The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045205	Citrobacter sp. NMI7904_11 chromosome, complete genome	5445431	689592	747613	5445431	portal,tail,capsid,plate,terminase,protease,holin,integrase	Salmonella_phage(78.05%)	67	689549:689567	726418:726436
689549:689567	attL	TGTAGGCCGGATAAGGCGT	NA	NA	NA	NA
WP_046493226.1|689592_690966_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	24.0	6.5e-16
WP_152401156.1|690962_691661_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_152406230.1|691811_692312_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_152401158.1|692488_693469_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	97.9	6.8e-185
WP_000229411.1|693538_693859_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	98.1	1.3e-52
WP_021312625.1|693959_694241_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	97.8	2.0e-49
WP_032259814.1|694251_694455_+	hypothetical protein	NA	A0A0M3ULI0	Salmonella_phage	97.0	7.5e-30
WP_032259815.1|694465_694672_+	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	98.5	2.1e-32
WP_152401159.1|694661_694892_+	hypothetical protein	NA	A0A0M4S6M9	Salmonella_phage	94.7	9.4e-37
WP_044597450.1|694977_695190_+	hypothetical protein	NA	A0A0M4R514	Salmonella_phage	67.1	7.3e-20
WP_152401160.1|695191_696166_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	81.7	1.1e-137
WP_032191486.1|696165_696345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152401162.1|696341_698699_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	86.4	0.0e+00
WP_152406231.1|698801_699260_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1X9I6C0	Streptococcus_phage	34.5	8.5e-13
WP_152401164.1|699281_700295_-	DNA-binding protein	NA	A0A0S2SXZ1	Bacillus_phage	28.0	2.3e-10
WP_152401166.1|700763_701810_-|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	76.1	1.6e-155
WP_152401168.1|701812_703528_-	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	74.5	4.9e-239
WP_001514724.1|703674_704514_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	61.7	7.5e-92
WP_001514725.1|704553_705600_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	90.8	6.1e-184
WP_152401170.1|705644_706490_+|terminase	terminase	terminase	A0A0M4R523	Salmonella_phage	64.4	3.1e-77
WP_152401172.1|706589_707078_+|capsid	capsid assembly protein	capsid	A0A0M4QWR7	Salmonella_phage	88.8	4.7e-78
WP_001514728.1|707077_707281_+	hypothetical protein	NA	A0A0M4RTN6	Salmonella_phage	73.1	9.8e-22
WP_152401173.1|707321_707711_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	36.4	9.7e-10
WP_152401175.1|707694_708015_+|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	43.2	2.0e-08
WP_152401177.1|708004_708397_+	M15 family peptidase	NA	A0A060DAL8	Salmonella_phage	85.2	1.2e-60
WP_001514731.1|708393_708930_+	DUF2514 family protein	NA	A0A0M4S5V1	Salmonella_phage	72.5	4.8e-07
WP_134350817.1|708932_709400_+|tail	phage tail protein	tail	A0A0M4R2U5	Salmonella_phage	77.6	1.1e-63
WP_001514733.1|709400_710033_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	79.6	1.8e-90
WP_152401180.1|710213_710849_+|plate	phage baseplate assembly protein V	plate	A0A0M3ULA5	Salmonella_phage	61.9	8.8e-69
WP_001514735.1|710845_711211_+	hypothetical protein	NA	A0A0M4S6L5	Salmonella_phage	68.9	2.9e-40
WP_060568740.1|711207_712119_+|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	85.1	2.8e-140
WP_152401182.1|712111_712729_+|tail	phage tail protein I	tail	A0A1J0I2I4	Salmonella_phage	85.7	3.1e-95
WP_152401184.1|712718_713726_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	66.3	7.8e-120
WP_152401186.1|713725_714319_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	66.0	4.7e-72
WP_152401188.1|714478_715507_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_063922329.1|715632_716082_-|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	77.7	7.9e-64
WP_152401190.1|716093_719024_-|tail	phage tail tape measure protein	tail	A0A0M4R2V3	Salmonella_phage	67.4	1.1e-241
WP_015698216.1|719024_719141_-|tail	GpE family phage tail protein	tail	A0A0M3ULA8	Salmonella_phage	91.9	6.2e-13
WP_001514743.1|719149_719488_-|tail	phage tail assembly protein	tail	A0A0M4RCV2	Salmonella_phage	80.6	2.1e-40
WP_001514744.1|719502_720018_-|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	90.1	7.6e-87
WP_152401192.1|720030_721227_-|tail	phage tail protein	tail	A0A0M4S6M1	Salmonella_phage	93.2	1.6e-212
WP_152406232.1|721388_722516_+	phage late control D family protein	NA	A0A0M4REC6	Salmonella_phage	86.5	9.9e-172
WP_087904817.1|722562_722805_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_152401194.1|723088_724222_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_152401196.1|724312_725215_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_152401199.1|725399_726362_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_152401201.1|726565_727555_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
726418:726436	attR	TGTAGGCCGGATAAGGCGT	NA	NA	NA	NA
WP_152401203.1|727658_728414_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_152401205.1|728680_730015_+	MFS transporter	NA	NA	NA	NA	NA
WP_152401207.1|730025_730976_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_152401209.1|730994_732035_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_152401212.1|732097_732820_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_152401214.1|732905_734210_+	citrate transporter	NA	NA	NA	NA	NA
WP_152401216.1|734322_735795_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_046493417.1|735839_736607_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_152401218.1|736836_737439_-	DUF1454 family protein	NA	NA	NA	NA	NA
WP_152401220.1|737539_737959_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_152401222.1|738002_738749_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_152401223.1|738846_739857_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_152401226.1|740017_741526_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_042325574.1|741548_742394_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.4	4.4e-15
WP_152401228.1|742782_743028_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_152401229.1|743232_743976_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_042998924.1|744167_744653_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_152401231.1|744745_745675_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_042325582.1|745741_747073_-	HslU--HslV peptidase ATPase subunit	NA	A0A173GE36	Erwinia_phage	30.3	4.9e-45
WP_046493441.1|747082_747613_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP045205	Citrobacter sp. NMI7904_11 chromosome, complete genome	5445431	1724514	1785617	5445431	portal,tail,head,capsid,plate,transposase,lysis,tRNA,integrase	Salmonella_phage(89.47%)	59	1722884:1722901	1728800:1728817
1722884:1722901	attL	ATTCAGGAGAAACAACAA	NA	NA	NA	NA
WP_152402653.1|1724514_1725543_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S6L016	Salmonella_phage	95.6	5.8e-195
WP_152402655.1|1725544_1726177_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	94.8	1.6e-110
WP_001397669.1|1726296_1726539_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_040233348.1|1726571_1727081_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	99.4	2.8e-89
WP_000956168.1|1727088_1727289_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	100.0	3.2e-33
WP_046092923.1|1727458_1728490_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_001244238.1|1728816_1729050_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	98.7	2.9e-33
1728800:1728817	attR	ATTCAGGAGAAACAACAA	NA	NA	NA	NA
WP_152402656.1|1729049_1729277_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	90.7	2.1e-33
WP_152402658.1|1729273_1730128_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	80.6	2.1e-129
WP_152402660.1|1730121_1732530_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	93.6	0.0e+00
WP_001749759.1|1732549_1732777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063090871.1|1732914_1733103_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	88.7	5.7e-24
WP_152402662.1|1733203_1733536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152402664.1|1733456_1735790_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_152406272.1|1735843_1736851_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	94.8	8.0e-181
WP_152402666.1|1736877_1738644_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	94.0	0.0e+00
WP_152402668.1|1738786_1739620_+|capsid	capsid protein	capsid	E5G6M5	Salmonella_phage	96.0	7.2e-127
WP_152402670.1|1739636_1740701_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.6	1.6e-195
WP_152402672.1|1740704_1741355_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	97.7	1.1e-111
WP_152402674.1|1741448_1741913_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	4.2e-84
WP_000868184.1|1741912_1742116_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1742119_1742335_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_152402676.1|1742315_1742831_+	glycoside hydrolase family protein	NA	E5G6N1	Salmonella_phage	78.2	6.7e-75
WP_152402678.1|1742827_1743256_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	92.9	4.1e-62
WP_152402679.1|1743185_1743389_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	92.5	6.3e-29
WP_152402681.1|1743351_1743783_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	95.8	1.4e-73
WP_152402683.1|1743775_1744243_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.2	2.2e-56
WP_152402686.1|1744375_1745416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152402688.1|1745563_1746142_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	96.4	5.3e-105
WP_152402690.1|1746138_1746498_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	89.9	1.0e-53
WP_152402692.1|1746484_1747393_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	90.1	6.6e-142
WP_152402694.1|1747385_1747991_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	92.0	1.6e-107
WP_152402696.1|1749146_1749560_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	36.6	6.9e-14
WP_152402698.1|1749747_1750773_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_152402700.1|1751181_1752354_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	92.8	3.6e-209
WP_094464801.1|1752363_1752879_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	97.7	3.3e-90
WP_060773291.1|1752933_1753236_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	96.0	2.3e-43
WP_000763315.1|1753250_1753370_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_152402702.1|1753362_1756155_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	72.0	5.6e-293
WP_125369893.1|1756151_1756637_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	91.9	3.6e-70
WP_152402704.1|1756633_1757734_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	89.6	3.4e-185
WP_152406273.1|1757802_1758021_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	90.3	3.2e-34
WP_152402707.1|1758562_1759753_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_152402709.1|1759733_1761920_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.0e-18
WP_152402711.1|1761916_1763323_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_152402714.1|1763407_1774147_-	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_046498167.1|1774768_1775251_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_152402716.1|1775381_1775858_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_152402718.1|1775847_1776138_+	RnfH family protein	NA	NA	NA	NA	NA
WP_152402720.1|1776192_1776537_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_152402722.1|1776686_1778348_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_042325929.1|1778433_1779312_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_152402725.1|1779434_1780028_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_152402727.1|1780109_1781396_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_152402729.1|1781415_1782207_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_046485408.1|1782372_1783734_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_042325918.1|1783989_1784238_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_046485398.1|1784256_1784805_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_046485395.1|1784849_1785617_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP045205	Citrobacter sp. NMI7904_11 chromosome, complete genome	5445431	1823639	1863023	5445431	holin,terminase	Escherichia_phage(38.89%)	49	NA	NA
WP_152402791.1|1823639_1824869_+	DUF4102 domain-containing protein	NA	H6WRW7	Salmonella_phage	95.6	1.3e-236
WP_061069717.1|1824846_1825131_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	78.7	5.6e-39
WP_152402793.1|1825177_1825417_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	77.9	1.3e-28
WP_061069718.1|1825458_1826541_-	recombinase RecT	NA	K7PKR8	Enterobacteria_phage	51.2	6.9e-98
WP_152406275.1|1826551_1829560_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	62.5	0.0e+00
WP_152402795.1|1829687_1829975_-	DNA breaking-rejoining protein	NA	H6WRX2	Salmonella_phage	82.1	4.3e-39
WP_000711201.1|1830060_1830219_-	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	100.0	1.4e-23
WP_130098287.1|1830218_1830413_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_152402797.1|1830875_1831286_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152402799.1|1831401_1831635_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	40.0	3.9e-14
WP_152406276.1|1831685_1832180_+	regulator	NA	K7PJT7	Enterobacteria_phage	58.1	5.7e-39
WP_152402801.1|1832556_1833555_+	replication protein	NA	A5VW95	Enterobacteria_phage	72.9	2.8e-53
WP_152402802.1|1833551_1834247_+	phage replication protein	NA	G8C7U6	Escherichia_phage	46.5	3.8e-57
WP_152402805.1|1834258_1834972_+	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	24.8	5.4e-06
WP_152402806.1|1834968_1835196_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	66.1	1.3e-14
WP_152402809.1|1835192_1835372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152402810.1|1835375_1836104_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	31.9	2.5e-11
WP_152402812.1|1836096_1836393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044266840.1|1836621_1836879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152402814.1|1836875_1838855_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.4	5.5e-202
WP_152402816.1|1838998_1839232_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	84.4	6.0e-31
WP_152402818.1|1839340_1839562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061069733.1|1839644_1840247_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	93.0	1.2e-104
WP_152402820.1|1840249_1840837_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	57.7	2.9e-58
WP_152402822.1|1840833_1841517_+	DUF1133 family protein	NA	Q8HA89	Salmonella_phage	43.8	6.4e-41
WP_081097267.1|1842647_1842977_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	94.5	9.3e-54
WP_061069738.1|1842963_1843389_+	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	54.0	2.2e-39
WP_061069739.1|1843453_1844335_+	site-specific DNA-methyltransferase	NA	H2EQJ0	Salmonella_phage	72.0	8.0e-52
WP_061069740.1|1844387_1844669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152406277.1|1844745_1845285_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	72.8	3.5e-58
WP_152402824.1|1845622_1846363_+	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	36.0	1.7e-18
WP_152402826.1|1846364_1847696_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	59.5	5.5e-153
WP_152402829.1|1847707_1849129_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.6	1.4e-90
WP_152402831.1|1849125_1849947_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	41.9	6.3e-51
WP_152402832.1|1849959_1851606_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_152402834.1|1851621_1852482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152402836.1|1852498_1853530_+	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	46.6	2.1e-75
WP_152402838.1|1853598_1854081_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	31.9	4.1e-10
WP_152402840.1|1854077_1854506_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	39.1	1.8e-20
WP_000627557.1|1854502_1854937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016152541.1|1854920_1855862_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.1	5.0e-52
WP_135129217.1|1855866_1857261_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.7	1.8e-66
WP_152402842.1|1857262_1857700_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	38.9	1.6e-24
WP_152402844.1|1857702_1858278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152402846.1|1858401_1860285_+	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	39.7	6.1e-17
WP_152402848.1|1860287_1860998_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.6	1.4e-30
WP_110498443.1|1860994_1861270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152402851.1|1861269_1862310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088760183.1|1862306_1863023_+	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	30.8	7.0e-22
>prophage 4
NZ_CP045205	Citrobacter sp. NMI7904_11 chromosome, complete genome	5445431	2104436	2155198	5445431	tail,plate,terminase,transposase,holin	Escherichia_phage(46.67%)	64	NA	NA
WP_003028200.1|2104436_2107196_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	54.7	1.9e-285
WP_003028198.1|2107312_2107513_-	AlpA family phage regulatory protein	NA	A0A1W6JPE9	Morganella_phage	55.6	1.5e-11
WP_003028196.1|2107621_2108500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003028195.1|2108591_2109869_-	DUF4102 domain-containing protein	NA	A0A2H4J5F8	uncultured_Caudovirales_phage	32.4	4.9e-50
WP_111925777.1|2110143_2110344_-	excisionase	NA	K7P7V0	Enterobacteria_phage	80.3	1.7e-26
WP_152403188.1|2110476_2110707_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	94.7	7.4e-34
WP_152403190.1|2110715_2110955_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	71.8	6.3e-28
WP_152403192.1|2110932_2111691_-	hypothetical protein	NA	R9VWB9	Serratia_phage	58.5	1.2e-72
WP_152403194.1|2111702_2111924_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	65.3	2.9e-19
WP_152403196.1|2112192_2112834_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	91.8	4.2e-111
WP_152403198.1|2113288_2113570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152403200.1|2113609_2114335_-	recombinase	NA	K7PKU3	Enterobacteria_phage	64.5	6.5e-84
WP_152403202.1|2114343_2114526_-	hypothetical protein	NA	I1TEE9	Salmonella_phage	69.4	1.0e-17
WP_152403204.1|2114534_2115506_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	97.6	1.8e-84
WP_064441788.1|2115576_2115780_-	hypothetical protein	NA	K7PM31	Enterobacteria_phage	80.9	9.5e-25
WP_152403206.1|2115754_2115934_-	hypothetical protein	NA	G8C7T3	Escherichia_phage	92.2	1.6e-20
WP_050499242.1|2116574_2117117_-	HNH endonuclease	NA	A0A0N9RV98	Escherichia_phage	44.4	8.2e-31
WP_045330132.1|2117226_2117646_-	hypothetical protein	NA	A0A088FWM4	Lelliottia_phage	39.2	1.0e-20
WP_152403208.1|2118061_2118292_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	87.5	3.5e-23
WP_045265467.1|2118281_2118566_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_045265468.1|2118577_2118874_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_015571542.1|2119154_2119847_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	78.9	4.6e-95
WP_054830129.1|2119952_2120186_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	66.2	2.5e-21
WP_001514165.1|2120216_2120783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152403210.1|2121025_2122402_+	DNA replication protein	NA	E5AGE9	Erwinia_phage	55.4	3.7e-64
WP_152403212.1|2122398_2123772_+	AAA family ATPase	NA	E5AGF0	Erwinia_phage	62.9	5.8e-166
WP_152403214.1|2123761_2124076_+	protein ren	NA	M1FPD5	Enterobacteria_phage	52.6	6.6e-17
WP_109908288.1|2124437_2124719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152403216.1|2124715_2125087_+	ead/Ea22-like family protein	NA	K7PHN2	Enterobacterial_phage	53.7	5.8e-28
WP_090049338.1|2126380_2126818_+	protein ninB	NA	G8C7V3	Escherichia_phage	69.7	1.6e-53
WP_152403218.1|2126814_2126985_+	NinE family protein	NA	G8C7V4	Escherichia_phage	87.5	9.0e-21
WP_152403221.1|2126977_2127589_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	70.6	2.6e-41
WP_152403223.1|2127585_2128269_+	DUF1133 family protein	NA	Q8HA89	Salmonella_phage	43.2	4.2e-40
WP_152406282.1|2128752_2129082_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	95.4	3.2e-54
WP_152403225.1|2129068_2129488_+	structural protein	NA	A0A0E3GMJ2	Enterobacteria_phage	55.4	4.4e-40
WP_152406283.1|2129535_2130033_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	72.2	4.7e-57
WP_152403227.1|2130370_2131111_+	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	35.9	2.2e-18
WP_152403229.1|2131112_2132444_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	60.0	4.2e-153
WP_152403231.1|2132455_2133883_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	38.1	1.9e-90
WP_152403234.1|2133879_2134704_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	42.3	5.2e-53
WP_152403243.1|2134716_2136321_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_152403245.1|2136336_2137197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152403247.1|2137213_2138245_+	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	46.4	3.0e-74
WP_109536370.1|2138313_2138796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109536369.1|2138792_2139221_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	40.6	1.9e-22
WP_152403250.1|2139217_2139655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152403252.1|2139638_2140580_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.3	1.0e-52
WP_152403255.1|2140584_2141979_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.4	2.2e-67
WP_152402842.1|2141980_2142418_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	38.9	1.6e-24
WP_152402844.1|2142420_2142996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152402846.1|2143119_2145003_+	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	39.7	6.1e-17
WP_152403258.1|2145005_2145731_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	38.1	5.2e-33
WP_152403260.1|2145727_2146003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152403262.1|2146002_2147025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152403264.1|2147021_2147738_+	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	29.0	1.2e-21
WP_048976622.1|2147734_2148067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152403266.1|2148063_2149482_+|plate	baseplate J-like family protein	plate	A0A0U2RJZ0	Escherichia_phage	42.2	1.3e-48
WP_152403268.1|2149483_2150188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130098293.1|2150344_2150695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152403270.1|2150759_2151884_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	73.2	4.9e-54
WP_152403272.1|2151883_2152462_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	56.2	3.2e-57
WP_152403274.1|2152487_2153210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152403277.1|2153214_2153484_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_000343760.1|2153977_2155198_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP045205	Citrobacter sp. NMI7904_11 chromosome, complete genome	5445431	2396776	2405189	5445431	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_152403621.1|2396776_2397724_+	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.4	4.9e-07
WP_152403624.1|2397707_2398439_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_042318015.1|2398419_2398527_-	protein YohO	NA	NA	NA	NA	NA
WP_152406291.1|2398586_2399318_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	92.0	1.2e-104
WP_152403626.1|2399540_2401229_+	GAF domain-containing protein	NA	Q9EYF3	Enterobacteria_phage	91.7	7.4e-280
WP_152403628.1|2401221_2401941_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_152403630.1|2401987_2402458_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	75.5	7.7e-62
WP_152403632.1|2402503_2402962_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	67.3	1.3e-50
WP_152403634.1|2403155_2405189_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 6
NZ_CP045205	Citrobacter sp. NMI7904_11 chromosome, complete genome	5445431	2476357	2485336	5445431	transposase	Acanthocystis_turfacea_Chlorella_virus(16.67%)	8	NA	NA
WP_152403736.1|2476357_2477482_+	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	65.0	6.9e-133
WP_152403738.1|2477486_2478452_+	NAD-dependent epimerase/dehydratase family protein	NA	D1LW79	Prochlorococcus_phage	50.8	3.2e-86
WP_152403740.1|2478455_2478917_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_152403742.1|2478922_2480329_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.0	1.3e-48
WP_152403744.1|2480328_2481075_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	40.4	6.0e-08
WP_152403746.1|2481080_2482463_+	phosphomannomutase	NA	NA	NA	NA	NA
WP_089600859.1|2482459_2483607_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	3.5e-148
WP_152403747.1|2483929_2485336_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	1.8e-37
>prophage 7
NZ_CP045205	Citrobacter sp. NMI7904_11 chromosome, complete genome	5445431	3147813	3214235	5445431	transposase	Escherichia_phage(31.25%)	51	NA	NA
WP_046092923.1|3147813_3148845_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_152404658.1|3149528_3150410_-	aromatic amino acid efflux DMT transporter YddG	NA	NA	NA	NA	NA
WP_152404660.1|3150646_3153694_+	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_152404662.1|3153706_3154591_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_152404664.1|3154583_3155240_+	formate dehydrogenase-N subunit gamma	NA	NA	NA	NA	NA
WP_152404666.1|3155369_3155972_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	40.3	1.7e-21
WP_152404669.1|3156018_3156303_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	48.9	7.5e-20
WP_152406330.1|3156302_3156581_-	Killer protein	NA	A0A2L1IV28	Escherichia_phage	60.9	7.4e-28
WP_152404671.1|3156760_3158476_-	ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.8	2.6e-38
WP_152404673.1|3158784_3160482_-	oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_061077521.1|3160653_3160797_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_152404675.1|3161024_3161456_+	peroxiredoxin OsmC	NA	NA	NA	NA	NA
WP_152404677.1|3161537_3162464_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	27.9	6.5e-12
WP_152406331.1|3162456_3163443_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.1	4.6e-16
WP_152404679.1|3163442_3164336_-	D,D-dipeptide ABC transporter permease	NA	NA	NA	NA	NA
WP_152404681.1|3164332_3165355_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_152404683.1|3165399_3166950_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_152404685.1|3166965_3167553_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
WP_152404687.1|3167567_3168434_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152404689.1|3168836_3169166_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_152404692.1|3169323_3171255_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.5	5.2e-11
WP_152404694.1|3171366_3173772_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_152404696.1|3173798_3175181_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.4	3.8e-16
WP_152404698.1|3175747_3176860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152404700.1|3177064_3177352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152404702.1|3177403_3182689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152404704.1|3182696_3187964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152404706.1|3188009_3189338_-	family 10 glycosylhydrolase	NA	NA	NA	NA	NA
WP_089600859.1|3189393_3190541_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	3.5e-148
WP_000833382.1|3190653_3192081_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|3192295_3192811_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|3192813_3193710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|3193931_3194165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001046767.1|3194210_3194465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136338.1|3194502_3194790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|3194826_3195057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152404708.1|3195351_3198564_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	45.6	8.4e-91
WP_089600859.1|3199311_3200458_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	3.5e-148
WP_000019951.1|3200911_3201184_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001572377.1|3201306_3202422_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000723070.1|3202679_3203114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572376.1|3203331_3204678_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.3e-18
WP_001572374.1|3204761_3205685_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	2.4e-176
WP_001572373.1|3205873_3207493_+	phosphoethanolamine--lipid A transferase MCR-9.1	NA	NA	NA	NA	NA
WP_001572372.1|3207569_3208046_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_001572371.1|3208258_3209608_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_001572368.1|3209583_3210252_-	response regulator	NA	NA	NA	NA	NA
WP_077909719.1|3210445_3211471_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_129541466.1|3212232_3212418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572363.1|3212363_3213068_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_152404710.1|3213221_3214235_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP045205	Citrobacter sp. NMI7904_11 chromosome, complete genome	5445431	3518129	3567738	5445431	tail,coat,terminase,transposase,tRNA,holin	Salmonella_phage(31.58%)	54	NA	NA
WP_152404984.1|3518129_3519236_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_042320078.1|3519272_3519914_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_152404985.1|3519917_3521288_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.5	1.1e-108
WP_152404986.1|3521803_3522739_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.8	6.9e-70
WP_152404987.1|3522926_3523115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004132711.1|3523629_3523863_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	56.6	1.1e-16
WP_152404988.1|3523882_3532462_-	cyclic beta 1-2 glucan synthetase	NA	NA	NA	NA	NA
WP_152404989.1|3532863_3533076_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_141227557.1|3533541_3533781_+	DinI family protein	NA	K7P6H1	Enterobacteria_phage	88.6	4.2e-32
WP_152406343.1|3534058_3535567_-	hypothetical protein	NA	A0A0A7RZ88	Escherichia_virus	46.9	1.5e-111
WP_152404990.1|3536437_3537400_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	65.0	1.4e-118
WP_152404991.1|3537407_3540119_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	84.4	0.0e+00
WP_152404992.1|3540118_3540517_-	hypothetical protein	NA	S4TR39	Salmonella_phage	81.1	4.7e-60
WP_152404993.1|3540523_3541108_-	hypothetical protein	NA	S4TND4	Salmonella_phage	87.1	6.0e-96
WP_044268228.1|3541107_3541701_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	58.8	1.8e-60
WP_152404994.1|3541704_3544608_-|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.2	4.3e-110
WP_152404995.1|3544778_3545288_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	46.1	2.4e-32
WP_152404996.1|3545486_3545819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044268218.1|3545909_3546158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152404997.1|3546758_3547934_-	Ig domain-containing protein	NA	A0A059VG08	Pseudomonas_phage	40.8	3.4e-58
WP_061077246.1|3547958_3548351_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_152404998.1|3548347_3548728_-	HK97 gp10 family phage protein	NA	A0A059VF88	Pseudomonas_phage	50.8	1.4e-29
WP_152404999.1|3548729_3549113_-	glutamate 5-kinase	NA	A0A059VA70	Pseudomonas_phage	48.8	2.6e-23
WP_152405000.1|3549114_3549525_-	protein singed	NA	NA	NA	NA	NA
WP_152405001.1|3549528_3549828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152405002.1|3549866_3551003_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	76.2	3.7e-158
WP_152405003.1|3551090_3551855_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	69.3	1.8e-92
WP_152405004.1|3551959_3553072_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	56.3	3.1e-117
WP_152405005.1|3553058_3554462_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	73.7	1.2e-195
WP_152405006.1|3554465_3556037_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	91.8	6.8e-304
WP_152405007.1|3556033_3556606_-|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	81.1	1.5e-67
WP_152405008.1|3556629_3557088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152405009.1|3557355_3557874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152405010.1|3558095_3558344_-	Fur-regulated protein	NA	Q38201	Enterobacteria_phage	88.2	1.2e-32
WP_152405011.1|3558342_3558939_+	hypothetical protein	NA	M9NZJ1	Enterobacteria_phage	95.5	5.5e-105
WP_152405012.1|3559059_3559515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152406344.1|3559601_3559796_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	77.6	5.9e-16
WP_152405013.1|3559752_3560022_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	66.7	3.2e-20
WP_044266508.1|3560028_3560643_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	80.4	1.2e-91
WP_152405014.1|3560799_3561081_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	77.2	1.8e-34
WP_152405015.1|3561067_3561463_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	93.1	2.1e-60
WP_152406345.1|3561652_3562087_-|transposase	IS200/IS605 family transposase	transposase	Q331U4	Clostridium_botulinum_C_phage	40.0	6.8e-20
WP_152405016.1|3562255_3562630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152405017.1|3562713_3563049_-	hypothetical protein	NA	H6WRZ2	Salmonella_phage	82.5	6.4e-10
WP_152405018.1|3563090_3563630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152405019.1|3563725_3564523_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	78.5	6.2e-120
WP_152405020.1|3564512_3564659_-	YlcG family protein	NA	H6WRZ0	Salmonella_phage	89.6	1.8e-17
WP_152405021.1|3564655_3565012_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	87.3	1.8e-58
WP_152405022.1|3565008_3565299_-	DUF1364 family protein	NA	K7PGZ6	Enterobacteria_phage	90.6	4.1e-45
WP_152405023.1|3565301_3565502_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	72.7	1.0e-23
WP_152405024.1|3565507_3565975_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	71.0	5.3e-71
WP_152405025.1|3566009_3566258_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	97.6	4.0e-41
WP_152405026.1|3567184_3567487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152405027.1|3567483_3567738_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	77.5	1.3e-26
>prophage 9
NZ_CP045205	Citrobacter sp. NMI7904_11 chromosome, complete genome	5445431	3570929	3585101	5445431		Escherichia_phage(37.5%)	19	NA	NA
WP_152406347.1|3570929_3571319_-	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	77.9	3.4e-47
WP_152405029.1|3571796_3572105_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.3	2.5e-32
WP_152405030.1|3572101_3572836_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	27.7	5.2e-12
WP_152405031.1|3572847_3573543_-	phage replication protein	NA	G8C7U6	Escherichia_phage	45.7	1.0e-57
WP_152405032.1|3573539_3574538_-	replication protein	NA	A5VW95	Enterobacteria_phage	71.5	5.3e-52
WP_152405033.1|3574654_3574909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152405034.1|3575464_3575698_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	80.5	1.1e-29
WP_152405035.1|3575801_3576188_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	87.3	7.5e-55
WP_152405036.1|3576293_3577235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152405037.1|3577262_3577469_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	57.4	2.5e-12
WP_152405038.1|3577743_3578121_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	58.6	1.2e-25
WP_152405039.1|3578299_3578494_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_152405040.1|3578493_3578652_+	hypothetical protein	NA	K7P7H7	Enterobacteria_phage	98.1	2.4e-23
WP_152405041.1|3578737_3579025_+	DNA breaking-rejoining protein	NA	H6WRX2	Salmonella_phage	77.9	1.2e-36
WP_152406348.1|3579152_3582161_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	60.5	1.1e-305
WP_152405042.1|3582171_3583254_+	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	52.0	1.7e-99
WP_042997814.1|3583295_3583535_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	79.2	4.4e-29
WP_044266475.1|3583599_3583815_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	56.3	2.8e-19
WP_152405043.1|3583814_3585101_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	49.1	6.7e-108
>prophage 10
NZ_CP045205	Citrobacter sp. NMI7904_11 chromosome, complete genome	5445431	4100602	4135142	5445431	head,transposase,tail,plate	Vibrio_phage(67.65%)	45	NA	NA
WP_152405425.1|4100602_4101868_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	49.3	1.5e-96
WP_104446361.1|4103344_4103761_+|tail	phage tail protein	tail	A0A218M4J2	Erwinia_phage	50.0	8.5e-12
WP_104446362.1|4103732_4104158_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	38.0	4.0e-17
WP_104446360.1|4104806_4105397_-	DUF2313 domain-containing protein	NA	M1NVS6	Vibrio_phage	51.3	1.6e-51
WP_152405426.1|4105381_4106458_-|plate	phage baseplate protein	plate	A0A2I7S9E5	Vibrio_phage	53.2	6.7e-101
WP_104446358.1|4106447_4106900_-	hypothetical protein	NA	M1PPW1	Vibrio_phage	42.8	4.0e-23
WP_104446357.1|4106896_4107439_-|plate	phage baseplate assembly protein V	plate	M1Q572	Vibrio_phage	40.4	4.9e-28
WP_104446356.1|4107429_4108521_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	45.9	7.8e-89
WP_104446355.1|4108520_4109852_-	multidrug DMT transporter	NA	A0A2I7S9E8	Vibrio_phage	36.8	7.0e-76
WP_104446354.1|4109851_4111771_-|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	34.6	3.4e-55
WP_058587157.1|4111857_4112253_-	hypothetical protein	NA	M1NVT1	Vibrio_phage	42.9	3.1e-19
WP_058587158.1|4112256_4112613_-|tail	phage tail protein	tail	A0A2I7S9D5	Vibrio_phage	43.8	5.9e-22
WP_152406372.1|4112622_4114101_-|tail	phage tail protein	tail	M1Q565	Vibrio_phage	54.6	2.1e-153
WP_058587160.1|4114100_4114289_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_152405427.1|4114281_4114893_-	hypothetical protein	NA	M4MHF0	Vibrio_phage	43.9	2.1e-35
WP_058587162.1|4114889_4115432_-	phage morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	60.3	3.6e-55
WP_094465504.1|4115431_4115872_-	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	49.3	1.7e-34
WP_152405428.1|4115871_4116474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058587165.1|4116557_4117451_-|head	phage head protein	head	M4MB71	Vibrio_phage	55.4	6.6e-94
WP_152405429.1|4117454_4118411_-	peptidase	NA	M1Q578	Vibrio_phage	50.8	3.4e-80
WP_058587167.1|4118614_4119409_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	57.9	1.3e-90
WP_152405430.1|4119401_4120970_-	DUF935 family protein	NA	A0A2I7S9K0	Vibrio_phage	54.8	8.1e-156
WP_104446343.1|4120969_4122553_-	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.9	7.8e-199
WP_058587170.1|4122549_4123128_-	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	50.8	3.5e-40
WP_104446341.1|4123117_4123390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152405431.1|4123379_4123757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058587173.1|4123759_4124047_-	hypothetical protein	NA	M1PPT9	Vibrio_phage	64.5	1.1e-26
WP_058587174.1|4124058_4124364_-	DUF2730 family protein	NA	M1Q558	Vibrio_phage	36.2	1.3e-12
WP_058587175.1|4124364_4124571_-	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_058587176.1|4124567_4125176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104446339.1|4125163_4125571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058587178.1|4125563_4125782_-	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	72.2	3.2e-26
WP_104446338.1|4125783_4126374_-	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	45.1	7.0e-36
WP_104446337.1|4126484_4126994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104446336.1|4126997_4127408_-	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	63.5	1.8e-38
WP_104446335.1|4127404_4127932_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	48.1	3.8e-41
WP_152405432.1|4127928_4128144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058587185.1|4128845_4129373_-	host-nuclease inhibitor protein Gam	NA	C9DGL8	Escherichia_phage	56.7	3.7e-44
WP_104446333.1|4129380_4129632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058587187.1|4129634_4129874_-	hypothetical protein	NA	A0A0C4UQY4	Shigella_phage	55.4	2.8e-15
WP_104446332.1|4129878_4130817_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.7	1.3e-76
WP_104446331.1|4130895_4132881_-|transposase	transposase	transposase	C9DGL1	Escherichia_phage	51.7	6.0e-188
WP_104446330.1|4132881_4133118_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.7	1.9e-13
WP_104446329.1|4133344_4133797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094465098.1|4134335_4135142_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	43.5	2.9e-48
>prophage 11
NZ_CP045205	Citrobacter sp. NMI7904_11 chromosome, complete genome	5445431	4993062	5000945	5445431		uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_042999135.1|4993062_4993833_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	38.0	2.1e-24
WP_072134376.1|4994016_4994370_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	47.2	6.9e-23
WP_046494310.1|4994416_4994779_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_042999132.1|4994796_4996548_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_042999131.1|4996595_4997885_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.3e-172
WP_042999130.1|4997897_4998326_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_000968905.1|4998400_4998898_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	38.3	2.4e-21
WP_042999129.1|4998926_5000150_-	MFS transporter	NA	NA	NA	NA	NA
WP_042999128.1|5000429_5000945_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	34.8	2.4e-16
>prophage 12
NZ_CP045205	Citrobacter sp. NMI7904_11 chromosome, complete genome	5445431	5167553	5231239	5445431	transposase,integrase,tRNA	Escherichia_phage(14.29%)	58	5173825:5173850	5231285:5231310
WP_042324318.1|5167553_5168567_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	2.6e-107
WP_001144069.1|5168794_5169010_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_152406073.1|5169251_5170997_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.8	2.4e-76
WP_046495899.1|5171168_5173016_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_152406074.1|5173061_5173568_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
5173825:5173850	attL	TTTGGGTCAGGTAATGGGTCAGGTAA	NA	NA	NA	NA
WP_032669204.1|5173871_5174720_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_032669203.1|5174783_5174987_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_032672023.1|5175016_5175508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032669201.1|5175504_5175882_-	toxin CbtA	NA	NA	NA	NA	NA
WP_023567998.1|5175932_5176292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023567997.1|5176315_5176537_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_032669200.1|5176557_5177037_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_032669199.1|5177048_5177492_-	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	35.6	5.9e-11
WP_032669198.1|5177522_5178344_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.9	2.6e-44
WP_032669197.1|5178745_5179195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000754598.1|5179191_5179647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020837117.1|5179685_5180321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032669194.1|5180317_5181031_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_071946041.1|5181072_5181261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032669193.1|5181291_5182167_-	GTPase family protein	NA	NA	NA	NA	NA
WP_044067157.1|5182446_5182830_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	37.7	5.4e-13
WP_152406401.1|5184624_5187387_+	lactate dehydrogenase	NA	Q6NE04	Leptospira_phage	32.2	9.7e-120
WP_032669192.1|5187401_5189447_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_032669191.1|5189439_5190618_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_001310555.1|5190899_5191916_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_024196074.1|5191914_5192244_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_032669189.1|5192295_5193099_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.6	4.8e-11
WP_002917661.1|5193152_5194976_-	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_002917670.1|5194988_5195414_-	glycerol dehydratase small subunit DhaB3	NA	NA	NA	NA	NA
WP_002917672.1|5195416_5196001_-	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
WP_002917676.1|5196013_5197681_-	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
WP_014599267.1|5198094_5198523_+	heme-binding protein	NA	NA	NA	NA	NA
WP_004150927.1|5198544_5199708_+	1,3-propanediol dehydrogenase	NA	NA	NA	NA	NA
WP_002917678.1|5199728_5200082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004210508.1|5200082_5200613_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_020317099.1|5200590_5202516_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_032669188.1|5202617_5203715_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_007372184.1|5203773_5203998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032669186.1|5206194_5206878_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	2.4e-27
WP_032669185.1|5206888_5208577_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_032669183.1|5208560_5209598_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_032669182.1|5210694_5211675_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.5e-184
WP_152406075.1|5211732_5211942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020077889.1|5212038_5213109_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_007372179.1|5213119_5213752_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_032669181.1|5213762_5215181_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_032669180.1|5215255_5216905_+	glycerone kinase	NA	NA	NA	NA	NA
WP_032669179.1|5218506_5219796_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.2	1.0e-84
WP_003821921.1|5219817_5220330_-	signal peptidase II	NA	NA	NA	NA	NA
WP_152406076.1|5220333_5221230_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_004364961.1|5221325_5221733_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_032669175.1|5222062_5224636_+	type III restriction enzyme, res subunit	NA	NA	NA	NA	NA
WP_032669173.1|5224726_5225353_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_032669172.1|5225653_5227069_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_044066940.1|5227197_5227434_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_032669170.1|5227526_5228537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947598.1|5228757_5229919_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_114499438.1|5229916_5231239_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	29.6	6.0e-35
5231285:5231310	attR	TTTGGGTCAGGTAATGGGTCAGGTAA	NA	NA	NA	NA
>prophage 1
NZ_CP045204	Citrobacter sp. NMI7904_11 plasmid pCTEL-1, complete sequence	113742	64125	70889	113742		Escherichia_phage(50.0%)	6	NA	NA
WP_048242139.1|64125_64833_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	33.6	3.2e-27
WP_048242137.1|65546_66752_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	71.9	1.3e-169
WP_152400167.1|66748_67720_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	51.6	1.4e-78
WP_048242133.1|67865_69140_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	62.8	2.7e-157
WP_048242131.1|69139_69568_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.0	6.0e-29
WP_048242129.1|69917_70889_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.5	2.8e-74
>prophage 1
NZ_CP045203	Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence	235057	145614	181021	235057	transposase	Enterobacteria_phage(40.0%)	41	NA	NA
WP_048213832.1|145614_146787_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	94.6	1.3e-219
WP_048213831.1|146786_147584_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	94.7	1.5e-137
WP_007372341.1|147936_148164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372342.1|148344_149268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372343.1|149303_149627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372345.1|149909_150128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152400069.1|150388_150640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089120.1|150694_151093_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003089115.1|151167_151518_+	mercury transporter MerT	NA	NA	NA	NA	NA
WP_003150552.1|151530_151806_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003089113.1|151813_152026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003299771.1|152038_155032_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.6	5.7e-259
WP_003089107.1|155445_155685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100226694.1|155937_156417_+	TraA	NA	NA	NA	NA	NA
WP_006473465.1|156428_157187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008786762.1|157206_157773_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152400071.1|157783_159295_-	MFS transporter	NA	NA	NA	NA	NA
WP_003159187.1|159632_160169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003159186.1|160180_160576_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_019334760.1|160572_160824_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003159185.1|161005_161572_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	54.3	7.9e-45
WP_003150544.1|161701_162631_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.9	1.9e-40
WP_007372347.1|163258_164872_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	37.0	2.2e-07
WP_024196077.1|164987_165287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032951190.1|165701_165908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372348.1|166008_166260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241538.1|166296_166794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098991.1|167298_169365_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_115465285.1|169361_170753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067845.1|170997_171702_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_152400073.1|171713_172601_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152400075.1|172691_173030_+	thioredoxin	NA	NA	NA	NA	NA
WP_152400077.1|173119_173689_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_110236767.1|173699_174035_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_110236765.1|174713_175469_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_102778660.1|175482_175680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102778661.1|175821_176082_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_012291449.1|176954_178193_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	23.4	1.9e-11
WP_152400079.1|178527_179817_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.2	2.3e-84
WP_152400081.1|179838_180258_-	signal peptidase II	NA	NA	NA	NA	NA
WP_001067845.1|180316_181021_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
