NZ_CP045258	Yersinia pestis strain SCPM-O-B-5942 (I-2638) chromosome, complete genome	4635506	3915585	3991519	4635506	plate,transposase	Escherichia_phage(20.0%)	56	NA	NA
WP_000255944.1|3915585_3916608_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3916607_3917387_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210424.1|3917726_3918113_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002210426.1|3918407_3921122_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210427.1|3921199_3921733_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|3921761_3922286_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|3922452_3923373_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210430.1|3923472_3924624_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002210431.1|3924696_3925953_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002228100.1|3925979_3926807_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|3926808_3927729_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|3927721_3929197_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002210434.1|3929334_3930405_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002210435.1|3930401_3931604_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210436.1|3931603_3932920_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210437.1|3932922_3934005_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210438.1|3933998_3935375_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210439.1|3935371_3936859_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210440.1|3936845_3938609_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|3938674_3938992_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210442.1|3938988_3939951_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210443.1|3939953_3940412_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|3940966_3941056_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|3941513_3941954_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002210447.1|3942084_3943095_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213759.1|3943599_3944058_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002424260.1|3944256_3944781_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_134816711.1|3944753_3946481_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.7	7.8e-59
WP_002216437.1|3946940_3948746_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002216434.1|3949299_3950256_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002210452.1|3950933_3951149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|3951577_3952036_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210453.1|3952182_3953745_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_016678772.1|3953747_3954839_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|3954840_3956271_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|3956285_3956888_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002224086.1|3957128_3958310_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210461.1|3958973_3960635_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002214274.1|3961574_3962567_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002214276.1|3962542_3964150_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002210464.1|3964136_3964847_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|3964915_3965683_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|3965878_3968248_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002220588.1|3968692_3971599_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210468.1|3971854_3972208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210469.1|3975732_3977343_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210470.1|3977339_3978695_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|3978814_3979306_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|3979298_3979664_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|3979669_3980287_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|3980279_3981383_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002224087.1|3981408_3983628_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_002210474.1|3983640_3985989_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|3986092_3988681_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|3988698_3989682_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210477.1|3989674_3991519_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 11
NZ_CP045258	Yersinia pestis strain SCPM-O-B-5942 (I-2638) chromosome, complete genome	4635506	4119628	4185596	4635506	protease,plate,transposase	Escherichia_phage(12.5%)	60	NA	NA
WP_071525507.1|4119628_4119967_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002209171.1|4120310_4121684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209170.1|4121655_4122378_-	histidine kinase	NA	NA	NA	NA	NA
WP_002209169.1|4122427_4123753_-	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_002209167.1|4124776_4126093_-	McrC family protein	NA	NA	NA	NA	NA
WP_002209166.1|4126089_4128153_-	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	33.2	5.3e-30
WP_000255944.1|4128286_4129309_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|4129308_4130088_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210151.1|4131169_4132063_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210150.1|4132324_4133029_+	pirin family protein	NA	NA	NA	NA	NA
WP_002210149.1|4133852_4134752_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.4	1.0e-49
WP_152406430.1|4134814_4136788_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_002210147.1|4136871_4137225_+	YraN family protein	NA	NA	NA	NA	NA
WP_002210146.1|4137495_4138086_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	32.0	3.2e-12
WP_002210145.1|4138096_4138672_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_002210144.1|4138878_4139604_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_002210143.1|4139600_4140254_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002210142.1|4140495_4142832_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.4	9.9e-41
WP_002210140.1|4143095_4144019_-	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_002228691.1|4144841_4149299_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_002210138.1|4149308_4150727_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002224291.1|4151167_4151653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216203.1|4151805_4152321_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
WP_002210135.1|4152326_4152968_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002230558.1|4153147_4153345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210133.1|4153341_4153734_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002210132.1|4153748_4154177_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210131.1|4154490_4155618_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210130.1|4155841_4156246_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002218066.1|4156516_4157890_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002213775.1|4158006_4158465_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210128.1|4158690_4159779_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002210127.1|4159959_4161222_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210126.1|4161375_4161630_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210125.1|4161776_4162079_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210124.1|4162114_4162738_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210123.1|4162750_4163308_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210122.1|4163312_4164095_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210121.1|4164312_4165131_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210120.1|4165395_4166370_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210119.1|4166480_4167467_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002228203.1|4167715_4168279_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002218352.1|4168275_4168839_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002210117.1|4168822_4169368_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002210116.1|4169374_4170100_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210115.1|4170161_4171595_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002213952.1|4172023_4172506_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210113.1|4172811_4173666_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002210112.1|4173662_4173935_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210111.1|4174272_4175208_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210110.1|4175219_4175684_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210109.1|4175821_4176208_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210107.1|4176506_4176983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210106.1|4177216_4178170_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002215779.1|4178580_4179996_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210104.1|4180090_4181758_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002210103.1|4182110_4182521_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210102.1|4182768_4183155_-	cytochrome b562	NA	NA	NA	NA	NA
WP_011055205.1|4183362_4184007_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210100.1|4184255_4185596_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 1
NZ_CP045260	Yersinia pestis strain SCPM-O-B-5942 (I-2638) plasmid pCD, complete sequence	68252	43586	66468	68252	protease,transposase	Enterobacteria_phage(50.0%)	19	NA	NA
WP_002213006.1|43586_44555_-|protease	T3SS effector cysteine protease YopT	protease	NA	NA	NA	NA
WP_002213007.1|45054_45603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229770.1|46200_46830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220902.1|48841_50008_+	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
WP_002213354.1|50004_50970_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	3.1e-89
WP_002224342.1|52141_52384_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_002213360.1|52376_52676_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002229754.1|52815_53475_-	type III secretion system effector GTPase activator YopE	NA	NA	NA	NA	NA
WP_002213403.1|53668_54061_+	YopE transcriptional regulator YerA	NA	NA	NA	NA	NA
WP_002220893.1|54870_56043_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.4	1.6e-220
WP_002213267.1|56817_57243_+	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_086016640.1|57390_58490_-|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002229829.1|58589_58919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224338.1|59057_59522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213258.1|59540_60092_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002213256.1|60255_62571_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.6	1.0e-279
WP_042469136.1|65182_65452_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|65520_65979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213244.1|66150_66468_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP045259	Yersinia pestis strain SCPM-O-B-5942 (I-2638) plasmid pMT, complete sequence	100984	0	97798	100984	transposase,integrase,terminase,tail	Salmonella_phage(79.49%)	99	13549:13566	26607:26624
WP_002214164.1|0_1065_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|1633_1846_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|1845_2181_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|2177_2357_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|2397_2673_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|2740_3151_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|3134_3506_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|3659_4490_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|4493_4694_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_161597819.1|4784_5816_-	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_000920226.1|5863_6130_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|6129_7074_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|7134_8163_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002213135.1|8282_8714_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|8934_9186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213141.1|9258_9822_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002425587.1|9851_10277_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002221186.1|10291_13816_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
13549:13566	attL	CCAATGATTCCATACATC	NA	NA	NA	NA
WP_002211767.1|13996_15232_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|15328_17695_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002228800.1|17804_18017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228802.1|18279_18666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353208.1|18660_19764_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
WP_002216410.1|20523_21036_-	F1 capsule protein	NA	NA	NA	NA	NA
WP_002211763.1|21116_23618_-	F1 capsule-anchoring protein	NA	NA	NA	NA	NA
WP_002211762.1|23642_24419_-	chaperone Caf1M	NA	NA	NA	NA	NA
WP_002211761.1|24746_25652_+	F1 operon transcriptional regulator Caf1R	NA	NA	NA	NA	NA
WP_002224363.1|26166_26472_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	3.2e-48
WP_002224361.1|26617_26833_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	7.7e-33
26607:26624	attR	GATGTATGGAATCATTGG	NA	NA	NA	NA
WP_002233024.1|26992_28030_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.4	1.8e-207
WP_001297096.1|28105_28885_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|28884_29907_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211744.1|30030_32040_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_002211745.1|32112_32343_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211746.1|33055_33562_-	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211747.1|33960_34740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|34793_35213_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211748.1|35223_35445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|35444_36122_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211750.1|36622_36823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228775.1|36984_38382_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002215070.1|38760_39732_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002211752.1|39728_40934_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002211753.1|41235_41463_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002215068.1|41462_41789_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211754.1|41988_42609_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215065.1|42674_43616_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211756.1|43638_43914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211757.1|44652_45141_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211758.1|45218_46982_+	phospholipase D	NA	NA	NA	NA	NA
WP_002211760.1|49057_50080_-|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002209743.1|50548_51757_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002224263.1|51790_52513_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_002224265.1|52765_53560_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	3.7e-141
WP_002224267.1|53860_54118_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	94.1	1.3e-34
WP_000255944.1|54519_55542_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|55541_56321_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|56454_57063_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|57364_60253_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|60333_60912_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002214118.1|60968_65600_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211773.1|65621_66209_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|66196_66994_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211775.1|66986_67685_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	7.1e-136
WP_000440566.1|67774_68110_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|68151_72729_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|72736_72961_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|73086_73404_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|73463_74210_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|74284_74668_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|74669_75143_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|75133_75478_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|75575_76409_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|76408_76843_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|76886_77549_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|77623_78499_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002231160.1|78525_79422_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.3	3.9e-147
WP_002211786.1|79444_81019_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	2.4e-301
WP_002211787.1|81052_82309_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|82311_82953_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|83148_83415_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|83424_84315_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|84320_84575_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|84567_85206_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|85202_85871_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|85870_86569_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|86633_88193_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|88195_88474_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|88533_88956_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|88960_89488_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|89811_90462_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|90546_90774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211801.1|91412_91895_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002211802.1|92100_92382_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002213759.1|92581_93040_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002214145.1|93248_93818_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213303.1|93830_94577_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_038918515.1|94566_94926_-	hypothetical protein	NA	J9Q741	Salmonella_phage	100.0	5.2e-58
WP_002213300.1|96712_97798_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
>prophage 1
NZ_CP045261	Yersinia pestis strain SCPM-O-B-5942 (I-2638) plasmid pTP33, complete sequence	33968	7636	33627	33968	holin,integrase,tail,terminase,plate	Haemophilus_phage(40.74%)	34	4156:4170	13870:13884
4156:4170	attL	GCCTTGCGCCACAGT	NA	NA	NA	NA
WP_016257349.1|7636_8197_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	51.4	1.3e-47
WP_071588212.1|8175_8391_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_016257348.1|8523_8751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016257347.1|8747_9371_-	ParA family protein	NA	A0A0K1Y6H3	Rhodobacter_phage	36.6	1.7e-27
WP_016257346.1|9990_10293_+|holin	holin	holin	S4TP56	Salmonella_phage	57.3	3.0e-19
WP_025476582.1|10294_10720_+	lysozyme	NA	A0A2I7S753	Vibrio_phage	61.8	2.2e-39
WP_016257344.1|10716_11238_+	DUF2514 domain-containing protein	NA	A0A0M4S5V1	Salmonella_phage	36.5	1.7e-17
WP_016257343.1|11291_12293_+|integrase	site-specific integrase	integrase	Q38045	Staphylococcus_phage	26.3	2.2e-05
WP_016257342.1|12471_13167_+	hypothetical protein	NA	A3E2J6	Sodalis_phage	38.6	1.0e-30
WP_016257341.1|13147_14374_+|terminase	terminase	terminase	H6WRS9	Salmonella_phage	66.8	1.2e-162
13870:13884	attR	ACTGTGGCGCAAGGC	NA	NA	NA	NA
WP_016257340.1|14496_15099_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	3.8e-21
WP_016257338.1|15336_16695_+	DUF1073 domain-containing protein	NA	Q7Y5U6	Haemophilus_phage	31.4	8.3e-56
WP_016257337.1|16760_17480_+	hypothetical protein	NA	A0A2K9V3J6	Faecalibacterium_phage	36.8	4.6e-21
WP_016257336.1|17505_18669_+	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	28.0	5.1e-22
WP_016257335.1|18671_19169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016257334.1|19174_20113_+	DUF2184 domain-containing protein	NA	NA	NA	NA	NA
WP_016257333.1|20126_20492_+	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	39.5	2.0e-12
WP_016261355.1|20502_21036_+	hypothetical protein	NA	A0A2H4J4S5	uncultured_Caudovirales_phage	40.7	2.6e-21
WP_025476461.1|21022_21280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016257033.1|21428_21827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016678638.1|21823_23338_+	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	42.3	2.6e-98
WP_016257034.1|23348_23774_+	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	45.7	4.3e-27
WP_016257035.1|23777_24173_+	hypothetical protein	NA	Q776V6	Haemophilus_phage	35.7	1.5e-10
WP_016261354.1|24326_26207_+	hypothetical protein	NA	A0A2I7QS75	Vibrio_phage	31.5	1.3e-06
WP_016257157.1|26203_26971_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	39.9	7.7e-35
WP_016257158.1|26972_27311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016257159.1|27285_28143_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	54.4	1.9e-82
WP_016257160.1|28114_28798_+	hypothetical protein	NA	Q7Y5S7	Haemophilus_phage	59.2	5.8e-42
WP_016257161.1|28794_29157_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	48.2	8.4e-24
WP_016257162.1|29140_30268_+|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	39.9	1.9e-69
WP_016257163.1|30260_30926_+	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	42.8	2.0e-34
WP_016257164.1|30903_32109_+	hypothetical protein	NA	Q7Y5S2	Haemophilus_phage	48.3	1.8e-30
WP_016257165.1|32120_32534_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	46.3	1.3e-25
WP_016257166.1|32508_33627_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.5	1.6e-33
