The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045240	Lactobacillus vaginalis strain LV515 chromosome, complete genome	1894710	141515	150486	1894710		Prochlorococcus_phage(33.33%)	7	NA	NA
WP_003716188.1|141515_143744_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	1.2e-147
WP_003716187.1|143719_145183_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.4	6.2e-57
WP_003716186.1|145179_146217_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	40.4	7.2e-60
WP_003716185.1|146226_146805_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	35.9	1.2e-27
WP_003716184.1|146808_148347_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	6.9e-75
WP_040530546.1|148412_149669_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_003716182.1|149799_150486_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	A0A1X9IGJ2	Lactococcus_phage	33.3	1.2e-05
>prophage 2
NZ_CP045240	Lactobacillus vaginalis strain LV515 chromosome, complete genome	1894710	383484	392132	1894710	tRNA	Streptococcus_phage(33.33%)	7	NA	NA
WP_003717563.1|383484_384510_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	38.7	6.7e-58
WP_003717564.1|384580_385822_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	53.7	4.5e-109
WP_081446194.1|386085_386877_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.6	9.7e-41
WP_003717566.1|387109_389062_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.2	5.0e-54
WP_003717567.1|389327_389984_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_040531580.1|390162_390447_+	co-chaperone GroES	NA	A0A221S422	uncultured_virus	41.1	6.4e-11
WP_003717569.1|390500_392132_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.3	1.4e-158
>prophage 3
NZ_CP045240	Lactobacillus vaginalis strain LV515 chromosome, complete genome	1894710	680250	730838	1894710	transposase,protease,integrase,tRNA	Staphylococcus_phage(17.65%)	49	673993:674009	725070:725086
673993:674009	attL	AAGTTGCTGTTTTAACT	NA	NA	NA	NA
WP_003716885.1|680250_681504_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.3	1.5e-136
WP_040531076.1|681528_682125_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003716887.1|682124_682424_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	47.0	1.4e-21
WP_003716889.1|682758_684570_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_040531078.1|684635_685949_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_003716891.1|685982_686912_+	ribonuclease Z	NA	NA	NA	NA	NA
WP_003716892.1|686937_687771_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	3.2e-10
WP_003716893.1|687854_690179_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.1	2.6e-81
WP_003716894.1|690197_690716_+	adenine phosphoribosyltransferase	NA	A0A2K9L2N8	Tupanvirus	34.2	4.6e-15
WP_003716895.1|690740_691352_+	DUF308 domain-containing protein	NA	NA	NA	NA	NA
WP_003716896.1|691737_692874_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_003716897.1|693314_694184_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003716898.1|694303_697417_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.5	1.1e-23
WP_003716899.1|697428_699081_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	47.1	8.4e-119
WP_003716900.1|699073_700222_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_050754883.1|700328_701009_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	39.9	6.2e-36
WP_152378512.1|701069_702485_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_003716901.1|702637_703573_-|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	49.2	5.5e-83
WP_152378505.1|704073_705204_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_152378513.1|705231_705693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152378505.1|705768_706899_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_152378514.1|706938_707214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003716902.1|707518_707803_+	plasmid maintenance system killer	NA	NA	NA	NA	NA
WP_003716903.1|707818_708112_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_082611513.1|708278_709097_-	hypothetical protein	NA	A0A2H4PQP5	Staphylococcus_phage	24.9	6.2e-06
WP_003716905.1|709972_710761_-	acetoin reductase	NA	NA	NA	NA	NA
WP_003716906.1|711010_711502_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003716907.1|711704_712442_-	glucose 1-dehydrogenase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	28.1	2.2e-10
WP_003716908.1|712767_713922_+	ArgE/DapE family deacylase	NA	NA	NA	NA	NA
WP_003716909.1|713930_715445_+	YfcC family protein	NA	NA	NA	NA	NA
WP_050754861.1|715510_716341_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.6	5.2e-53
WP_003716911.1|716461_716869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003716912.1|716918_717974_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_003716913.1|718075_718756_+	RNase HI	NA	A0A1G5SA06	Enterococcus_phage	35.4	2.3e-22
WP_003716914.1|718755_719916_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_081446186.1|720120_721293_+	putative hydroxymethylpyrimidine transporter CytX	NA	NA	NA	NA	NA
WP_003716915.1|721339_721972_-	transcriptional repressor LexA	NA	A0A1B1P7Q3	Bacillus_phage	52.8	1.2e-14
WP_003716916.1|722145_722397_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003716917.1|722471_722696_+	YneF family protein	NA	NA	NA	NA	NA
WP_040531084.1|722747_723386_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003716919.1|723474_724236_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_081446181.1|724219_724498_+	endonuclease	NA	NA	NA	NA	NA
WP_003716920.1|724672_725461_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
725070:725086	attR	AAGTTGCTGTTTTAACT	NA	NA	NA	NA
WP_040531087.1|725573_726449_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_003716922.1|726525_727248_+	UMP kinase	NA	NA	NA	NA	NA
WP_003716923.1|727251_727812_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_040531090.1|727967_728735_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.0	8.0e-24
WP_040531093.1|728752_729538_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003716926.1|729560_730838_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
>prophage 4
NZ_CP045240	Lactobacillus vaginalis strain LV515 chromosome, complete genome	1894710	847048	904654	1894710	transposase,tRNA	unidentified_phage(30.77%)	54	NA	NA
WP_152378505.1|847048_848179_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_003717036.1|848258_848885_-	glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003717037.1|849106_851137_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.6	3.5e-127
WP_003717038.1|851159_853631_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.7	1.7e-99
WP_003717039.1|853778_854714_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_040531169.1|854817_855315_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_003717043.1|855621_856806_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003717044.1|856809_857802_+	lactate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	33.6	6.5e-34
WP_003717045.1|857952_858483_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003717046.1|858616_859408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717047.1|860054_861242_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_003717048.1|861386_862160_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_003717049.1|862217_862625_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_003717050.1|862645_862837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717051.1|862852_863398_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_152378505.1|863726_864857_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_040531282.1|864920_865460_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_040531172.1|865526_865835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040531175.1|865906_867163_-	chloride channel protein	NA	NA	NA	NA	NA
WP_003717055.1|867399_868212_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_003717056.1|868215_868701_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_003717057.1|868778_869129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717058.1|869135_870164_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	28.5	1.3e-13
WP_003717059.1|870253_870901_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_003717060.1|870890_871712_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_050754856.1|871733_872516_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_003717062.1|872720_873575_-	patatin family protein	NA	NA	NA	NA	NA
WP_003717063.1|873638_874523_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.1	7.1e-08
WP_003717064.1|874622_875099_+	flavodoxin	NA	NA	NA	NA	NA
WP_003717065.1|875213_875630_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_040531179.1|875750_876716_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_152378505.1|876892_878023_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_040531182.1|878258_878753_+|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_003717068.1|878882_880103_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	35.6	1.5e-61
WP_003717071.1|881049_881202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003717073.1|882246_883743_-	threonine synthase	NA	NA	NA	NA	NA
WP_003717074.1|883856_885131_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003717075.1|885145_886009_+	homoserine kinase	NA	NA	NA	NA	NA
WP_003717076.1|886142_886682_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.5	4.5e-05
WP_003717077.1|886949_888020_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_003717078.1|888139_889324_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_040531189.1|889862_891230_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003717081.1|891943_892234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081446183.1|892209_893154_+	MFS transporter	NA	NA	NA	NA	NA
WP_003717084.1|893427_893748_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003717086.1|894365_894632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082611515.1|894558_894930_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_152378505.1|894966_896097_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_003717088.1|896282_897212_+	hypothetical protein	NA	M1NSB9	Streptococcus_phage	33.1	4.7e-26
WP_040531191.1|897396_898632_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.4	2.7e-29
WP_003717090.1|898715_899903_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_003717094.1|901932_902316_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003717095.1|902432_902723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056974665.1|903238_904654_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP045240	Lactobacillus vaginalis strain LV515 chromosome, complete genome	1894710	913063	943773	1894710	transposase,integrase	unidentified_phage(50.0%)	23	913152:913171	925481:925500
WP_152378505.1|913063_914194_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
913152:913171	attL	TTGCGACTTTAAAGTCGCAA	NA	NA	NA	NA
WP_056974670.1|915514_916114_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152378517.1|916050_916959_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	34.5	2.8e-23
WP_056974650.1|916982_917750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040531196.1|917838_918969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152378505.1|919625_920756_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_003717110.1|920968_922015_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_003717111.1|921995_923168_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	29.5	2.3e-38
WP_003717112.1|923387_923981_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	31.6	1.6e-19
WP_152378562.1|924253_925195_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_152378505.1|925392_926523_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
925481:925500	attR	TTGCGACTTTAAAGTCGCAA	NA	NA	NA	NA
WP_056974630.1|926537_926969_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_040531202.1|927951_928764_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_003717117.1|928860_929385_-	nucleoside deoxyribosyltransferase	NA	A0A0A7DMT2	Lactobacillus_phage	68.8	6.2e-60
WP_003717118.1|929465_930875_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003717121.1|931342_932188_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_040531209.1|932209_934519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040531211.1|934644_936420_-	oleate hydratase	NA	NA	NA	NA	NA
WP_003717124.1|936601_937432_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_040531214.1|937491_938871_-	amino acid permease	NA	NA	NA	NA	NA
WP_040531218.1|939158_940673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717127.1|940749_942525_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_152378505.1|942642_943773_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
>prophage 6
NZ_CP045240	Lactobacillus vaginalis strain LV515 chromosome, complete genome	1894710	999853	1044528	1894710	transposase	unidentified_phage(35.29%)	45	NA	NA
WP_152378517.1|999853_1000762_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	34.5	2.8e-23
WP_003717180.1|1000830_1001226_-	antitoxin HicB	NA	NA	NA	NA	NA
WP_003717181.1|1001259_1002111_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.2	6.6e-35
WP_152378519.1|1002138_1002630_-	DUF1829 domain-containing protein	NA	Q6SEA4	Lactobacillus_prophage	38.0	2.2e-14
WP_050754883.1|1002718_1003399_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	39.9	6.2e-36
WP_056974665.1|1003459_1004875_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_082611517.1|1004994_1005312_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_040531308.1|1005308_1005563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717185.1|1005916_1006354_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003717186.1|1006356_1007370_+	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	28.7	1.8e-15
WP_003717187.1|1007535_1008333_-	Abi family protein	NA	NA	NA	NA	NA
WP_003717188.1|1008336_1008549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717189.1|1008746_1009058_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003717190.1|1009070_1010162_-	NAD(P)-dependent alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.6	1.4e-21
WP_003717191.1|1010536_1010962_-	hypothetical protein	NA	A0A2D1GPE1	Lactobacillus_phage	39.0	1.2e-16
WP_003717192.1|1010963_1011191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040531313.1|1011194_1011737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717194.1|1011883_1015405_-	SNF2 helicase associated domain protein	NA	E5ESE1	Bathycoccus_sp._RCC1105_virus	28.9	2.7e-42
WP_152378505.1|1016109_1017240_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_152378505.1|1019660_1020791_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_003717201.1|1021251_1022229_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_152378505.1|1022400_1023531_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_152378520.1|1023523_1024285_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_152378505.1|1024290_1025421_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_003717951.1|1025967_1027065_-	EpsG family protein	NA	NA	NA	NA	NA
WP_152378521.1|1027073_1027748_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_152378517.1|1027704_1028613_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	34.5	2.8e-23
WP_056974670.1|1028549_1029149_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152378522.1|1029292_1029625_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.3	4.5e-08
WP_056974657.1|1029869_1030388_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_056974655.1|1030567_1030981_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_152378523.1|1030981_1031605_-	sugar transferase	NA	NA	NA	NA	NA
WP_152378505.1|1031644_1032775_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_003717481.1|1032962_1033895_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	34.7	2.5e-43
WP_003717480.1|1033930_1034704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717479.1|1034717_1035479_-	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_003717478.1|1035492_1036311_-	exopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_040531476.1|1036556_1037552_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003717476.1|1037940_1038345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717475.1|1038446_1039166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717474.1|1039382_1039955_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003717473.1|1039973_1040216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081446191.1|1040479_1041454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152378524.1|1042548_1043358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152378505.1|1043397_1044528_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
>prophage 7
NZ_CP045240	Lactobacillus vaginalis strain LV515 chromosome, complete genome	1894710	1080134	1112100	1894710	terminase,tail,protease,head,portal,holin	Lactobacillus_phage(47.06%)	35	NA	NA
WP_003717434.1|1080134_1080842_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003717433.1|1080924_1081752_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	63.7	1.1e-100
WP_040531457.1|1081765_1082086_-	DNA-binding protein	NA	A0A2R3ZXQ3	Staphylococcus_phage	38.4	1.4e-14
WP_040531455.1|1082151_1083174_-	serine hydrolase	NA	NA	NA	NA	NA
WP_152378525.1|1083701_1084070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152378526.1|1084069_1084297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717429.1|1084455_1084986_-	collagen-like protein	NA	A0A059PAH9	Leuconostoc_phage	45.5	6.8e-06
WP_003717428.1|1084985_1085606_-	hypothetical protein	NA	F8J1C9	Lactobacillus_phage	33.7	1.7e-08
WP_003717427.1|1085606_1086701_-	lysozyme	NA	A0A0M7RDM5	Lactobacillus_phage	55.0	3.1e-61
WP_081446190.1|1086681_1087185_-	hypothetical protein	NA	A0A0A1ELI5	Lactobacillus_phage	41.8	1.3e-14
WP_003717425.1|1087141_1087561_-|holin	phage holin family protein	holin	A0A1P8VVQ3	Streptococcus_phage	44.0	4.7e-18
WP_003717424.1|1087683_1087827_-	XkdX family protein	NA	NA	NA	NA	NA
WP_003717423.1|1087826_1088393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717422.1|1088409_1088853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040531451.1|1088865_1089738_-	DUF2479 domain-containing protein	NA	NA	NA	NA	NA
WP_040531448.1|1089750_1090743_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_040531446.1|1090756_1091269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717418.1|1091286_1092885_-	hypothetical protein	NA	A0A2D2W3A0	Escherichia_phage	26.6	9.2e-22
WP_081446189.1|1092884_1094270_-	hypothetical protein	NA	A0A0A1ERA5	Lactobacillus_phage	67.3	4.7e-83
WP_056974553.1|1094281_1096477_-	peptidoglycan DD-metalloendopeptidase family protein	NA	E9LUJ4	Lactobacillus_phage	36.3	3.8e-111
WP_040531444.1|1096473_1097445_-|tail	phage tail family protein	tail	A0A2H4JBE0	uncultured_Caudovirales_phage	27.8	5.6e-06
WP_003717413.1|1097456_1101494_-	tape measure protein	NA	A0A0M9JJ59	Lactobacillus_phage	29.4	9.1e-26
WP_152378527.1|1101486_1101843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717411.1|1101875_1102361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717410.1|1102445_1103135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717409.1|1103166_1103562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717408.1|1103561_1104083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152378528.1|1104069_1104414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152378563.1|1104401_1104686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717405.1|1104942_1105962_-	hypothetical protein	NA	O03966	Lactobacillus_phage	49.6	2.6e-78
WP_003717404.1|1105975_1106638_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_003717403.1|1106721_1107666_-|head	head morphogenesis protein	head	A0A2P1JTW9	Anoxybacillus_phage	31.8	2.7e-05
WP_003717402.1|1107652_1109401_-|portal	phage portal protein	portal	D2IZF6	Enterococcus_phage	35.1	9.0e-71
WP_003717399.1|1110740_1111469_-	HNH endonuclease family prophage LambdaSa2	NA	L0P6F5	Lactobacillus_phage	42.9	4.3e-35
WP_003717398.1|1111578_1112100_-|terminase	terminase small subunit	terminase	A0A097BYC9	Leuconostoc_phage	52.3	1.0e-30
>prophage 8
NZ_CP045240	Lactobacillus vaginalis strain LV515 chromosome, complete genome	1894710	1117443	1127109	1894710	integrase	Lactobacillus_phage(66.67%)	19	1121298:1121311	1127751:1127764
WP_152378564.1|1117443_1118112_-	hypothetical protein	NA	Q6R839	Staphylococcus_virus	38.6	8.6e-14
WP_040531429.1|1118272_1118947_-	phage protein	NA	U5U4M2	Lactobacillus_phage	48.6	5.9e-55
WP_081446188.1|1118952_1119609_-	ERF family protein	NA	A0A1S5SAA3	Streptococcus_phage	51.5	1.5e-34
WP_003717382.1|1119611_1120175_-	hypothetical protein	NA	D2KRE1	Lactobacillus_phage	34.1	2.1e-21
WP_003717380.1|1120316_1120511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717379.1|1120542_1120722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717378.1|1120775_1121309_+	hypothetical protein	NA	NA	NA	NA	NA
1121298:1121311	attL	CAAAGTAAATAATT	NA	NA	NA	NA
WP_003717377.1|1121467_1121725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717376.1|1121808_1122036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152378531.1|1122016_1122316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050754867.1|1122323_1122623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717373.1|1122627_1122837_-	hypothetical protein	NA	A0A1B0YC38	Lactobacillus_phage	39.4	1.7e-05
WP_003717372.1|1123085_1123391_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	41.0	6.6e-14
WP_003717371.1|1123392_1123794_+	hypothetical protein	NA	E9LUL3	Lactobacillus_phage	54.1	4.8e-36
WP_003717370.1|1123806_1124019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040531425.1|1124052_1124517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003717368.1|1124544_1125384_+	DUF4393 domain-containing protein	NA	E9LUL1	Lactobacillus_phage	26.3	1.0e-19
WP_003717367.1|1125658_1125976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003717366.1|1125978_1127109_+|integrase	site-specific integrase	integrase	A9D9I9	Lactobacillus_prophage	32.6	2.4e-48
1127751:1127764	attR	CAAAGTAAATAATT	NA	NA	NA	NA
>prophage 9
NZ_CP045240	Lactobacillus vaginalis strain LV515 chromosome, complete genome	1894710	1226336	1305605	1894710	terminase,tail,transposase,protease,head,portal,tRNA,capsid,integrase	Lactobacillus_phage(58.33%)	90	1250638:1250655	1313144:1313161
WP_152378505.1|1226336_1227467_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_003717260.1|1227681_1228071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717259.1|1228081_1228738_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_040531375.1|1228746_1229949_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003717257.1|1229941_1230679_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.8	1.0e-23
WP_003717256.1|1230807_1231245_+	HIT family protein	NA	D7NW73	Streptomyces_phage	31.6	4.3e-06
WP_124031579.1|1231180_1231450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003717254.1|1231519_1232452_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003717253.1|1232558_1235027_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_003717252.1|1235016_1236222_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_003717251.1|1236316_1236691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717249.1|1239075_1240776_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.0	3.3e-70
WP_040531373.1|1241165_1241993_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_003717247.1|1241992_1242925_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_003717246.1|1243867_1244185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717245.1|1244325_1244667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040531370.1|1244640_1245243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717243.1|1245249_1245645_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_040531367.1|1245710_1246688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717892.1|1247305_1248418_-	LysM peptidoglycan-binding domain-containing protein	NA	U3PJ04	Lactobacillus_phage	44.6	1.0e-40
WP_040531902.1|1248420_1248858_-	hypothetical protein	NA	A0A0A1ELI5	Lactobacillus_phage	49.6	3.7e-18
WP_003717890.1|1248844_1249168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152378566.1|1249278_1249416_-	XkdX family protein	NA	NA	NA	NA	NA
WP_003717888.1|1249421_1249796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717887.1|1249813_1250239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152378567.1|1250245_1250608_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
1250638:1250655	attL	TTACTTGATACTGCTTAT	NA	NA	NA	NA
WP_003717885.1|1250710_1251220_-|tail	tail protein	tail	I4DSJ1	Enterococcus_phage	38.6	1.1e-08
WP_152378568.1|1251223_1252588_-	DUF2479 domain-containing protein	NA	NA	NA	NA	NA
WP_152378569.1|1252807_1253047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717881.1|1253048_1254890_-	glycoside hydrolase	NA	E9LUJ4	Lactobacillus_phage	23.4	1.3e-43
WP_003717880.1|1254889_1255735_-|tail	phage tail family protein	tail	E9LUJ3	Lactobacillus_phage	39.6	9.1e-45
WP_003717879.1|1255741_1259548_-	tape measure protein	NA	A0A0M9JJ59	Lactobacillus_phage	75.0	0.0e+00
WP_003717877.1|1259778_1260189_-	hypothetical protein	NA	A0A0M7REI9	Lactobacillus_phage	90.4	6.8e-62
WP_003717876.1|1260276_1260984_-|tail	tail protein	tail	A0A0M7RF39	Lactobacillus_phage	92.2	3.1e-123
WP_003717875.1|1260987_1261377_-	DUF806 family protein	NA	A0A0M7RE53	Lactobacillus_phage	95.3	7.3e-66
WP_056974590.1|1261373_1261811_-	hypothetical protein	NA	A0A0M7RDL2	Lactobacillus_phage	93.8	5.0e-71
WP_152378534.1|1261803_1262172_-|head	phage head closure protein	head	A0A0M7RFE1	Lactobacillus_phage	90.1	3.8e-56
WP_003717872.1|1262149_1262470_-	hypothetical protein	NA	A0A0M7RDR5	Lactobacillus_phage	94.9	8.4e-44
WP_081446200.1|1262489_1264397_-|capsid	phage major capsid protein	capsid	A0A0M7RF71	Lactobacillus_phage	85.2	1.7e-272
WP_003717870.1|1264371_1265565_-|portal	phage portal protein	portal	A0A0M9JJ63	Lactobacillus_phage	94.9	1.2e-212
WP_003717868.1|1265741_1267682_-|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	96.0	0.0e+00
WP_003717867.1|1267656_1268196_-|terminase	phage terminase small subunit P27 family	terminase	A0A0M7REI3	Lactobacillus_phage	92.2	6.8e-86
WP_003717866.1|1268427_1268931_-	hypothetical protein	NA	B8R694	Lactobacillus_phage	40.9	8.7e-27
WP_003717865.1|1268947_1269229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717863.1|1269496_1269685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152378570.1|1269730_1270273_-	hypothetical protein	NA	A0A090DC14	Clostridium_phage	27.0	1.1e-06
WP_040531871.1|1270817_1271243_-	phage-encoded transcriptional regulator	NA	NA	NA	NA	NA
WP_056974670.1|1271475_1272075_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152378517.1|1272011_1272920_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	34.5	2.8e-23
WP_003717925.1|1273718_1273913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717923.1|1274085_1274550_-	class I SAM-dependent methyltransferase	NA	A0A059T693	Listeria_phage	54.2	1.5e-46
WP_040531867.1|1274536_1274866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717920.1|1275041_1275260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717917.1|1275560_1275797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717916.1|1275793_1276153_-	VRR-NUC domain-containing protein	NA	A0A0A1ENT6	Lactobacillus_phage	66.4	6.8e-42
WP_152378535.1|1276472_1276655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717912.1|1276670_1277099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040531860.1|1277373_1279695_-	DNA primase	NA	Q9T1H6	Lactobacillus_phage	56.6	7.8e-256
WP_003717910.1|1279768_1280299_-	DUF669 domain-containing protein	NA	Q9T0Y2	Lactobacillus_phage	49.4	4.5e-42
WP_003717909.1|1280317_1280896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717908.1|1280892_1282248_-	DEAD/DEAH box helicase	NA	A0A0P0ID30	Lactobacillus_phage	56.7	1.4e-151
WP_003717907.1|1282240_1282921_-	AAA family ATPase	NA	A0A286QSE8	Streptococcus_phage	57.3	7.0e-72
WP_003717906.1|1282920_1283199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717904.1|1283339_1283543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717903.1|1283568_1283760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717902.1|1283825_1284281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003717901.1|1284530_1284863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717900.1|1284924_1285149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003717899.1|1285280_1285484_-	hypothetical protein	NA	M1IFE9	Streptococcus_phage	46.0	2.5e-09
WP_003717898.1|1285806_1286229_+	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	50.7	5.4e-30
WP_003717897.1|1286243_1286675_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M4RD70	Bacillus_phage	37.7	1.0e-12
WP_003717896.1|1286737_1287052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003717895.1|1287068_1287542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040531856.1|1287560_1288022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003717893.1|1288206_1289301_+|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	62.9	2.3e-125
WP_040531364.1|1289590_1289875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050754865.1|1290288_1290963_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_040531362.1|1290959_1291187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717239.1|1291241_1291850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717238.1|1292062_1292698_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	44.1	5.8e-44
WP_152378536.1|1292783_1293638_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_040531360.1|1293870_1295169_+	MFS transporter	NA	NA	NA	NA	NA
WP_003717235.1|1295312_1296368_-	glycoside hydrolase family 73 protein	NA	A0A249Y0X5	Enterococcus_phage	34.0	4.2e-15
WP_003717234.1|1296534_1297923_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003717233.1|1298101_1298599_-	universal stress protein	NA	NA	NA	NA	NA
WP_040531358.1|1298661_1300062_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_003717231.1|1300156_1301014_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_081446192.1|1301093_1302686_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_003717229.1|1302818_1303082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040531356.1|1303184_1305605_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.0	0.0e+00
1313144:1313161	attR	TTACTTGATACTGCTTAT	NA	NA	NA	NA
>prophage 10
NZ_CP045240	Lactobacillus vaginalis strain LV515 chromosome, complete genome	1894710	1324172	1399509	1894710	transposase,protease	unidentified_phage(20.0%)	55	NA	NA
WP_152378517.1|1324172_1325081_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	34.5	2.8e-23
WP_056974670.1|1325017_1325617_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_152378537.1|1326536_1327232_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A096XT26	Enterococcus_phage	37.6	1.2e-13
WP_003717207.1|1327587_1328589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003717206.1|1328601_1329189_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	55.5	3.5e-51
WP_003717205.1|1329200_1331435_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.7	1.3e-247
WP_003717204.1|1331784_1334394_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_003717203.1|1334400_1334766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040531337.1|1334930_1335479_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003716813.1|1341847_1342096_-	YkuJ family protein	NA	NA	NA	NA	NA
WP_003716812.1|1342253_1343273_-	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_003716811.1|1343272_1344298_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_040530885.1|1344301_1345519_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003716809.1|1345676_1347407_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.1	2.5e-17
WP_003716808.1|1347406_1347673_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_003716807.1|1347790_1347976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040530883.1|1348208_1350413_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.5	2.2e-119
WP_003716805.1|1350564_1351287_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003716804.1|1351276_1352062_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	33.6	2.7e-27
WP_040530881.1|1352336_1353044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040530878.1|1353036_1353906_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	8.0e-20
WP_003716801.1|1353886_1354270_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152378505.1|1354501_1355632_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_040530875.1|1355927_1357046_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_040530873.1|1360441_1361089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003716796.1|1361119_1362043_-	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	34.3	9.9e-45
WP_003716795.1|1362057_1362348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152378505.1|1362765_1363896_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_040530869.1|1364212_1364746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003716793.1|1364834_1365347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003716792.1|1365428_1366637_-	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_003716791.1|1366747_1368892_-	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_003716790.1|1369064_1370543_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003716789.1|1370593_1371571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040530864.1|1371698_1372199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003716787.1|1372257_1373562_-	hypothetical protein	NA	A0A1V0DZX6	Clostridioides_phage	35.4	4.6e-11
WP_003716786.1|1373770_1375777_-	surface protein C	NA	NA	NA	NA	NA
WP_003716785.1|1375891_1378510_-	hypothetical protein	NA	L0P533	Streptococcus_phage	42.0	4.5e-18
WP_003716784.1|1378672_1379422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003716783.1|1379543_1380518_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003716782.1|1380530_1382108_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	24.3	2.4e-30
WP_003716781.1|1382208_1383906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152378571.1|1385033_1386002_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	38.2	1.1e-54
WP_152378538.1|1386016_1386499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152378505.1|1386538_1387669_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_152378539.1|1387661_1388819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152378540.1|1388799_1389696_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_152378505.1|1389647_1390778_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
WP_152378541.1|1390830_1391214_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_003716774.1|1391210_1392701_-	carnitine transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	1.7e-06
WP_003716773.1|1392705_1393419_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_003716772.1|1393420_1395157_-	phosphotransferase	NA	NA	NA	NA	NA
WP_152378542.1|1395616_1397032_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_050754883.1|1397092_1397773_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	39.9	6.2e-36
WP_152378517.1|1398600_1399509_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	34.5	2.8e-23
>prophage 11
NZ_CP045240	Lactobacillus vaginalis strain LV515 chromosome, complete genome	1894710	1438407	1481259	1894710	transposase,integrase,terminase,tRNA	Erysipelothrix_phage(40.91%)	41	1458757:1458816	1460874:1461458
WP_040530849.1|1438407_1438896_-|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_040530846.1|1439002_1439398_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_050754848.1|1439479_1439674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152378545.1|1439673_1439895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152378546.1|1439934_1441065_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.1	2.5e-37
WP_152378547.1|1441170_1442691_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	47.6	2.8e-121
WP_003716728.1|1442711_1443386_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_003716727.1|1443444_1444032_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_040530840.1|1444057_1444693_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_152378548.1|1444712_1445294_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_003716724.1|1445253_1445487_-	copper-binding protein	NA	NA	NA	NA	NA
WP_003716721.1|1449283_1449856_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	42.1	3.5e-32
WP_003716720.1|1449839_1451270_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	41.8	2.3e-96
WP_040530834.1|1451374_1452091_-	NUDIX hydrolase	NA	A0A0E3JJF3	Streptomyces_phage	31.2	1.3e-07
WP_152378517.1|1452639_1453548_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	34.5	2.8e-23
WP_056974670.1|1453484_1454084_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003716718.1|1454567_1455578_-	Abi family protein	NA	NA	NA	NA	NA
WP_003716717.1|1455606_1458723_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.5e-68
1458757:1458816	attL	TAAATGCTAATTTAGCCGCCTAAAAGTAATAATTTAAAAATGCTAATCTTAGTTTTTGAA	NA	NA	NA	NA
WP_152378549.1|1458775_1459855_-	hypothetical protein	NA	E3T4D5	Cafeteria_roenbergensis_virus	25.4	1.9e-07
WP_003717945.1|1459851_1460820_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	28.9	3.7e-34
WP_152378550.1|1460892_1461924_-	hypothetical protein	NA	NA	NA	NA	NA
1460874:1461458	attR	TAAATGCTAATTTAGCCGCCTAAAAGTAATAATTTAAAAATGCTAATCTTAGTTTTTGAAGCGAATTATTCTCTATTTTATTATTACTCATACAATCTTCAATCCGTTTGGTATTATTTTTAAACTGTTCAATAATAAATCTATCAGTGGGAATCTTTAATTTTAATTGCTTAAGATTATTTATAGTCAGTTGTGGCTGTGCTGAACCGGTTACAAACTGCGAAGGCTTACTACTTTTAATAAGTTCATAAGTGAATGATAAACCCAAACCAGTTTTATCTATTAAGTACAATAAGTTGTTTGTTAAAAATGCTTCTTCCTCATCAATATAACTAACGAATCCTGCCCCAGATCCACGGCTCGTTATTGTAACAGTTGCCTTATTAACTAAGGGCTTTCTTTCTGTATATCCCATAAAACCTTTTGCACCAAAAACTTTAGTGCCTGTTCTTAACAATTGTGATTTGGGTAACGTCTTGCCATATTTAATGCTATACAATTCTTTTATACTAATCGTTTTAAGAGCCGACTGTGCTATTAGCTGTTTATATAGAATATGTCTTAGTTCTTGTAAATTAGCATTTA	NA	NA	NA	NA
WP_040530831.1|1461913_1463446_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	31.0	1.6e-52
WP_003716714.1|1463448_1463655_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	68.7	7.9e-19
WP_040530828.1|1463795_1464680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003716712.1|1465101_1465560_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003716711.1|1465642_1465846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003716710.1|1465829_1466147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003716709.1|1466143_1467283_+	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	52.8	1.7e-110
WP_003716708.1|1467260_1467836_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	73.9	2.2e-74
WP_003716707.1|1467891_1469826_+	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	56.9	4.3e-223
WP_003716706.1|1469892_1470297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056974633.1|1470299_1472555_+	DNA primase	NA	A0A1X9I6B6	Streptococcus_phage	48.4	2.1e-213
WP_003716703.1|1472768_1473050_+	VRR-NUC domain-containing protein	NA	A0A1B0RXC4	Streptococcus_phage	52.2	2.2e-19
WP_003716702.1|1473030_1474386_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	65.7	5.6e-153
WP_003716701.1|1474382_1474850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040530823.1|1474997_1475375_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	56.4	6.7e-32
WP_003716699.1|1475494_1476037_+|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	58.8	2.3e-57
WP_003716698.1|1476036_1477290_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	64.4	9.4e-155
WP_050754883.1|1477477_1478158_-	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	39.9	6.2e-36
WP_152378512.1|1478218_1479634_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_152378505.1|1480128_1481259_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	31.9	2.1e-36
