The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045216	Pantoea dispersa strain BJQ0007 chromosome, complete genome	4325134	183162	257392	4325134	transposase,integrase,protease	Hokovirus(16.67%)	55	177610:177636	258199:258225
177610:177636	attL	CCAGGTGCGCATCAATGCGCACCCTGT	NA	NA	NA	NA
WP_064511431.1|183162_184314_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_059012349.1|184390_185308_-	bestrophin	NA	NA	NA	NA	NA
WP_021508093.1|185561_186203_+	hydrolase	NA	NA	NA	NA	NA
WP_152390342.1|186204_187107_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152390343.1|187202_188024_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_059012346.1|188119_188923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031279810.1|188993_189926_-	nucleoside recognition family protein	NA	NA	NA	NA	NA
WP_058780218.1|190067_191420_-	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_059012345.1|191550_192462_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_152390344.1|192465_193308_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_049851967.1|193884_194094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152390345.1|194226_195897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058759342.1|196113_198156_+	oligopeptidase A	NA	NA	NA	NA	NA
WP_021508104.1|198164_198914_+	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_152390346.1|199420_208672_+	hemagglutinin	NA	NA	NA	NA	NA
WP_024143560.1|208697_209621_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_152390347.1|210693_211584_+	OmpA family protein	NA	NA	NA	NA	NA
WP_021508107.1|211668_212106_-	universal stress protein UspA	NA	NA	NA	NA	NA
WP_010618665.1|212528_212864_+	universal stress protein UspB	NA	NA	NA	NA	NA
WP_021508108.1|212942_214442_-	inorganic phosphate transporter PitA	NA	NA	NA	NA	NA
WP_152390348.1|214682_215867_+	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
WP_152390349.1|216272_216548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024143560.1|216589_217513_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_152390350.1|217673_220598_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	2.6e-38
WP_152390351.1|221087_222503_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_152390352.1|222639_226311_-	autotransporter domain-containing protein	NA	Q9LA58	Enterobacterial_phage	36.7	1.4e-86
WP_152390353.1|226489_226837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024143560.1|226971_227895_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_152390354.1|228317_228812_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152390355.1|229131_230154_+	alpha/beta fold hydrolase	NA	K0GAH4	Mycobacterium_virus	28.6	1.4e-07
WP_104094165.1|230161_231136_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.1	1.7e-10
WP_031279816.1|231251_232229_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_021508120.1|232555_234061_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.8e-57
WP_021508121.1|234419_235211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021508122.1|235203_235674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152390356.1|235701_236661_-	D-2-hydroxyacid dehydrogenase family protein	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	29.2	1.7e-15
WP_152390357.1|236635_238240_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_152390358.1|238579_239656_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_152390359.1|239864_241088_+	MFS transporter	NA	NA	NA	NA	NA
WP_152390360.1|241656_243162_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_127834682.1|243185_244001_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_031279682.1|244185_245028_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021507392.1|245381_247295_-	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_104189576.1|247840_249775_+	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_021507394.1|249839_250853_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_104189577.1|250922_251819_+	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_152390361.1|251929_252076_-	DUF943 family protein	NA	NA	NA	NA	NA
WP_152390362.1|252036_252387_-	DUF943 family protein	NA	NA	NA	NA	NA
WP_152390363.1|252386_253070_-	DUF3289 family protein	NA	NA	NA	NA	NA
WP_024143560.1|253135_254059_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_152390364.1|254121_254292_-	DUF3289 family protein	NA	NA	NA	NA	NA
WP_058759321.1|254472_255981_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_152390365.1|256014_256278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152390366.1|256208_256535_+	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_058759383.1|256567_257392_+|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
258199:258225	attR	CCAGGTGCGCATCAATGCGCACCCTGT	NA	NA	NA	NA
>prophage 2
NZ_CP045216	Pantoea dispersa strain BJQ0007 chromosome, complete genome	4325134	552893	605691	4325134	tRNA,transposase,coat	Bacillus_virus(28.57%)	37	NA	NA
WP_024143560.1|552893_553817_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_152390430.1|553872_555423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024143560.1|555541_556465_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_152390431.1|556510_556696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059012473.1|556888_558694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127834598.1|558706_561070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082678702.1|561263_563057_-	Biofilm associated protein A	NA	NA	NA	NA	NA
WP_021509584.1|563509_564832_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.5	2.0e-59
WP_152390432.1|566099_567062_-	fimbrial protein	NA	NA	NA	NA	NA
WP_152390433.1|567058_569491_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_059012069.1|569490_570186_-	molecular chaperone	NA	NA	NA	NA	NA
WP_059012052.1|570212_570716_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_021509578.1|570738_571308_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_152390434.1|571855_573955_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	35.0	2.3e-20
WP_059012056.1|574117_576208_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	35.9	6.4e-23
WP_152390435.1|576497_577928_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_058757235.1|577940_578444_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_127834593.1|578510_581366_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	1.3e-143
WP_021506718.1|581371_581830_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_021506719.1|582141_583653_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.0	5.6e-45
WP_031279533.1|583920_585021_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_021506721.1|585020_586097_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_152390436.1|586213_587491_-	DUF445 family protein	NA	NA	NA	NA	NA
WP_152390437.1|587514_589017_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	43.8	2.7e-84
WP_152391503.1|589187_590759_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_152390438.1|591287_592019_+	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_021506726.1|592051_593821_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_152390439.1|593825_595076_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_021506728.1|595188_595866_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_021506729.1|596554_597190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152390440.1|597285_597765_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_152390441.1|597777_598383_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_152390442.1|598394_598820_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_152390443.1|598940_600320_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021506733.1|600429_600945_-	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_024143560.1|601912_602836_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_152390444.1|604767_605691_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	3.2e-176
>prophage 3
NZ_CP045216	Pantoea dispersa strain BJQ0007 chromosome, complete genome	4325134	956080	1005342	4325134	tRNA,transposase	Planktothrix_phage(13.33%)	52	NA	NA
WP_024143560.1|956080_957004_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_152390540.1|957049_957670_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_152390541.1|957653_958577_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152390542.1|958603_959113_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_024143560.1|959156_960080_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_152390543.1|960304_960970_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.5	7.0e-24
WP_088515750.1|960962_961796_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.0e-16
WP_031279350.1|961785_962643_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_021506482.1|962639_963692_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_058776471.1|963691_965260_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058770885.1|966011_968735_+	magnesium-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	25.0	2.0e-37
WP_058781696.1|968894_969572_+	SDR family oxidoreductase	NA	Q56AQ6	Bacillus_thuringiensis_phage	33.7	1.9e-13
WP_031279356.1|969609_970266_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_152390544.1|970499_970664_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_024143560.1|970707_971631_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_152391508.1|971942_972395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021506488.1|972566_972920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152390545.1|973367_973757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152390546.1|973753_974596_-	DUF4225 domain-containing protein	NA	A0A140XBD0	Dickeya_phage	50.4	4.1e-29
WP_152391509.1|974605_975067_-	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
WP_024143560.1|975103_976027_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_152391510.1|976089_977010_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152390547.1|977240_977996_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.8	1.1e-12
WP_152390548.1|978064_978493_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_024143560.1|978789_979713_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_021506506.1|980991_981474_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.2	9.8e-28
WP_021506507.1|981633_982068_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_021506508.1|982060_982351_+	RnfH family protein	NA	NA	NA	NA	NA
WP_021506509.1|982402_982750_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_152390549.1|982934_984596_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_152390550.1|984681_985560_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_152390551.1|985682_986261_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_058775636.1|986306_986984_-	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	48.4	3.8e-54
WP_152390552.1|987247_987631_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	68.9	6.8e-32
WP_021506515.1|987818_989147_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	2.7e-43
WP_058770868.1|989284_990034_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_152391511.1|990030_991638_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_010617748.1|992080_992659_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_152390553.1|992686_993343_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_058781716.1|993342_994299_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_152390554.1|994295_994760_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_058758277.1|994978_996778_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	27.2	4.1e-26
WP_152390555.1|996787_997759_+	signal peptidase I	NA	NA	NA	NA	NA
WP_021506523.1|997877_998558_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	37.6	1.1e-19
WP_058758278.1|998606_999509_+	GTPase Era	NA	NA	NA	NA	NA
WP_058775641.1|999512_1000250_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_021506526.1|1000310_1001042_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_010617758.1|1001041_1001422_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_010617759.1|1001418_1001667_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	51.2	3.1e-17
WP_152391512.1|1001963_1003349_-	hypothetical protein	NA	E5AGC8	Erwinia_phage	31.9	4.9e-64
WP_152390556.1|1003381_1004293_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	80.1	1.2e-138
WP_024143560.1|1004418_1005342_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP045216	Pantoea dispersa strain BJQ0007 chromosome, complete genome	4325134	1196763	1207520	4325134	integrase	Salmonella_phage(28.57%)	9	1203164:1203178	1206573:1206587
WP_152390604.1|1196763_1200192_+	DUF1983 domain-containing protein	NA	A0A291AWT4	Escherichia_phage	51.0	6.3e-312
WP_152390605.1|1201164_1201587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152390606.1|1201602_1202094_-	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	40.6	3.0e-24
WP_058771615.1|1202463_1202703_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	49.4	7.7e-18
WP_152390607.1|1202702_1203968_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	72.3	6.3e-175
1203164:1203178	attL	GAAGTGGACGAAGAC	NA	NA	NA	NA
WP_152391515.1|1203925_1204231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152390608.1|1204234_1205404_-|integrase	tyrosine-type recombinase/integrase	integrase	I6R0M2	Salmonella_phage	71.2	4.3e-162
WP_152390609.1|1205729_1206662_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	76.5	5.0e-113
1206573:1206587	attR	GTCTTCGTCCACTTC	NA	NA	NA	NA
WP_152390610.1|1206905_1207520_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	W5SAS9	Pithovirus	27.6	2.1e-11
>prophage 6
NZ_CP045216	Pantoea dispersa strain BJQ0007 chromosome, complete genome	4325134	1695584	1763245	4325134	transposase,tRNA	Escherichia_phage(36.36%)	59	NA	NA
WP_152390752.1|1695584_1697366_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_059009760.1|1697365_1697797_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_021509967.1|1698037_1698781_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_021509968.1|1698818_1699346_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	1.2e-10
WP_021509969.1|1699500_1700115_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_021509970.1|1700123_1701128_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.6	4.0e-07
WP_152390753.1|1701134_1701920_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_058774752.1|1701916_1702672_-	zinc ABC transporter ATP-binding protein ZnuC	NA	R4TX06	Phaeocystis_globosa_virus	33.5	2.2e-13
WP_152390754.1|1702749_1703721_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_031280193.1|1703735_1705064_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	43.5	2.2e-16
WP_021509975.1|1705191_1706166_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_152390755.1|1706210_1707446_-	MdfA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_021509977.1|1707538_1708981_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_152390756.1|1709088_1709958_-	transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_021509979.1|1710331_1711807_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.4	1.3e-78
WP_058780667.1|1711967_1712414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058757515.1|1712592_1713240_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_152390757.1|1713325_1714504_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_152390758.1|1714665_1715307_+	DUF533 domain-containing protein	NA	NA	NA	NA	NA
WP_152390759.1|1715426_1717490_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_104093225.1|1717483_1718152_-	exodeoxyribonuclease X	NA	NA	NA	NA	NA
WP_010616356.1|1718155_1718386_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	2.0e-15
WP_104093226.1|1718539_1718917_+	copper homeostasis periplasmic binding protein CopC	NA	NA	NA	NA	NA
WP_152390760.1|1718916_1719798_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_031280196.1|1719826_1720174_+	YebY family protein	NA	NA	NA	NA	NA
WP_024143560.1|1720874_1721798_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_023135683.1|1722236_1723253_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_058774585.1|1723726_1724293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058757753.1|1724704_1725097_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_021510007.1|1725172_1725403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024143560.1|1725546_1726470_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_058759072.1|1726556_1727135_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_104187471.1|1727552_1728620_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_024143560.1|1729081_1730005_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010618047.1|1730435_1730996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010618046.1|1730992_1731787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058775925.1|1731863_1732193_+	DNA damage-inducible SOS regulon protein	NA	NA	NA	NA	NA
WP_021509066.1|1732656_1734597_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_031280003.1|1734669_1735209_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	45.8	1.5e-21
WP_136547869.1|1735296_1735785_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152390761.1|1735881_1737045_+	MFS transporter	NA	NA	NA	NA	NA
WP_152390762.1|1737122_1737554_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_058770225.1|1737550_1738297_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_152390763.1|1738396_1739341_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152390764.1|1739608_1740073_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_152390765.1|1740187_1740988_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_152390766.1|1741558_1742686_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_023135683.1|1743160_1744177_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_152390767.1|1744236_1750164_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	23.4	5.2e-38
WP_152390768.1|1750191_1751259_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	37.1	9.1e-26
WP_021509079.1|1751262_1752087_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_152390769.1|1752096_1753017_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_104093323.1|1753041_1754313_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_058781511.1|1754334_1755501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058770216.1|1755487_1756198_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152391527.1|1756345_1757851_+	filamentous hemagglutinin	NA	NA	NA	NA	NA
WP_021313390.1|1757847_1758210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152391528.1|1758731_1760711_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_024143560.1|1762321_1763245_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP045216	Pantoea dispersa strain BJQ0007 chromosome, complete genome	4325134	2616921	2630843	4325134	tRNA	Tupanvirus(22.22%)	15	NA	NA
WP_058769694.1|2616921_2617968_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	51.4	1.0e-85
WP_152391074.1|2617974_2619414_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	39.8	1.2e-57
WP_152391075.1|2619511_2620255_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_152391076.1|2620569_2621028_-	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	34.4	3.2e-12
WP_058780656.1|2621092_2621839_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.5	8.7e-07
WP_058769691.1|2621838_2622384_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_021506244.1|2622423_2623407_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_021506246.1|2623540_2623843_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	5.6e-13
WP_021506247.1|2623847_2626235_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.9	4.6e-09
WP_021506248.1|2626249_2627233_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.1	3.8e-34
WP_121626058.1|2627380_2627425_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_010616241.1|2627545_2627902_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_006118955.1|2628070_2628268_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_058757673.1|2628367_2628910_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.5	4.3e-16
WP_152391077.1|2628914_2630843_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	2.6e-127
>prophage 8
NZ_CP045216	Pantoea dispersa strain BJQ0007 chromosome, complete genome	4325134	3221490	3266583	4325134	tRNA,transposase,integrase,protease	Escherichia_phage(20.0%)	45	3218477:3218492	3261357:3261372
3218477:3218492	attL	CACCGCCGGCACCGGC	NA	NA	NA	NA
WP_024143560.1|3221490_3222414_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_152391262.1|3222480_3222726_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_127833791.1|3222918_3224022_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_059010513.1|3224303_3225464_+	diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_021508608.1|3225530_3225812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021508609.1|3225992_3226253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021508610.1|3226333_3226531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136545627.1|3226563_3226830_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_021508612.1|3226964_3227234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021508613.1|3227333_3227576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021508614.1|3227888_3228128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031279895.1|3228349_3228610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152391263.1|3228808_3230248_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_150360907.1|3230608_3231190_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_150360935.1|3231213_3231825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058769416.1|3232193_3232649_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_152391264.1|3232726_3233806_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_152391562.1|3234882_3235062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152391563.1|3235903_3237439_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_021508621.1|3237698_3237914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152391564.1|3238064_3238478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152391265.1|3238839_3240033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152390444.1|3240076_3241000_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	3.2e-176
WP_152391266.1|3242628_3242847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152391267.1|3242903_3243587_-	VIT family protein	NA	NA	NA	NA	NA
WP_152391268.1|3243629_3244211_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_024143560.1|3244837_3245761_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_141497181.1|3246308_3246518_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_152391269.1|3246729_3247482_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_152391270.1|3247483_3248764_-	fimbrial protein	NA	NA	NA	NA	NA
WP_152391271.1|3248781_3251304_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_152391272.1|3251306_3251897_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_024143560.1|3251893_3252817_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_152391273.1|3253820_3254813_-	alkene reductase	NA	NA	NA	NA	NA
WP_152391274.1|3254803_3256030_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	1.3e-121
WP_152391275.1|3256367_3256871_-	DUF1198 family protein	NA	NA	NA	NA	NA
WP_058757932.1|3257046_3257913_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.2	4.8e-33
WP_058781236.1|3257912_3258125_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_152391276.1|3258207_3259593_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.0	8.7e-45
WP_021508631.1|3259811_3260306_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_058775254.1|3260305_3261022_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_021508633.1|3261155_3261665_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
3261357:3261372	attR	GCCGGTGCCGGCGGTG	NA	NA	NA	NA
WP_152391277.1|3261661_3262726_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_059012033.1|3265302_3265989_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-30
WP_141097301.1|3265959_3266583_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 9
NZ_CP045216	Pantoea dispersa strain BJQ0007 chromosome, complete genome	4325134	3352155	3359872	4325134	tRNA	uncultured_Mediterranean_phage(50.0%)	9	NA	NA
WP_058769383.1|3352155_3352626_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.0e-29
WP_058769382.1|3352719_3353823_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.3	6.7e-48
WP_031279647.1|3353826_3354276_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_058769381.1|3354447_3354885_+	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	50.0	2.1e-05
WP_152391299.1|3354900_3355473_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_058769379.1|3355537_3356506_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	42.2	2.2e-47
WP_071813591.1|3356516_3358364_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_021507155.1|3358389_3358722_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	1.7e-10
WP_021507154.1|3358747_3359872_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.3	9.4e-90
>prophage 10
NZ_CP045216	Pantoea dispersa strain BJQ0007 chromosome, complete genome	4325134	3440945	3447411	4325134		Streptococcus_phage(33.33%)	7	NA	NA
WP_021507271.1|3440945_3441296_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	45.5	1.4e-20
WP_021507272.1|3441292_3441760_-	glycoside hydrolase family protein	NA	A0A2I7S0L3	Vibrio_phage	33.3	3.6e-19
WP_021507273.1|3441938_3442217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031279669.1|3442629_3443361_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	37.1	1.8e-44
WP_152391568.1|3443714_3444968_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.7	6.6e-92
WP_058758012.1|3444978_3446082_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	2.9e-59
WP_021507277.1|3446328_3447411_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.2	1.2e-113
>prophage 1
NZ_CP045217	Pantoea dispersa strain BJQ0007 plasmid unnamed1, complete sequence	85113	10259	61232	85113	transposase	Enterobacteria_phage(75.0%)	46	NA	NA
WP_024143560.1|10259_11183_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	7.3e-173
WP_032416767.1|11346_11781_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_003026799.1|12019_12286_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_152391583.1|12273_12756_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_152391584.1|13825_14230_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024143560.1|15544_16468_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	7.3e-173
WP_032416808.1|16671_17007_+	TonB family protein	NA	NA	NA	NA	NA
WP_152391585.1|17481_18123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024143560.1|18479_19403_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	7.3e-173
WP_152391586.1|20021_20933_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	1.0e-171
WP_038628583.1|21438_21909_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_038628585.1|21924_22347_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_152391609.1|22436_25199_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_152391587.1|25390_26380_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_152391610.1|26487_27507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152391588.1|27578_28349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024143560.1|28831_29755_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	7.3e-173
WP_152391589.1|29881_30874_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_152391590.1|31041_31281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038628597.1|31348_31720_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_152391591.1|31725_32502_+	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
WP_152391592.1|32498_33065_+	serine kinase	NA	NA	NA	NA	NA
WP_038628601.1|33051_33654_+	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_038628603.1|33728_33956_+	HrpF protein	NA	NA	NA	NA	NA
WP_104951622.1|34066_36121_+	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	R9TEZ5	Vibrio_phage	25.4	1.3e-12
WP_102752010.1|36129_36318_+	type III secretion protein HrpT	NA	NA	NA	NA	NA
WP_152391593.1|36504_41880_+	AvrE-family type 3 secretion system effector	NA	NA	NA	NA	NA
WP_038628609.1|41892_42324_+	Tir chaperone family protein	NA	NA	NA	NA	NA
WP_102752012.1|42450_43536_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_038628614.1|43528_44344_-	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_038628616.1|44343_44604_-	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_102752026.1|44611_45259_-	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
WP_152391594.1|45271_45697_-	type III secretion system protein	NA	NA	NA	NA	NA
WP_152391595.1|45672_46311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152391596.1|46307_46970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152391597.1|46966_47422_-	type III secretion protein	NA	NA	NA	NA	NA
WP_102752017.1|47405_48761_-	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_102752018.1|48754_49615_-	type III secretion protein	NA	NA	NA	NA	NA
WP_038628627.1|49614_51825_-	type III secretion protein HrpI	NA	NA	NA	NA	NA
WP_102752020.1|51849_52968_-	YopN family type III secretion system gatekeeper subunit	NA	NA	NA	NA	NA
WP_152391598.1|53254_53800_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	24.4	7.7e-05
WP_102752022.1|53915_55400_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_084971144.1|55407_56049_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_152391599.1|56127_58497_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_152391600.1|58500_59877_-	MFS transporter	NA	NA	NA	NA	NA
WP_152390871.1|60308_61232_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.0	3.3e-173
>prophage 1
NZ_CP045218	Pantoea dispersa strain BJQ0007 plasmid unnamed2, complete sequence	48869	962	6723	48869		Enterobacteria_phage(50.0%)	6	NA	NA
WP_064645533.1|962_1511_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	3.0e-49
WP_064645534.1|1522_2413_-	dTDP-4-dehydrorhamnose reductase	NA	K7QJU0	Escherichia_phage	32.2	2.2e-25
WP_064645535.1|2434_3307_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	3.9e-107
WP_103755043.1|3321_4410_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.2	2.7e-94
WP_000780222.1|6131_6413_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|6393_6723_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
