The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045277	Escherichia coli strain LAU-OXA chromosome, complete genome	4812180	47917	58481	4812180	transposase	Enterobacteria_phage(87.5%)	11	NA	NA
WP_069905111.1|47917_50251_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
WP_000856729.1|50265_50586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000459298.1|50721_51177_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244664.1|51169_51457_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	98.9	5.1e-48
WP_032196530.1|51449_52004_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.2	4.0e-41
WP_001149160.1|52000_52267_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_032286762.1|52819_53554_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.0	1.5e-128
WP_000638635.1|53550_54051_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446136.1|54124_54697_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_021570265.1|54958_56722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|57319_58481_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 2
NZ_CP045277	Escherichia coli strain LAU-OXA chromosome, complete genome	4812180	1065582	1078765	4812180		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1065582_1066344_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1066337_1066964_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1067103_1068243_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1068305_1069298_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104459.1|1069391_1070756_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136925.1|1070844_1071621_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1071625_1072264_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1072260_1073523_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847979.1|1073519_1074428_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	3.0e-118
WP_001300386.1|1074623_1075391_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1075441_1076098_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272928.1|1076203_1078765_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 3
NZ_CP045277	Escherichia coli strain LAU-OXA chromosome, complete genome	4812180	1849749	1931999	4812180	integrase,transposase	Bacillus_phage(23.08%)	55	1873009:1873068	1917138:1917238
WP_001775131.1|1849749_1851351_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.6	2.8e-260
WP_001331140.1|1851551_1851767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813432.1|1852239_1852842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001313064.1|1852935_1853214_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000266732.1|1853248_1853551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071527823.1|1853518_1853842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297900.1|1854268_1854469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221530.1|1854667_1855237_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270980.1|1855496_1855898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221617.1|1855885_1856296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000656347.1|1858610_1859645_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_001066368.1|1860669_1861428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000667430.1|1861441_1862656_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001741392.1|1863808_1864942_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001327366.1|1865169_1865367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152406409.1|1865869_1867082_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
WP_000973176.1|1868242_1868788_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001518002.1|1868784_1869528_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193786.1|1869539_1870619_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001352368.1|1871346_1872555_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
1873009:1873068	attL	TTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACC	NA	NA	NA	NA
WP_001011447.1|1873411_1874329_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011039.1|1874430_1875381_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122985555.1|1875498_1877142_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|1877773_1878490_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060231.1|1878832_1880287_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378563.1|1880388_1881705_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480506.1|1882019_1883072_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001311901.1|1885192_1885363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323489.1|1885289_1886000_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000784549.1|1886691_1888713_-	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_001088826.1|1888843_1890421_-	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_000194282.1|1890424_1891228_-	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_000982860.1|1891224_1892325_-	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_001518000.1|1892321_1901813_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_001517999.1|1901900_1908008_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	4.0e-33
WP_000140405.1|1908198_1909158_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_000098386.1|1909324_1911127_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	28.0	2.0e-33
WP_000654453.1|1911113_1912916_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	7.9e-22
WP_001286292.1|1912908_1914189_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000703041.1|1914216_1915521_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_000480163.1|1915714_1916977_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.2e-72
WP_001323493.1|1917314_1918112_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1917138:1917238	attR	TTGGCTCCTCTGACTGGACTCGAACCAGTGACATACGGATTAACAGTCCGCCGTTCTACCGACTGAACTACAGAGGAATCGTGTGAACGGGGCGCATATTA	NA	NA	NA	NA
WP_001007767.1|1918964_1919615_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240090.1|1919871_1920507_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740111.1|1920507_1921512_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920132.1|1921620_1922034_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001340597.1|1922166_1922838_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
WP_000826783.1|1922837_1924196_+	heavy metal sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	19.4	5.1e-05
WP_001157257.1|1926304_1927723_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.5	1.1e-100
WP_000228683.1|1927703_1928174_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	49.0	1.8e-34
WP_001212236.1|1928162_1929083_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|1929255_1930173_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|1930251_1930434_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_071525573.1|1930516_1930711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343717.1|1930790_1931999_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
>prophage 4
NZ_CP045277	Escherichia coli strain LAU-OXA chromosome, complete genome	4812180	2287979	2332574	4812180	tail,protease,transposase,integrase,lysis	Escherichia_phage(25.0%)	59	2282330:2282345	2312367:2312382
2282330:2282345	attL	TTCATAAAAATAATCC	NA	NA	NA	NA
WP_001260865.1|2287979_2288801_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2288900_2288984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|2289076_2289412_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2289808_2291062_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2291168_2292062_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2292196_2293417_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2293541_2294237_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2294189_2295482_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2295640_2296255_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|2296297_2297152_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2297153_2297771_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_077888671.1|2297781_2300205_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	6.3e-208
WP_000041675.1|2300265_2302692_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001300836.1|2302890_2303196_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2303303_2304014_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2304016_2304577_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2304611_2304953_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2305087_2305414_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2305619_2306834_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|2306845_2307865_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_072276620.1|2307922_2308033_+	transporter	NA	NA	NA	NA	NA
WP_000876958.1|2308052_2309333_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001296941.1|2309367_2309604_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_024248766.1|2309691_2311725_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	7.0e-59
WP_001310834.1|2311911_2312268_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_000786209.1|2313420_2313600_+	hypothetical protein	NA	NA	NA	NA	NA
2312367:2312382	attR	GGATTATTTTTATGAA	NA	NA	NA	NA
WP_000955178.1|2313574_2313757_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_069905218.1|2313934_2315248_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000343717.1|2315697_2316906_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
WP_069905221.1|2317004_2317337_-	protein flxA	NA	NA	NA	NA	NA
WP_001326990.1|2317539_2317845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|2317869_2318109_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|2318108_2318396_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|2318467_2318623_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980994.1|2318839_2319091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|2319157_2319436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|2319437_2320487_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|2320500_2321253_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2321530_2321620_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2321674_2321887_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2322187_2322403_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2323156_2323372_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189916.1|2323376_2323688_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_001092971.1|2323684_2324218_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2324214_2324712_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|2325074_2325287_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2325297_2325486_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2325488_2325554_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|2325633_2325789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2325960_2326134_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2326285_2326696_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001368374.1|2326753_2326987_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453589.1|2327375_2327921_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.2	9.5e-88
WP_071524888.1|2328171_2328480_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000885600.1|2328479_2329055_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	1.8e-105
WP_000343717.1|2329177_2330386_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
WP_000086522.1|2330474_2331065_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_032293154.1|2331381_2331513_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	81.4	7.0e-13
WP_120795384.1|2332460_2332574_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
>prophage 5
NZ_CP045277	Escherichia coli strain LAU-OXA chromosome, complete genome	4812180	2500494	2596890	4812180	tail,terminase,holin,transposase,tRNA,integrase,lysis	Escherichia_phage(50.0%)	90	2495987:2496003	2596023:2596039
2495987:2496003	attL	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
WP_000343717.1|2500494_2501703_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	3.7e-47
WP_010723099.1|2507946_2508012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123464.1|2508115_2508706_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|2508687_2509638_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632280.1|2509738_2511052_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|2511078_2512284_-	3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2512283_2512706_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973360.1|2512695_2514123_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969784.1|2514124_2514913_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2514912_2515680_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|2515676_2516747_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|2516754_2517252_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|2517266_2518013_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2518021_2518309_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|2518320_2519250_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186469.1|2519534_2521580_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_069905041.1|2521827_2524101_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138615.1|2524158_2525658_-	NAD-dependent phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_069905040.1|2525893_2526799_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|2526970_2527297_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2527304_2527490_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900941.1|2527486_2530126_-	YdbH family protein	NA	NA	NA	NA	NA
WP_069905039.1|2530333_2531323_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	43.7	9.6e-70
WP_001298828.1|2531433_2531856_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2531852_2532119_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000837921.1|2537059_2538193_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|2538333_2538768_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000286867.1|2539353_2540268_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983721.1|2540267_2541095_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_001101728.1|2541091_2541949_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968131.1|2541945_2542803_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_152406410.1|2543198_2546975_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	83.5	0.0e+00
WP_016238939.1|2547039_2547639_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.7e-106
WP_152406411.1|2547707_2551187_-	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	90.6	0.0e+00
WP_000741572.1|2551247_2551895_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	2.0e-108
WP_001312811.1|2551792_2552536_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	1.1e-150
WP_001152425.1|2552541_2553240_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.3	1.9e-128
WP_000024051.1|2553239_2553578_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_089502999.1|2553570_2556804_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.1	1.9e-103
WP_001755909.1|2556967_2557168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012565075.1|2557275_2557635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|2557785_2558748_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_000673077.1|2558774_2559167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029819.1|2559163_2559544_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	6.5e-19
WP_000524260.1|2559544_2559928_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|2559927_2560323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000918487.1|2560545_2561685_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000770042.1|2561783_2562548_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
WP_089502936.1|2562652_2563765_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	9.3e-114
WP_000763702.1|2563748_2565155_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	1.0e-186
WP_131199879.1|2565157_2566306_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.5	2.1e-124
WP_000089450.1|2567215_2568310_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	1.0e-112
WP_000126788.1|2568313_2568523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204035.1|2568500_2569433_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
WP_001291093.1|2569425_2570217_-	transcriptional regulator	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_069905030.1|2570354_2571812_-	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228696.1|2572008_2572194_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001194112.1|2572410_2572887_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	2.3e-85
WP_000781775.1|2572890_2573232_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
WP_001324058.1|2573308_2573611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208722.1|2573579_2574149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000640144.1|2574370_2574913_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.6	4.9e-76
WP_000228038.1|2574909_2575200_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_000940316.1|2575199_2575799_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	1.6e-107
WP_001186445.1|2576264_2576417_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	81.6	1.6e-13
WP_000107696.1|2576565_2578395_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000721512.1|2578418_2579459_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	38.8	3.8e-61
WP_001151113.1|2579492_2579924_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	5.4e-62
WP_000450659.1|2579939_2580701_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	2.0e-115
WP_000788972.1|2580723_2581470_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000899746.1|2581476_2582334_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000693797.1|2582346_2582769_-	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000712069.1|2582791_2583088_-	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000948459.1|2583211_2583688_+	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000233809.1|2583996_2584131_+	phage protein	NA	NA	NA	NA	NA
WP_001169151.1|2584141_2584297_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001324055.1|2584293_2584782_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2585223_2585445_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001352098.1|2585444_2585615_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2585689_2585965_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_069905029.1|2586066_2588667_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	1.5e-247
WP_000166319.1|2588659_2589469_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2589525_2589720_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2589712_2589922_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2590000_2590216_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2590217_2591453_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001157406.1|2591504_2592440_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123737.1|2592568_2593942_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2594419_2595403_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|2595657_2596890_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2596023:2596039	attR	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
>prophage 6
NZ_CP045277	Escherichia coli strain LAU-OXA chromosome, complete genome	4812180	2792853	2844339	4812180	portal,tail,protease,terminase,transposase,holin,capsid,tRNA,head,integrase	Escherichia_phage(43.59%)	58	2801045:2801059	2844441:2844455
WP_001297484.1|2792853_2793960_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|2793995_2794637_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2794640_2796011_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|2796179_2796851_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|2796850_2798311_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000456506.1|2798386_2799508_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000359434.1|2799556_2800783_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2801032_2802169_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
2801045:2801059	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2802152_2803016_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_122985287.1|2803571_2804240_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_089503024.1|2804184_2804322_-|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
WP_103723399.1|2806210_2807424_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.3	1.1e-168
WP_001230338.1|2809634_2810234_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	4.4e-110
WP_152406412.1|2810303_2813801_-	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	98.1	0.0e+00
WP_000741572.1|2813861_2814509_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	2.0e-108
WP_001312811.1|2814406_2815150_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	1.1e-150
WP_152406413.1|2815155_2815854_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	1.8e-131
WP_001330090.1|2815853_2816210_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_053897428.1|2816187_2819415_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.8	0.0e+00
WP_071590020.1|2819461_2819722_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_001312914.1|2819763_2820150_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_053897430.1|2820149_2820854_-|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	94.0	5.3e-115
WP_001206699.1|2820914_2821259_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.8e-55
WP_000968644.1|2821255_2821705_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_089502987.1|2821701_2822040_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	89.3	1.1e-49
WP_000719066.1|2822048_2822366_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000999828.1|2823673_2824273_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923129.1|2824265_2825492_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.1	1.1e-203
WP_001140892.1|2825639_2827397_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|2827396_2827879_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001111090.1|2828026_2828377_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	4.3e-65
WP_000351660.1|2828515_2829055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100260.1|2829060_2829327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001228685.1|2829544_2829730_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_000992100.1|2829946_2830480_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_000193289.1|2830543_2830894_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000839574.1|2830898_2831114_-|holin	holin	holin	M1FN85	Enterobacteria_phage	100.0	2.4e-34
WP_001323867.1|2831862_2831985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064896.1|2832015_2832705_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	2.8e-60
WP_000904096.1|2832701_2833061_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	2.7e-38
WP_024198496.1|2833073_2834123_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.2	7.7e-110
WP_001323868.1|2834124_2834397_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_001112736.1|2834343_2834523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013636.1|2834564_2834777_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000150294.1|2834957_2835623_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151253.1|2835797_2836223_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	4.1e-62
WP_021530548.1|2836263_2837334_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	1.9e-63
WP_000693850.1|2837405_2837831_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2837827_2838082_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2838161_2838581_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_000379575.1|2838878_2839034_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|2839193_2839412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131199666.1|2839415_2839580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2839980_2840169_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_016231063.1|2840165_2840357_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_152406414.1|2840449_2842921_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000003742.1|2842982_2843252_+	excisionase	NA	NA	NA	NA	NA
WP_000074983.1|2843220_2844339_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
2844441:2844455	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 7
NZ_CP045277	Escherichia coli strain LAU-OXA chromosome, complete genome	4812180	3671226	3753315	4812180	portal,tail,protease,terminase,transposase,holin,capsid,head,plate,integrase	Shigella_phage(60.34%)	96	3690160:3690176	3750761:3750777
WP_000131044.1|3671226_3673260_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3673388_3673976_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089110.1|3673989_3675462_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3675475_3677146_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3677358_3678027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3678269_3678965_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_069905003.1|3678957_3680385_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102108.1|3680395_3681115_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3681641_3682496_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069905002.1|3682721_3684047_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	3.2e-113
WP_000474084.1|3684155_3684392_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3684403_3684997_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_131199844.1|3685586_3686438_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_069905001.1|3686577_3690834_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
3690160:3690176	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000662258.1|3691948_3692050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3692413_3692677_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3692676_3692817_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3692851_3693079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3693902_3694445_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|3694519_3695107_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001300563.1|3695310_3696423_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000716398.1|3696514_3697183_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131096.1|3697208_3699734_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001572600.1|3699723_3700821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000905935.1|3700995_3701367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001360105.1|3701335_3702046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|3702358_3702688_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3702935_3703550_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070700.1|3703967_3704657_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3704653_3705610_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667026.1|3705606_3707805_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121359.1|3707814_3708771_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3708749_3709160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749408.1|3709666_3710098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947598.1|3710474_3711637_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_069905221.1|3711719_3712052_-	protein flxA	NA	NA	NA	NA	NA
WP_032193087.1|3712907_3714797_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_023147383.1|3715047_3715422_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	49.4	2.8e-14
WP_001515122.1|3715421_3715865_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	62.4	1.5e-46
WP_001515121.1|3715836_3716247_-|tail	tail assembly chaperone	tail	U5P0S4	Shigella_phage	81.6	2.3e-25
WP_039000333.1|3716246_3717173_-	hypothetical protein	NA	U5P0I1	Shigella_phage	83.1	9.3e-51
WP_000383536.1|3717176_3717761_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	7.0e-113
WP_023147736.1|3717751_3718810_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	8.1e-200
WP_016244980.1|3718796_3719222_-|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	2.0e-80
WP_001259084.1|3719221_3719770_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000999511.1|3719769_3720849_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.6e-206
WP_032193238.1|3720845_3722174_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	2.5e-246
WP_016244982.1|3722234_3724070_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.3	2.9e-306
WP_023147733.1|3724062_3724245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661054.1|3724211_3724481_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090998.1|3724480_3724837_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_016244983.1|3724836_3726333_-|tail	phage tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.4	5.4e-274
WP_000497751.1|3726316_3726487_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_016244984.1|3726495_3727056_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	3.0e-105
WP_000213503.1|3727052_3727559_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_023147732.1|3727533_3727944_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	2.1e-71
WP_000927711.1|3727940_3728264_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|3728266_3728467_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257519.1|3728516_3729722_-|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	100.0	1.8e-224
WP_016244986.1|3729736_3730387_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	1.6e-118
WP_023147731.1|3730364_3731606_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	1.3e-241
WP_000605606.1|3731605_3731788_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_123010488.1|3731799_3733296_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	99.8	2.0e-300
WP_000929173.1|3733529_3734024_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_021519684.1|3734149_3734500_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	2.3e-63
WP_021519683.1|3734557_3735064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122985904.1|3735268_3735517_-	peptidase	NA	Q8SBD8	Shigella_phage	77.2	1.8e-25
WP_032193237.1|3735401_3735794_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	82.9	1.3e-49
WP_016236818.1|3735777_3736254_-	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	94.3	1.5e-84
WP_001120501.1|3736257_3736593_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|3736729_3737023_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|3737301_3737535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|3737678_3738218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021519680.1|3738432_3739185_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	5.8e-136
WP_089502964.1|3739198_3740188_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	3.3e-195
WP_001061403.1|3740195_3740993_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	2.0e-150
WP_000767095.1|3741012_3741402_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_021549921.1|3741398_3741725_-	LexA repressor	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_015364417.1|3741721_3742375_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_072176118.1|3742374_3742869_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	4.3e-87
WP_000104954.1|3742865_3743807_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001250269.1|3743796_3743976_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001434539.1|3744151_3744703_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_000205494.1|3744740_3744941_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|3745038_3745665_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000917896.1|3745850_3746147_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000141752.1|3746064_3746310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077626407.1|3746546_3746768_+	hypothetical protein	NA	S5FNS4	Shigella_phage	95.9	2.4e-37
WP_000008202.1|3746823_3747360_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001242749.1|3747350_3747713_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_001519505.1|3747712_3748009_+	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	6.8e-48
WP_077873866.1|3747924_3748359_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	6.4e-79
WP_000051893.1|3748235_3749399_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	5.3e-229
WP_000893278.1|3749603_3750857_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3750761:3750777	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|3750868_3751972_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3752259_3753315_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 8
NZ_CP045277	Escherichia coli strain LAU-OXA chromosome, complete genome	4812180	4131056	4169598	4812180	holin,transposase	Stx2-converting_phage(25.0%)	49	NA	NA
WP_097499809.1|4131056_4132329_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	4.7e-170
WP_001514887.1|4132254_4132473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001514886.1|4132469_4132844_-	toxin YeeV	NA	NA	NA	NA	NA
WP_131199866.1|4132933_4133302_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692286.1|4133464_4133686_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	7.2e-10
WP_001186774.1|4133748_4134225_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855059.1|4134240_4134714_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001234729.1|4135055_4135874_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	40.1	4.2e-47
WP_071596305.1|4135894_4136029_-	cytoplasmic protein	NA	NA	NA	NA	NA
WP_001323397.1|4136028_4136187_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_024946616.1|4136257_4139104_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_024946615.1|4139476_4140349_-	GTPase family protein	NA	NA	NA	NA	NA
WP_023143234.1|4140433_4141351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001332433.1|4141483_4141699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|4141993_4143267_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001329788.1|4143519_4143717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813456.1|4143887_4144490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123009915.1|4144584_4144863_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001384652.1|4144831_4144990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089503012.1|4144931_4145198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001344112.1|4145498_4145675_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_001297219.1|4146020_4146221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221544.1|4146419_4146989_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270978.1|4147248_4147650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|4147637_4148072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331630.1|4148071_4148308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171523.1|4148426_4148807_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612632.1|4148803_4149151_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	98.3	1.4e-60
WP_000998098.1|4149200_4150586_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	2.2e-258
WP_024946614.1|4150824_4152183_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000937736.1|4152561_4152753_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
WP_000555341.1|4152915_4153173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001332869.1|4153217_4153406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024946613.1|4155364_4156309_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000088357.1|4156489_4157629_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
WP_001293435.1|4157782_4159780_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_071932121.1|4159724_4159883_+|holin	choline transporter	holin	NA	NA	NA	NA
WP_001375347.1|4159842_4161120_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000145475.1|4161367_4162024_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001390362.1|4162081_4162186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126123275.1|4162204_4162315_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001390361.1|4162423_4162705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077249023.1|4163103_4163304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001387298.1|4163431_4163530_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_001295538.1|4163531_4164314_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001742622.1|4164619_4165540_+	ribokinase	NA	NA	NA	NA	NA
WP_000998346.1|4165567_4166884_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_004019923.1|4166895_4167909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|4168389_4169598_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 1
NZ_CP045278	Escherichia coli strain LAU-OXA plasmid pLAU-OXA1, complete sequence	111694	0	111373	111694	tRNA,terminase,transposase,integrase,tail	Salmonella_phage(90.99%)	126	11716:11735	21537:21556
WP_000105079.1|0_1095_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	1.3e-75
WP_001229345.1|1674_1887_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_001404454.1|1886_2222_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	8.6e-39
WP_000688529.1|2218_2398_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	67.8	4.0e-11
WP_014962290.1|2437_2713_-	hypothetical protein	NA	J9Q738	Salmonella_phage	73.6	9.8e-33
WP_024181926.1|2768_3185_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	75.4	1.4e-59
WP_000715581.1|3285_4116_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_000591156.1|4119_4320_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	60.6	3.2e-09
WP_001051809.1|4412_5486_-	hypothetical protein	NA	J9Q736	Salmonella_phage	95.2	1.4e-196
WP_000920224.1|5488_5755_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
WP_001108395.1|5754_6699_-	hypothetical protein	NA	J9Q7S6	Salmonella_phage	90.8	2.3e-166
WP_000047683.1|6759_7788_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	84.6	4.8e-141
WP_000627054.1|7905_8337_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.7	1.5e-64
WP_113519373.1|8462_11981_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.3	0.0e+00
11716:11735	attL	AATGATTCCATACATCTCAT	NA	NA	NA	NA
WP_001348687.1|11955_12159_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	89.6	4.4e-30
WP_000213833.1|12161_13397_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	81.3	6.7e-198
WP_032252482.1|13492_15601_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	66.5	1.4e-227
WP_001098352.1|15699_15912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282577.1|16162_16549_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_000797846.1|16543_17647_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_000156433.1|17857_18103_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	4.5e-13
WP_113519372.1|18277_19540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000067986.1|21115_21406_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	78.1	6.9e-37
WP_000636535.1|21551_21767_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.5	3.3e-20
21537:21556	attR	ATGAGATGTATGGAATCATT	NA	NA	NA	NA
WP_085949093.1|21750_21927_-	hypothetical protein	NA	J9Q729	Salmonella_phage	72.4	1.1e-16
WP_000733192.1|21926_23249_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	90.9	2.0e-240
WP_106361768.1|23245_23728_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	70.6	1.1e-50
WP_021520122.1|23784_24567_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	3.4e-54
WP_113519371.1|24642_25824_-	DNA primase	NA	J9Q720	Salmonella_phage	93.2	1.5e-207
WP_000137333.1|25905_27246_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.5	3.4e-235
WP_001717320.1|27289_28030_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.6	2.2e-127
WP_113519370.1|28319_29378_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	43.5	7.6e-65
WP_000062085.1|29438_29798_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
WP_000161228.1|29797_30466_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_001351987.1|30784_31054_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_023908317.1|31061_31583_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071597914.1|31614_31800_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	75.0	4.9e-20
WP_001404395.1|31750_32002_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	78.0	1.1e-25
WP_000856757.1|32003_32696_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	94.3	6.2e-124
WP_001717323.1|32709_33033_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	89.7	5.9e-45
WP_032196220.1|33114_33345_-	hypothetical protein	NA	J9Q714	Salmonella_phage	59.2	1.9e-21
WP_031323050.1|33355_33964_-	hypothetical protein	NA	J9Q7G0	Salmonella_phage	73.3	6.5e-77
WP_000120169.1|33963_34218_-	hypothetical protein	NA	J9Q7R5	Salmonella_phage	67.9	3.0e-28
WP_023908314.1|34380_34908_-|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	84.0	4.1e-80
WP_113519376.1|34910_35825_-|tail	phage tail protein	tail	A0A077SK37	Escherichia_phage	87.6	3.4e-162
WP_113519384.1|39362_44090_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.2	0.0e+00
WP_001293195.1|44107_44701_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	2.0e-99
WP_000526940.1|44688_45486_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	93.6	1.1e-153
WP_001348638.1|45478_46210_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	97.0	5.3e-134
WP_000442114.1|46259_46595_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	87.3	2.3e-52
WP_000081615.1|46637_51215_-	tape measure protein	NA	J9Q712	Salmonella_phage	83.7	0.0e+00
WP_024198537.1|51222_51492_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	5.1e-34
WP_000163860.1|51572_51890_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	95.2	3.3e-48
WP_000072375.1|51951_52698_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	6.2e-106
WP_000469440.1|52772_53156_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
WP_000523627.1|53157_53631_-	hypothetical protein	NA	J9Q711	Salmonella_phage	89.8	2.1e-75
WP_001027663.1|53621_53966_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_000057118.1|54045_54879_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.3e-141
WP_000801185.1|54878_55313_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	82.6	1.1e-59
WP_001348642.1|55357_56278_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	83.9	2.1e-132
WP_001130340.1|56351_57227_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.5	5.0e-155
WP_001055286.1|57252_58140_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	87.9	1.6e-132
WP_000422363.1|58161_59736_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	92.9	8.4e-286
WP_001007300.1|59762_61019_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.9	3.4e-245
WP_000215413.1|61018_61651_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
WP_000176292.1|61846_62113_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_001348643.1|62122_63022_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.3	1.3e-166
WP_001113022.1|63018_63273_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	5.9e-40
WP_000049674.1|63265_63904_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	3.6e-110
WP_000161986.1|63900_64569_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_024170896.1|64568_65267_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	87.1	5.1e-110
WP_113519383.1|65331_66891_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	2.0e-279
WP_001291061.1|66893_67172_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_023145145.1|67204_67804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000028001.1|67949_68438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001348648.1|68453_69053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001259437.1|69049_69574_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	79.1	3.4e-66
WP_001273880.1|69869_70520_+	hypothetical protein	NA	J9Q754	Salmonella_phage	86.1	6.9e-101
WP_000470243.1|70567_70798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001009193.1|71414_71897_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
WP_023908299.1|72247_72658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000216801.1|72739_73135_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	3.1e-32
WP_000749407.1|73261_73573_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
WP_031323040.1|73726_74056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014962255.1|74194_74413_-	hypothetical protein	NA	J9Q804	Salmonella_phage	91.7	2.3e-32
WP_023908297.1|76004_77195_-	hypothetical protein	NA	J9Q803	Salmonella_phage	55.6	3.1e-123
WP_050586635.1|77365_77587_-	hypothetical protein	NA	J9Q750	Salmonella_phage	53.7	1.9e-15
WP_001755492.1|77826_79860_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_000004356.1|80017_81118_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_000506720.1|81155_81545_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
WP_131199857.1|82346_82973_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	68.4	1.2e-06
WP_131199856.1|83349_84003_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	92.1	7.0e-45
WP_001355905.1|84002_84188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131199855.1|84184_84607_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	50.0	1.4e-14
WP_001718093.1|84606_85149_-	hypothetical protein	NA	J9Q748	Salmonella_phage	86.9	1.0e-86
WP_131199854.1|85145_85787_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	86.9	1.8e-98
WP_022644969.1|85906_86287_-	hypothetical protein	NA	J9Q801	Salmonella_phage	68.6	1.3e-27
WP_108432744.1|86286_86991_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	77.4	1.5e-88
WP_113519374.1|87052_88738_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.0	0.0e+00
WP_022644972.1|88879_89446_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	64.2	7.7e-56
WP_001393253.1|89653_89986_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|90032_90908_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|91163_92426_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000893470.1|92640_92799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000900261.1|92798_93224_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	78.7	5.7e-56
WP_014962274.1|93317_93506_-	hypothetical protein	NA	J9Q800	Salmonella_phage	51.6	9.4e-11
WP_021512350.1|93515_94010_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	56.2	3.0e-24
WP_001404443.1|94158_94749_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.8	3.7e-93
WP_000121543.1|95329_95560_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	5.9e-31
WP_000559568.1|95745_96339_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	2.0e-99
WP_000099880.1|96522_97332_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	3.4e-65
WP_001718080.1|97490_98048_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	82.5	4.8e-87
WP_126681131.1|98057_98477_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	2.1e-50
WP_131199853.1|98538_99183_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	80.4	1.1e-95
WP_000781810.1|99182_99659_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	90.5	2.0e-81
WP_001348729.1|99655_100069_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	84.7	2.3e-62
WP_097346607.1|100070_101201_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	86.6	7.3e-191
WP_001011859.1|101345_102215_-	hypothetical protein	NA	J9Q742	Salmonella_phage	81.0	3.1e-133
WP_000122502.1|102292_103435_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_131199852.1|103541_105857_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.4	0.0e+00
WP_000037962.1|105930_106500_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_023908288.1|106509_107253_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.2	1.2e-51
WP_001404451.1|107242_109159_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	73.2	4.5e-249
WP_085949095.1|109155_109347_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	74.6	8.3e-23
WP_000174804.1|109388_110474_-	exonuclease	NA	J9Q7S9	Salmonella_phage	87.3	6.8e-186
WP_000364573.1|110728_111373_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
>prophage 1
NZ_CP045279	Escherichia coli strain LAU-OXA plasmid pLAU-OXA2, complete sequence	82182	66604	76310	82182	transposase	Escherichia_phage(62.5%)	8	NA	NA
WP_001553854.1|66604_69721_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
WP_001617890.1|69842_71126_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
WP_001617892.1|71122_72679_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_001190712.1|72861_73083_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|73082_73463_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|73467_73647_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|73674_74034_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_152406418.1|75293_76310_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	1.7e-186
>prophage 1
NZ_CP045280	Escherichia coli strain LAU-OXA plasmid pLAU-OXA3, complete sequence	37385	0	13371	37385	transposase,integrase	Escherichia_phage(33.33%)	11	3332:3344	15584:15596
WP_000624722.1|658_1009_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080200.1|1039_2653_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
3332:3344	attL	TGCCACCACCGTC	NA	NA	NA	NA
WP_004118297.1|3892_5377_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.8e-32
WP_072143941.1|5376_5628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776034.1|5785_6217_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004118291.1|6216_7488_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_012600007.1|7569_8547_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|8543_9749_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_004118283.1|10645_11512_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000764642.1|12279_12537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|12594_13371_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
15584:15596	attR	TGCCACCACCGTC	NA	NA	NA	NA
>prophage 2
NZ_CP045280	Escherichia coli strain LAU-OXA plasmid pLAU-OXA3, complete sequence	37385	16976	20175	37385	transposase	uncultured_archaeal_virus(33.33%)	3	NA	NA
WP_000509966.1|16976_17582_-	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_001067855.1|17812_18517_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001323889.1|18597_20175_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
>prophage 3
NZ_CP045280	Escherichia coli strain LAU-OXA plasmid pLAU-OXA3, complete sequence	37385	25133	36506	37385	transposase	Enterobacteria_phage(25.0%)	10	NA	NA
WP_024250302.1|25133_26243_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	28.9	2.5e-26
WP_024250303.1|26239_27688_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_024250304.1|27690_28566_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.7	9.9e-111
WP_024250305.1|28649_29798_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.5	6.2e-97
WP_024250307.1|30715_31855_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_077694555.1|32194_33211_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	1.7e-186
WP_024250309.1|34077_34503_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.0	1.3e-31
WP_024250310.1|34502_35768_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	55.2	1.9e-123
WP_000780222.1|35914_36196_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_024250311.1|36176_36506_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
