The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	151529	211206	4596548	protease,transposase,tail	Escherichia_phage(15.38%)	50	NA	NA
WP_002210082.1|151529_152975_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002210083.1|153177_156036_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210084.1|156060_158892_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210086.1|159092_159452_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_002210087.1|159448_159850_-	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	61.0	3.6e-36
WP_002214300.1|159862_160165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210089.1|160298_164789_-	toxin	NA	NA	NA	NA	NA
WP_001297096.1|164957_165737_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|165736_166759_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_152329110.1|166772_170399_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002210090.1|170439_172941_-	toxin	NA	NA	NA	NA	NA
WP_002214297.1|173176_174043_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210092.1|174303_175215_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002210093.1|175517_175721_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002210094.1|175728_176664_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210095.1|176665_178621_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002214288.1|180550_181024_+	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210098.1|181028_181310_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002210099.1|181421_181970_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210100.1|182150_183491_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011055205.1|183739_184384_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210102.1|184591_184978_+	cytochrome b562	NA	NA	NA	NA	NA
WP_002210103.1|185217_185628_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210104.1|185980_187648_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002215779.1|187742_189158_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210106.1|189568_190522_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002210107.1|190755_191232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210109.1|191530_191917_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210110.1|192054_192519_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210111.1|192530_193466_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210112.1|193803_194076_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210113.1|194072_194927_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002213952.1|195232_195715_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210115.1|196143_197577_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002210116.1|197638_198364_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210117.1|198370_198916_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002218352.1|198899_199463_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002228203.1|199459_200023_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002210119.1|200271_201258_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002210120.1|201368_202343_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210121.1|202607_203426_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210122.1|203643_204426_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210123.1|204430_204988_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210124.1|205000_205624_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210125.1|205659_205962_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210126.1|206108_206363_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210127.1|206500_207763_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210128.1|207943_209032_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002213775.1|209257_209716_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002218066.1|209832_211206_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
>prophage 2
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	390777	458205	4596548	transposase	Escherichia_phage(31.58%)	52	NA	NA
WP_000255944.1|390777_391800_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|391799_392579_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211540.1|392617_392953_+	deoxyribonuclease	NA	NA	NA	NA	NA
WP_002211541.1|392967_393990_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_002211542.1|394099_394588_-	transcription/translation regulatory transformer protein RfaH	NA	NA	NA	NA	NA
WP_002215917.1|394835_396332_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_002215918.1|396386_397088_+	NAD(P)H-flavin reductase	NA	NA	NA	NA	NA
WP_002211545.1|397247_398411_-	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
WP_002211546.1|398422_400612_-	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
WP_002211547.1|400938_402270_+	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_002213759.1|402582_403041_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002211550.1|403629_405081_+	Trk system potassium transporter TrkH	NA	NA	NA	NA	NA
WP_002215920.1|405102_405636_+	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_002218887.1|405919_406105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161992928.1|408400_408562_-	hypothetical protein	NA	A0A140XBD7	Dickeya_phage	88.7	2.3e-21
WP_002212288.1|411772_412810_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_002212289.1|412806_413766_+	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_002212290.1|413800_414751_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.2	8.7e-28
WP_002217850.1|414961_415513_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255944.1|415602_416625_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|416624_417404_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210669.1|418460_419645_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
WP_002210670.1|419895_420279_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002210671.1|420280_420826_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
WP_002210672.1|421016_421445_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002210673.1|421448_422153_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002210674.1|422517_423015_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002210675.1|423081_423450_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002210676.1|423792_427821_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
WP_002210677.1|427949_432170_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
WP_002213775.1|432296_432755_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002210678.1|433186_434317_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002228257.1|434309_435125_-	thiazole synthase	NA	NA	NA	NA	NA
WP_002217275.1|435126_435342_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_002210680.1|435338_436136_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.8	1.6e-11
WP_002210681.1|436125_436800_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_002210682.1|436786_438832_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_002210683.1|439207_439717_-	sigma D regulator	NA	NA	NA	NA	NA
WP_002210684.1|439813_440596_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_002210685.1|440688_441474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210686.1|441592_442660_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_002210687.1|442689_443430_+	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_002210688.1|443475_444066_+	YjaG family protein	NA	NA	NA	NA	NA
WP_002210689.1|444254_444530_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
WP_002355296.1|444579_445233_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210691.1|445380_446667_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002210692.1|446726_448316_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.2e-68
WP_002218887.1|448783_448969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161992928.1|451264_451426_-	hypothetical protein	NA	A0A140XBD7	Dickeya_phage	88.7	2.3e-21
WP_086016626.1|454639_455738_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	2.2e-46
WP_001297096.1|456403_457183_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|457182_458205_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 3
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	1114070	1168825	4596548	tRNA,transposase,integrase,protease	uncultured_virus(16.67%)	54	1109408:1109426	1185405:1185423
1109408:1109426	attL	TAAAGGCGATAACTTTACC	NA	NA	NA	NA
WP_002208581.1|1114070_1114550_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_002208580.1|1114813_1115623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002223301.1|1116143_1119029_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.8	1.0e-111
WP_002208578.1|1119235_1119655_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_002208577.1|1119763_1120213_-	NfeD family protein	NA	NA	NA	NA	NA
WP_002208576.1|1120215_1121130_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_002208575.1|1121324_1122194_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_002208574.1|1122270_1123047_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002208573.1|1123433_1124069_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_002208572.1|1124039_1124726_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.6e-31
WP_002208571.1|1124722_1127152_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002208570.1|1127195_1128260_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002208569.1|1128256_1128781_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_002208568.1|1129076_1129799_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_002208567.1|1129809_1130304_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_002222677.1|1130514_1131900_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.5	2.2e-40
WP_002213775.1|1132246_1132705_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002209775.1|1132851_1133064_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_002209774.1|1133078_1133945_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
WP_002215270.1|1134299_1134482_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_002215268.1|1134740_1134941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228356.1|1135054_1135552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215266.1|1135687_1136026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079866998.1|1136108_1136387_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	73.5	4.2e-31
WP_002354559.1|1136598_1136805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209770.1|1137204_1137807_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_002209769.1|1137799_1138729_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002209768.1|1138738_1139371_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002209767.1|1139367_1141131_+	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002209766.1|1141123_1142443_+	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_002209765.1|1142424_1142826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215253.1|1142922_1143228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|1143594_1144374_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1144373_1145396_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002209764.1|1145489_1146383_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209763.1|1146437_1147427_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002209762.1|1147452_1148304_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	1.2e-49
WP_002209759.1|1148776_1150405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209758.1|1150483_1152865_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002209757.1|1153023_1153554_-	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_002209756.1|1153546_1155754_-	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|1156205_1157414_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209753.1|1157815_1158397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224869.1|1158685_1158808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209752.1|1158931_1160848_-	autotransporter adhesin YapC	NA	NA	NA	NA	NA
WP_002209751.1|1161656_1161896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002227852.1|1161934_1162186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209749.1|1162209_1162782_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002209748.1|1162793_1163195_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_002209746.1|1163427_1163829_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_002216002.1|1164096_1164678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209745.1|1165350_1165596_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	7.2e-19
WP_138921619.1|1165808_1168121_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_002213775.1|1168366_1168825_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
1185405:1185423	attR	TAAAGGCGATAACTTTACC	NA	NA	NA	NA
>prophage 4
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	1533473	1597307	4596548	transposase,tRNA,plate	Escherichia_phage(41.18%)	54	NA	NA
WP_000255944.1|1533473_1534496_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|1534495_1535275_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213775.1|1535403_1535862_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002208491.1|1536004_1536514_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002208490.1|1536562_1538290_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.3	3.0e-18
WP_002208488.1|1538338_1538596_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002222180.1|1539094_1540063_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.8	4.8e-74
WP_002213487.1|1540219_1540954_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002227089.1|1541202_1542189_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_002213368.1|1542279_1544292_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.2	1.7e-142
WP_002213369.1|1544311_1544527_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_002213372.1|1544627_1544975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213374.1|1545106_1545712_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_002213775.1|1546272_1546731_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002222185.1|1546923_1548339_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002211622.1|1549572_1550757_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_002211621.1|1551207_1552437_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_002354622.1|1552529_1552844_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002232425.1|1553113_1554103_-	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_002211617.1|1554238_1555117_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211616.1|1555219_1555696_+	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_002211615.1|1555876_1556848_+	glucokinase	NA	NA	NA	NA	NA
WP_002211614.1|1556925_1558173_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_002211613.1|1558438_1559674_+	alanine transaminase	NA	NA	NA	NA	NA
WP_002211611.1|1559937_1560462_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.1	9.3e-24
WP_002211610.1|1560556_1560988_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	2.4e-25
WP_002215847.1|1561577_1562249_+	lipoprotein	NA	NA	NA	NA	NA
WP_002215846.1|1562275_1562632_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_002211607.1|1562628_1563285_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_002211606.1|1563530_1564100_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_002228419.1|1564096_1564693_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	49.2	9.2e-44
WP_002211604.1|1565174_1565951_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	41.4	3.9e-42
WP_002211603.1|1565952_1566570_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	1.1e-87
WP_002228420.1|1566581_1569008_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.3	6.9e-255
WP_002211601.1|1569838_1570687_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_002354621.1|1570916_1571396_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211599.1|1571862_1572387_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_002211598.1|1572459_1573509_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-21
WP_002215840.1|1573505_1575092_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002211596.1|1575147_1576167_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211590.1|1578856_1579459_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002215321.1|1579816_1580299_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_002211588.1|1580295_1581978_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002224806.1|1581978_1582680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211586.1|1582676_1584014_-	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	32.8	2.0e-70
WP_002215319.1|1584053_1585085_-	fimbrial protein	NA	NA	NA	NA	NA
WP_002211584.1|1585091_1586273_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002211583.1|1586371_1587397_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211582.1|1587396_1589277_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002215317.1|1590059_1592735_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211580.1|1592935_1593481_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211579.1|1593637_1594399_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002215157.1|1594526_1596077_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|1596098_1597307_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 5
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	1866282	1942494	4596548	tRNA,transposase,coat	Escherichia_phage(25.0%)	59	NA	NA
WP_002210913.1|1866282_1867398_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_002210912.1|1867584_1868031_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002218214.1|1868023_1868650_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_002210910.1|1868780_1870034_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
WP_002210909.1|1870179_1871223_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002210908.1|1871498_1871759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210907.1|1871878_1873459_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	50.7	2.5e-35
WP_002210906.1|1874378_1875236_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002227977.1|1875395_1875779_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002210903.1|1876310_1877636_+	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_002210902.1|1877937_1878141_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	44.6	9.8e-06
WP_002210901.1|1878443_1879343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210900.1|1879434_1879884_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_150064371.1|1880233_1880488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002214045.1|1880427_1880961_-	membrane protein	NA	NA	NA	NA	NA
WP_032465820.1|1881243_1882224_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001297096.1|1882315_1883095_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1883094_1884117_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002214048.1|1884619_1887802_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	62.3	0.0e+00
WP_002210893.1|1888342_1888555_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_071525649.1|1888646_1888961_+	protein DsrB	NA	NA	NA	NA	NA
WP_002210891.1|1892003_1892702_+	MgtC family protein	NA	G3MA03	Bacillus_virus	40.0	2.1e-15
WP_002210890.1|1893102_1895802_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.6	8.5e-44
WP_002210889.1|1897344_1897926_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_002210888.1|1898130_1899018_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_002210887.1|1899014_1900298_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_002210886.1|1900314_1902480_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_002210885.1|1902642_1903140_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_002210884.1|1903431_1904667_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210883.1|1904679_1905057_-	RidA family protein	NA	NA	NA	NA	NA
WP_002210882.1|1905053_1906040_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002210881.1|1906229_1906895_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_002224033.1|1907369_1911176_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_002210878.1|1911703_1914580_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_002214064.1|1914648_1915350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210876.1|1915590_1917264_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	1.5e-11
WP_002220817.1|1917447_1919058_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.4	2.3e-12
WP_002214065.1|1919230_1920103_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_002210874.1|1920102_1921152_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	6.1e-06
WP_002210873.1|1921252_1921642_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.3	1.3e-06
WP_002210872.1|1921651_1922296_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_002210870.1|1922866_1923631_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	27.2	1.9e-09
WP_002229223.1|1925623_1926142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210869.1|1926241_1927195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210868.1|1927813_1929043_-	alanine racemase	NA	NA	NA	NA	NA
WP_002210867.1|1929444_1929639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210865.1|1930203_1930452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210864.1|1930844_1932101_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_002210862.1|1932255_1932489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|1933075_1933855_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1933854_1934877_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215943.1|1935283_1935673_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_002210859.1|1935782_1936022_-	YebV family protein	NA	NA	NA	NA	NA
WP_002210858.1|1936229_1937219_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_002210857.1|1937424_1939872_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210856.1|1940042_1940795_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002216611.1|1940825_1941383_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|1941403_1941934_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210852.1|1941939_1942494_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 6
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	2069022	2138470	4596548	transposase,tRNA,protease	Escherichia_phage(31.25%)	59	NA	NA
WP_002213759.1|2069022_2069481_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002210974.1|2069645_2070674_-	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_002210975.1|2070918_2071584_+	phage shock protein PspA	NA	NA	NA	NA	NA
WP_002210976.1|2071745_2071973_+	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_002210977.1|2071972_2072332_+	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_002216375.1|2072416_2072659_+	phage shock protein PspD	NA	NA	NA	NA	NA
WP_002210979.1|2072639_2074037_+	YcjX family protein	NA	NA	NA	NA	NA
WP_002210980.1|2074033_2075095_+	TIGR01620 family protein	NA	NA	NA	NA	NA
WP_002210981.1|2075104_2075563_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_002210982.1|2075624_2076071_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_002210983.1|2076406_2077984_+	transcriptional regulator TyrR	NA	NA	NA	NA	NA
WP_000255944.1|2078342_2079365_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2079364_2080144_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_152329115.1|2080194_2080548_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.2	4.7e-11
WP_002210984.1|2080800_2081304_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_002210985.1|2081466_2082441_+	L-Ala-D/L-Glu epimerase	NA	NA	NA	NA	NA
WP_002220315.1|2082482_2083190_-	murein tripeptide amidase MpaA	NA	NA	NA	NA	NA
WP_002210987.1|2083630_2085247_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002227906.1|2085489_2086473_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_002210990.1|2086846_2087686_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002222427.1|2087997_2088966_-	alpha/beta hydrolase	NA	A0A2P1EM31	Moumouvirus	28.7	7.3e-14
WP_002210992.1|2089272_2090214_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	88.3	2.1e-130
WP_002210993.1|2090488_2094022_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_002210994.1|2094500_2094833_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_002210995.1|2094892_2095552_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	44.6	6.0e-20
WP_002227907.1|2095836_2096178_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_002214605.1|2096235_2096688_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_002210998.1|2096757_2097750_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	44.2	7.6e-67
WP_002210999.1|2098015_2100712_+	YdbH family protein	NA	NA	NA	NA	NA
WP_002211000.1|2100708_2100903_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_002211001.1|2100912_2101284_+	YdbL family protein	NA	NA	NA	NA	NA
WP_152329116.1|2101489_2102887_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	2.7e-46
WP_002211003.1|2103096_2104053_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002211004.1|2104173_2104779_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_002211005.1|2105201_2109089_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	31.4	4.0e-55
WP_002214609.1|2109427_2109757_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211007.1|2109753_2110077_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002211008.1|2110132_2110969_-|protease	serine protease	protease	NA	NA	NA	NA
WP_151421150.1|2111302_2111635_-	acid shock protein	NA	NA	NA	NA	NA
WP_002214618.1|2112959_2113118_+	invertase	NA	NA	NA	NA	NA
WP_001297096.1|2117309_2118089_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2118088_2119111_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002223614.1|2119650_2122326_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002210656.1|2123132_2123777_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_002218177.1|2124614_2126252_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_002210654.1|2126338_2127259_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_025470761.1|2127274_2128183_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_002210652.1|2128194_2129196_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.2e-14
WP_002210651.1|2129192_2130194_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	4.7e-24
WP_002210650.1|2130754_2130970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210649.1|2131268_2131592_-	YciU family protein	NA	NA	NA	NA	NA
WP_002210648.1|2131756_2133217_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_002388651.1|2133658_2133835_+	YciY family protein	NA	NA	NA	NA	NA
WP_002210646.1|2134263_2134803_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	42.4	2.1e-26
WP_002210644.1|2135023_2135287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002217646.1|2135402_2135648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210643.1|2135870_2136167_-	YciI family protein	NA	NA	NA	NA	NA
WP_002210642.1|2136467_2137226_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_002209743.1|2137261_2138470_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 7
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	2258483	2358008	4596548	transposase,tail,tRNA,lysis,integrase	Escherichia_phage(14.55%)	103	2306412:2306442	2347426:2347456
WP_002213759.1|2258483_2258942_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_000255944.1|2259052_2260075_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2260074_2260854_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210659.1|2261222_2261813_-	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	55.8	1.5e-54
WP_002223593.1|2262562_2262970_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002210664.1|2263404_2264751_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002210665.1|2265057_2266074_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210666.1|2267407_2267872_+	YchJ family protein	NA	NA	NA	NA	NA
WP_002210667.1|2267955_2268825_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	5.5e-13
WP_002209743.1|2268787_2269996_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211665.1|2270867_2271728_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211667.1|2272537_2273344_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211668.1|2273441_2273828_+	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211669.1|2273840_2274131_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211670.1|2274127_2276053_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211671.1|2276114_2277161_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002211673.1|2277385_2277937_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211674.1|2278099_2279950_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211675.1|2280066_2281083_+	asparaginase	NA	NA	NA	NA	NA
WP_002211676.1|2281097_2281745_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002217933.1|2281878_2282151_-	YeaC family protein	NA	NA	NA	NA	NA
WP_002211677.1|2282221_2282635_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002224141.1|2282982_2283978_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211679.1|2284291_2285167_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002430110.1|2285239_2285989_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211681.1|2286432_2288367_+	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002216501.1|2288516_2289791_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211683.1|2289898_2291017_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002211684.1|2291051_2291957_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211685.1|2292154_2293024_+	pirin family protein	NA	NA	NA	NA	NA
WP_002216508.1|2293288_2294491_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211686.1|2294506_2295811_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002211687.1|2296274_2297810_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211688.1|2298027_2298747_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211689.1|2298990_2300565_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002227934.1|2300800_2301331_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002214494.1|2301747_2302104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211692.1|2303195_2303936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211693.1|2303952_2305152_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002214492.1|2305155_2306328_+	MFS transporter	NA	NA	NA	NA	NA
2306412:2306442	attL	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002209743.1|2306632_2307841_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_097608205.1|2308061_2308430_-|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002211696.1|2308491_2309409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211697.1|2309425_2310424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|2310423_2313627_-	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002359202.1|2313802_2314024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|2314198_2314819_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002211701.1|2314874_2315090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214482.1|2315232_2315784_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211704.1|2315882_2316890_-	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002211705.1|2316963_2317131_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211706.1|2317254_2317686_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211707.1|2317764_2318397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_140269982.1|2318657_2319368_-	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.4	8.3e-108
WP_002211709.1|2319370_2320123_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002211710.1|2320296_2320638_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002211711.1|2320640_2324144_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_071530527.1|2324144_2324405_-	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	48.6	4.1e-12
WP_002211712.1|2324452_2324764_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_002211713.1|2324776_2325697_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211714.1|2325762_2326170_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211715.1|2326166_2326751_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211716.1|2326752_2327103_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211717.1|2327104_2327359_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211718.1|2327355_2327838_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211719.1|2327885_2329091_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211720.1|2329104_2329878_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211721.1|2329999_2331112_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002228446.1|2331112_2331754_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002228445.1|2331772_2332501_-	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002211722.1|2332500_2333475_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	81.1	2.3e-153
WP_002209743.1|2333479_2334688_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211723.1|2334735_2335320_-	hypothetical protein	NA	A0A0R6PHH0	Moraxella_phage	70.7	4.8e-69
WP_002211724.1|2335323_2335773_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211725.1|2335803_2336439_-	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211727.1|2336895_2337609_-	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211729.1|2338154_2338613_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211730.1|2338597_2339110_-	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002430108.1|2339140_2339338_-	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002215644.1|2339583_2339859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211731.1|2339855_2340065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|2340488_2341052_-	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002215638.1|2341100_2341319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215636.1|2341322_2341712_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002211735.1|2341712_2342318_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002211736.1|2342391_2342838_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_071525537.1|2342813_2343563_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002215632.1|2343862_2344123_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_001297096.1|2344290_2345070_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2345069_2346092_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211738.1|2346161_2347400_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_002211739.1|2347426_2347873_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
2347426:2347456	attR	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
WP_002211740.1|2347975_2348632_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002215627.1|2348702_2349788_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211743.1|2349928_2350201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220631.1|2350921_2351608_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211179.1|2351632_2352445_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002211180.1|2352448_2352718_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211181.1|2352954_2354076_-	ribonuclease D	NA	NA	NA	NA	NA
WP_002220632.1|2354235_2355924_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
WP_087768167.1|2356459_2356567_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002211183.1|2356567_2357173_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_002211184.1|2357309_2358008_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	2449191	2530496	4596548	transposase,plate,integrase	Escherichia_phage(26.67%)	60	2469447:2469506	2511658:2513611
WP_002209743.1|2449191_2450400_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211267.1|2450518_2452177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211268.1|2452346_2452811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211269.1|2452971_2454159_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002211270.1|2454155_2454740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214329.1|2454736_2455891_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002211271.1|2455890_2456853_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002211273.1|2456986_2458273_-	coenzyme F390 synthetase	NA	NA	NA	NA	NA
WP_002214335.1|2458269_2459076_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002211275.1|2459068_2460085_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002211277.1|2462109_2463714_+	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_002211278.1|2463891_2464464_-	HutD family protein	NA	NA	NA	NA	NA
WP_002232930.1|2464463_2465834_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_002211280.1|2465981_2466749_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_002211281.1|2466952_2468173_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_002211282.1|2468169_2468976_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
2469447:2469506	attL	TGTCAACGACGGATGAAAAGTGATCCACTTATATCTCCACCAACGGCCCAATATTGATCC	NA	NA	NA	NA
WP_001297096.1|2469512_2470292_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2470291_2471314_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002213971.1|2471401_2471932_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002212747.1|2472024_2472669_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002212750.1|2472744_2475309_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_162007333.1|2475396_2476668_+	fimbrial protein	NA	NA	NA	NA	NA
WP_002227954.1|2476664_2477405_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002212753.1|2477944_2479207_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.4e-73
WP_000703040.1|2479400_2480705_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286280.1|2480732_2482013_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_002212761.1|2482005_2483808_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.6	2.7e-22
WP_001327262.1|2483794_2485507_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.8e-31
WP_000140406.1|2485763_2486723_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_002212775.1|2486913_2493021_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
WP_002212777.1|2493108_2502600_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_000982866.1|2502596_2503697_+	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_002221885.1|2503759_2504497_+	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_001088826.1|2504500_2506078_+	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_002212885.1|2506208_2508230_+	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_002212886.1|2509595_2510030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000205185.1|2510169_2510355_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	42.1	5.6e-08
WP_000937857.1|2510543_2511125_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_001112403.1|2511114_2511324_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_100067905.1|2511527_2511680_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001297096.1|2511723_2512503_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2512502_2513525_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_161597818.1|2513968_2514163_-	hypothetical protein	NA	NA	NA	NA	NA
2511658:2513611	attR	TGTCAACGACGGATGAAAAGTGATCCACTTATATCTCCACCAACGGCCCAATATTGATCCACCGTTTTACTCAGGATTAGCTTCTGCTATAACCCCGGCCTTTCGTTTCTGTCTGAGTCGATAGCTTTCTCCTTTGATTTGAACGACATGTGAGTGGTGTAAGATACGGTCCAGCATCGCTGAGGTCAGTGCTGCATCACCGGCGAACGTTTGATCCCACTGCCCGAACGGCAGATTGGATGTCAGGATCATTGCGCTCTTTTCGTAACGTTTAGCGATGACCTGGAAGAACAGCTTTGCTTCTTCCTGACTGAACGGCAGATAGCCTATTTCATCAATGATGAGCAGGCGGGGGGCCATTACTCCACGCTGAAGCGTCGTTTTATAACGGCCCTGACGTTGTGCCGTAGATAACTGAAGTAACAGATCTGCTGCTGTTGTGAAGCGAACTTTGATACCTGCACGGACTGCTTCATAGCCCATCGCTATTGCCAGATGGGTTTTCCCCACACCTGATGGCCCCAGTAATACGATATTTTCATTACGTTCTATGAAGCTGAGTGAGCGTAACGACTGGAGTTGCTTCTGCGGTGCTCCGGTGGCGAATGTGAAGTCATACTCTTCGAACGTTTTCACCGCCGGGAAGGCTGCCATTCGGGTATACATCGCCTGTTTACGTTGATGACGTGCCAGTTTTTCTTCATGAAGCAGATGCTCCAGGAAGTCCATATAACTCCATTCCTGGTCTACTGCCTGTTGTGACAGCGCAGGCGCTGCGCTTATAAGGCTTTCCAGTTGCAACTGCCCGGCGAGCGCCATCAGTCGTTGATGTTGCAGTTCCATCATCACGCCACTCCTCTGCAGAATGAGTCGTAGATGGAGAGTGGATGATGCAGGGGGTGTTTGTCGAAGTTCACCAGATTTTCATCAAGATGCACGTCATACTCTTTTTTCTCCGGAGGCAGTGCCAGCATGGACTGCTGCTCTTCGAGCCAGCGATCGCAGGGACGGGCCTGGATTGTTTCATGCTTTCGTTGGTTAGCGACATCGTGCAGCCAGCGCAGACCGTGGCGGTTGGCTGTTTCAACATCGACAGTGATCCCCATCGGGCGCAGGCGAGTCATTAGTGGGATGTAAAAACTGTTACGGGTGTACTGCACCATCCGTTCCACCTTACCTTTAGTCTGTGCCCTGAAGGGGCGACACAGTCGGGGAGAGAAGCCCATCTCCTTGCCGAACTGCCACAGCGAAGGATGGAACCGGTGCTGACCGGTCTGATATGCGTCACGTTGCAGAACCACAGTTTTCATATTGTCATACAACACTTCGCGCGGCACACCACCAAAGAAGCGGAACGCATTACGATGGCAGGTCTCCAGCGTGTCATAACGCATATTGTCAGTGAATTCGATGTACAGCATTCGGCTGTATCCGAGAACAGCAACGAACACGTGAAGCGGTGAGCGACCATTACGCATAGTGCCCCAGTCAACCTGCATCTGTCGTCCGGGTTCAGTTTCGAACCGAACGGCAGGCTCCTGCTCCTGAGGAACCGAGAGAGAACGAATGAATGCCCTGAGAATGGTCATTCCGCCACGATATCCCTGGTCTCTGATCTCGCGAGCGATTACCGTTGCCGGGATTTTGTAAGGATGAGCATCGGCGATGCGTTGACGAATATAATCCCGGTATTCATCCAGGAGTGAAGCAACAGCAGGTCGCGGCGTATATTTTGGCGGCTCAGATTTTGCCTGCAAATAACGTTTAACGGTATTGCGGGAGATCCCCAGTTCTCTGGCAATCGCCCGGCTACTCATTCCCTGCTTGTGCAGGATTTTAATTTCCATAACTGTCTCAAAAGTGACCATAAACTCTCCTGAATCAGGAGAGCAGATTACCCCCTGGATCTGATTTCAGGCGTTGGGTGTGGATCACTATTGCACCGTTCGTTACA	NA	NA	NA	NA
WP_002213183.1|2514203_2514428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228531.1|2514437_2514779_-	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_002215425.1|2514664_2515555_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.1	6.7e-22
WP_002213186.1|2515579_2516407_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002213188.1|2516399_2517260_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002213190.1|2517326_2518595_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002213192.1|2518624_2519638_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002213201.1|2520299_2521097_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002215417.1|2522065_2522500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213205.1|2522511_2523081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213208.1|2524744_2525821_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_002213209.1|2525886_2526177_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	39.4	1.8e-05
WP_002213210.1|2526157_2526430_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_002213211.1|2526565_2526820_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	62.5	1.1e-17
WP_002213212.1|2526816_2527116_+	lysozyme	NA	A0A218M4K8	Erwinia_phage	64.9	2.6e-23
WP_002215413.1|2527132_2527420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086016636.1|2528983_2530496_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	2752841	2797357	4596548	tRNA,transposase,plate,lysis	Indivirus(12.5%)	35	NA	NA
WP_002211870.1|2752841_2754869_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
WP_002213775.1|2755032_2755491_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002228565.1|2755708_2756371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211975.1|2757068_2758145_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211974.1|2758162_2759416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211973.1|2759748_2760930_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211971.1|2761171_2761579_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002211970.1|2761575_2762271_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_002211969.1|2762596_2763481_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_002211968.1|2763836_2765534_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002211966.1|2765814_2766552_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_002211965.1|2766996_2768007_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_002211964.1|2768027_2769548_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.6e-10
WP_002211963.1|2769777_2770770_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002211961.1|2771517_2772684_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_002211960.1|2772738_2773401_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_002211959.1|2773584_2774736_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211958.1|2774871_2775741_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211957.1|2776014_2777154_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.9	5.2e-35
WP_002211956.1|2777174_2778017_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002227980.1|2778273_2778486_+	peptide antibiotic darobactin C	NA	NA	NA	NA	NA
WP_002215886.1|2778569_2780930_+	darobactin export ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002211952.1|2780931_2782194_+	darobactin export ABC transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002211951.1|2782195_2782864_+	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
WP_002211950.1|2782873_2784184_+	darobactin maturation radical SAM/SPASM protein DarE	NA	NA	NA	NA	NA
WP_002211949.1|2784718_2785993_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_002211948.1|2785994_2786765_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_002209743.1|2786900_2788109_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211947.1|2788152_2788806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|2789033_2790629_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211945.1|2791311_2791935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211943.1|2793536_2793989_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002214552.1|2793988_2794570_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211941.1|2794544_2795630_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211940.1|2795593_2797357_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 10
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	2822218	2888936	4596548	transposase,tRNA,plate,protease	Saccharomonospora_phage(23.08%)	56	NA	NA
WP_002211664.1|2822218_2823571_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002215896.1|2823582_2825127_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211662.1|2825169_2825670_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002213016.1|2826658_2827507_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002213017.1|2827605_2827854_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_002228570.1|2827891_2828332_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213024.1|2828418_2829207_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213025.1|2829209_2829962_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_002213026.1|2829963_2830683_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213028.1|2830675_2831914_-	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|2831929_2832667_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213032.1|2832668_2833952_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213034.1|2833941_2834466_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213036.1|2834729_2834948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213038.1|2835678_2836425_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213039.1|2836578_2838996_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213046.1|2842640_2842970_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213049.1|2843021_2843300_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002213052.1|2843393_2844584_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213054.1|2844644_2844962_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213056.1|2845070_2845487_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213058.1|2845802_2846483_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213060.1|2846661_2847126_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002221095.1|2847186_2849241_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.8	1.5e-16
WP_002213062.1|2849434_2849881_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002213063.1|2849910_2852049_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213064.1|2852150_2852786_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213065.1|2853014_2853521_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213066.1|2853878_2854940_+	porin OmpA	NA	NA	NA	NA	NA
WP_002213775.1|2855129_2855588_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002226586.1|2855756_2856212_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002224683.1|2856422_2858174_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002220006.1|2858242_2858761_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002211286.1|2859026_2859215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|2859848_2860871_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2860870_2861650_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213775.1|2862810_2863269_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002228015.1|2863466_2863634_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_002211289.1|2863903_2864482_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_002211290.1|2864478_2866131_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_002211291.1|2866117_2867404_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_002211292.1|2867532_2869446_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.5e-47
WP_002211293.1|2869451_2871572_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_002363919.1|2871674_2872784_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_002211295.1|2872809_2873361_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_002211296.1|2873543_2874554_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_002220013.1|2875171_2877787_-	aminopeptidase N	NA	NA	NA	NA	NA
WP_002228013.1|2878502_2879708_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002211301.1|2880206_2881607_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.2	6.5e-80
WP_002354007.1|2881907_2882987_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	56.5	3.2e-111
WP_002211303.1|2883243_2884434_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002430096.1|2884587_2884704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211304.1|2884857_2885505_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.3	2.2e-22
WP_002211305.1|2885565_2886114_-	YcbK family protein	NA	A0A0K1LLY2	Rhodobacter_phage	34.7	7.8e-05
WP_002217987.1|2886337_2888194_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002213759.1|2888477_2888936_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
>prophage 11
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	2942327	2951964	4596548	tRNA,transposase,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_002211344.1|2942327_2944052_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	3.3e-17
WP_002211346.1|2944270_2944981_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|2945146_2945365_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002213759.1|2945736_2946195_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002211348.1|2946487_2948764_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.7	7.4e-166
WP_002211349.1|2948789_2949110_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
WP_002211350.1|2949470_2949734_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	3.6e-16
WP_002211351.1|2950014_2951964_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	37.7	8.8e-35
>prophage 12
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	3061511	3119294	4596548	transposase,tail,plate,coat,protease	Pseudomonas_phage(19.23%)	51	NA	NA
WP_002213775.1|3061511_3061970_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002208835.1|3062170_3063175_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002208836.1|3063352_3063580_+	YejL family protein	NA	NA	NA	NA	NA
WP_002208837.1|3063607_3065404_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002230704.1|3065634_3066018_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_152329119.1|3066374_3067283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|3067309_3068332_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3068331_3069111_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002208840.1|3069494_3069983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208841.1|3070682_3071045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208842.1|3071170_3072607_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208843.1|3072897_3073638_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208845.1|3073935_3074715_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208846.1|3074811_3075159_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002215458.1|3075155_3075416_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208847.1|3075412_3076549_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002208848.1|3076552_3077008_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002215460.1|3077004_3077601_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208850.1|3077616_3078672_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002208852.1|3078668_3080075_-	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208853.1|3080341_3081835_-|coat	coat protein	coat	NA	NA	NA	NA
WP_002208854.1|3081955_3082255_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_002208855.1|3082256_3082625_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002208856.1|3082646_3084155_-|tail	tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
WP_002208857.1|3084151_3084346_-	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
WP_002208858.1|3084350_3084968_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_002208859.1|3085013_3085304_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
WP_002208860.1|3085934_3086729_-	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_002208861.1|3086704_3087517_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_002208862.1|3088225_3089530_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
WP_002215470.1|3089740_3090220_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_002208864.1|3090493_3091216_+	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_002208866.1|3091421_3091664_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
WP_002208867.1|3091835_3092771_+	omptin family outer membrane beta-barrel protein YcoA	NA	NA	NA	NA	NA
WP_002208868.1|3093192_3094980_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
WP_002208869.1|3095053_3096082_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002208870.1|3096458_3097985_+	MFS transporter	NA	NA	NA	NA	NA
WP_002228026.1|3098259_3099426_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_002213759.1|3100215_3100674_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002210826.1|3100875_3101991_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	57.6	9.6e-111
WP_002210825.1|3103093_3104248_+	MFS transporter	NA	NA	NA	NA	NA
WP_002216093.1|3104271_3106224_+	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_002216094.1|3106391_3106964_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_002210824.1|3106966_3107620_+	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_002228028.1|3107687_3110561_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.3	3.8e-42
WP_002210821.1|3110748_3113424_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	34.4	4.0e-102
WP_002210820.1|3113685_3114414_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_002210818.1|3114907_3117196_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_002210817.1|3117358_3118489_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.6	7.6e-172
WP_002210816.1|3118492_3118750_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.9	4.0e-20
WP_002210815.1|3118784_3119294_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 13
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	3265814	3271986	4596548	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_002210709.1|3265814_3266015_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002215949.1|3266014_3266557_+	ash family protein	NA	NA	NA	NA	NA
WP_002215950.1|3266549_3267509_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
WP_002210707.1|3267505_3268594_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002210705.1|3268942_3269257_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002215951.1|3269262_3269580_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_000255944.1|3270184_3271207_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3271206_3271986_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
>prophage 14
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	3879168	3955040	4596548	transposase,plate	Escherichia_phage(16.67%)	56	NA	NA
WP_000255944.1|3879168_3880191_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3880190_3880970_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210424.1|3881231_3881618_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002210426.1|3881912_3884627_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210427.1|3884704_3885238_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|3885266_3885791_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|3885957_3886878_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210430.1|3886977_3888129_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002210431.1|3888201_3889458_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002228100.1|3889484_3890312_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|3890313_3891234_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|3891226_3892702_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002210434.1|3892839_3893910_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002210435.1|3893906_3895109_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210436.1|3895108_3896425_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210437.1|3896427_3897510_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210438.1|3897503_3898880_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210439.1|3898876_3900364_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_140269987.1|3900350_3902114_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|3902179_3902497_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210442.1|3902493_3903456_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210443.1|3903458_3903917_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|3904471_3904561_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|3905018_3905459_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002210447.1|3905589_3906600_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213775.1|3907104_3907563_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002424260.1|3907761_3908286_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002228103.1|3908258_3909986_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_002216437.1|3910445_3912251_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002216434.1|3912804_3913761_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002210452.1|3914438_3914654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|3915082_3915541_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002224085.1|3915687_3917250_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|3917252_3918344_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_140270017.1|3918345_3919776_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|3919790_3920393_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002224086.1|3920633_3921815_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210461.1|3922478_3924140_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002214274.1|3925079_3926072_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002214276.1|3926047_3927655_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002210464.1|3927641_3928352_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|3928420_3929188_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|3929383_3931753_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002220588.1|3932213_3935120_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210468.1|3935375_3935729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210469.1|3939253_3940864_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210470.1|3940860_3942216_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|3942335_3942827_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|3942819_3943185_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|3943190_3943808_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|3943800_3944904_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002224087.1|3944929_3947149_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_002210474.1|3947161_3949510_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|3949613_3952202_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|3952219_3953203_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210477.1|3953195_3955040_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 15
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	4080523	4147939	4596548	transposase,tRNA,plate	Escherichia_phage(13.33%)	49	NA	NA
WP_071525507.1|4080523_4080862_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002209171.1|4081205_4082579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209170.1|4082550_4083273_-	histidine kinase	NA	NA	NA	NA	NA
WP_002209169.1|4083322_4084648_-	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_002209167.1|4085671_4086988_-	McrC family protein	NA	NA	NA	NA	NA
WP_002209166.1|4086984_4089048_-	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	33.2	5.3e-30
WP_000255944.1|4089181_4090204_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|4090203_4090983_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002209009.1|4091056_4091494_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_002209010.1|4091500_4092385_-	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002209011.1|4092481_4093072_-	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_002217380.1|4093393_4095217_-	ribosome-dependent GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	42.3	1.2e-20
WP_002213150.1|4095778_4097188_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_002213151.1|4097440_4098490_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.2	4.2e-07
WP_002213152.1|4098497_4099910_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	25.6	3.1e-05
WP_002213155.1|4099963_4101337_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_002213158.1|4101519_4102086_-	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_002213160.1|4102830_4103481_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_002213775.1|4103732_4104191_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002213759.1|4104442_4104901_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002213164.1|4105309_4108108_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.8	2.7e-69
WP_002213168.1|4108599_4109223_-	thiol:disulfide interchange protein DsbA	NA	NA	NA	NA	NA
WP_002213169.1|4109250_4110237_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_002213170.1|4110327_4110597_-	YihD family protein	NA	NA	NA	NA	NA
WP_002213171.1|4110750_4111338_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_002217538.1|4111337_4111868_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_002220999.1|4111925_4113134_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_161992928.1|4116383_4116545_+	hypothetical protein	NA	A0A140XBD7	Dickeya_phage	88.7	2.3e-21
WP_002218887.1|4118780_4118966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228171.1|4119231_4120095_-	glutamate racemase	NA	NA	NA	NA	NA
WP_002228170.1|4120039_4121917_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	24.8	1.3e-11
WP_002209474.1|4122396_4123500_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_002209475.1|4123633_4124041_-	YijD family membrane protein	NA	NA	NA	NA	NA
WP_002209476.1|4124053_4124689_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_002209477.1|4124906_4126307_+	Si-specific NAD(P)(+) transhydrogenase	NA	NA	NA	NA	NA
WP_002209478.1|4126289_4127207_-	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_002209479.1|4127353_4128085_+	glutathione peroxidase	NA	A0A1D8KSL1	Synechococcus_phage	58.5	1.3e-47
WP_002209480.1|4128178_4129642_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_002209481.1|4129757_4130561_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_002209482.1|4130625_4131954_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002209483.1|4132029_4133838_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	31.2	3.5e-25
WP_002209484.1|4134003_4134621_-	hemophore HasA	NA	NA	NA	NA	NA
WP_002209485.1|4134842_4137335_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_002209487.1|4137933_4139307_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_002209488.1|4139473_4140247_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_002209489.1|4140415_4141420_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_002223919.1|4141670_4142834_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_002209491.1|4143207_4145844_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_100067904.1|4146585_4147939_+|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
>prophage 16
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	4294060	4344873	4596548	tRNA,transposase,protease	Bacillus_phage(30.0%)	44	NA	NA
WP_002208973.1|4294060_4294549_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_002208972.1|4294737_4295802_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	NA	NA	NA	NA
WP_002208971.1|4295850_4297227_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.4	1.5e-17
WP_002208970.1|4297223_4297922_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.8e-06
WP_002208969.1|4298095_4298584_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_002221684.1|4299040_4299217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353252.1|4299300_4300221_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	8.6e-73
WP_002208967.1|4300782_4301685_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_002208966.1|4301902_4302886_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_002208965.1|4303106_4304096_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016257829.1|4304345_4305122_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002208963.1|4305239_4306667_-	anion permease	NA	NA	NA	NA	NA
WP_002208962.1|4306732_4307446_-	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_001297096.1|4307576_4308356_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|4308355_4309378_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_152329121.1|4309404_4310139_-	PIG-L domain-containing protein	NA	NA	NA	NA	NA
WP_002208960.1|4310275_4311511_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208959.1|4311742_4312510_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_002223910.1|4312638_4313274_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_002208957.1|4313421_4313856_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_002208956.1|4314196_4314943_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_002223912.1|4315097_4316108_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_002218876.1|4316344_4317868_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_002208954.1|4318044_4318893_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.5	3.2e-13
WP_002208953.1|4319520_4319760_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_002213759.1|4319967_4320426_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
WP_002223915.1|4320838_4322953_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_002208949.1|4322945_4324238_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_002215873.1|4324450_4324690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228141.1|4325319_4325904_+	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_002208945.1|4326020_4326506_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_002208944.1|4326647_4327565_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002208943.1|4327800_4329132_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.8	1.2e-43
WP_002208942.1|4329202_4329727_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_002208941.1|4329826_4330672_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_002208938.1|4332122_4334321_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_002216737.1|4334563_4334779_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002208936.1|4335321_4335777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002208935.1|4336125_4336443_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_002208934.1|4337982_4340418_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_002208933.1|4340650_4341535_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_100067904.1|4341696_4343051_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
WP_002208930.1|4343243_4344002_-	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002216348.1|4344036_4344873_-|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
>prophage 17
NZ_CP045158	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 chromosome, complete genome	4596548	4452237	4462188	4596548	transposase	Escherichia_phage(28.57%)	7	NA	NA
WP_002212296.1|4452237_4454358_+	membrane protein	NA	H9YQA8	environmental_Halophage	64.5	6.0e-45
WP_002212295.1|4454583_4455801_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	4.5e-29
WP_002223842.1|4455933_4456509_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	3.0e-68
WP_002215686.1|4456751_4458293_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	44.5	6.9e-83
WP_002208878.1|4458612_4459182_-	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	32.3	1.7e-07
WP_001297096.1|4460386_4461166_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|4461165_4462188_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 1
NZ_CP045160	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 plasmid pCD, complete sequence	70503	12265	67703	70503	protease,transposase	Enterobacteria_phage(42.86%)	59	NA	NA
WP_000255944.1|12265_13288_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002212907.1|14079_14427_-	type III secretion system exported negative regulator LcrQ/YscM1	NA	NA	NA	NA	NA
WP_002212909.1|14651_15284_-	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_002361471.1|15262_15892_-	type III secretion system sorting platform protein YscK	NA	NA	NA	NA	NA
WP_002212912.1|15891_16626_-	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_002212914.1|16632_16980_-	type III secretion system inner rod subunit SctI	NA	NA	NA	NA	NA
WP_002212915.1|16980_17478_-	YopR family type III secretion effector	NA	NA	NA	NA	NA
WP_002229801.1|17474_17822_-	YscG family type III secretion protein	NA	NA	NA	NA	NA
WP_002212916.1|17823_18087_-	type III secretion system needle filament subunit SctF	NA	NA	NA	NA	NA
WP_002212917.1|18087_18288_-	EscE/YscE/SsaE family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
WP_002212919.1|18284_19544_-	type III secretion system inner membrane ring subunit SctD	NA	NA	NA	NA	NA
WP_002212923.1|19540_21364_-	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_002212925.1|21369_21783_-	type III secretion system chaperone YscB	NA	NA	NA	NA	NA
WP_002229797.1|22008_22107_-	type III secretion system protein YscA	NA	NA	NA	NA	NA
WP_002212931.1|22185_23001_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002222527.1|23124_23520_-	type III secretion system chaperone YscW	NA	NA	NA	NA	NA
WP_002212936.1|24095_25160_-	type III secretion system export apparatus switch protein YscU	NA	NA	NA	NA	NA
WP_002212938.1|25159_25945_-	type III secretion system export apparatus protein SctT	NA	NA	NA	NA	NA
WP_002212945.1|25941_26208_-	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_002212947.1|26209_26863_-	type III secretion system export apparatus protein SctR	NA	NA	NA	NA	NA
WP_002212948.1|26859_27783_-	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_002212950.1|27779_29147_-	type III secretion system needle length determinant	NA	NA	NA	NA	NA
WP_002212952.1|29146_29611_-	type III secretion system central stalk protein YscO	NA	NA	NA	NA	NA
WP_002212955.1|29607_30927_-	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_002212958.1|31124_32006_+	type III secretion system gatekeeper subunit YopN	NA	NA	NA	NA	NA
WP_002212965.1|31986_32265_+	type III secretion system gatekeeper subunit TyeA	NA	NA	NA	NA	NA
WP_002229794.1|32251_32623_+	type III secretion chaperone SycN	NA	NA	NA	NA	NA
WP_002212969.1|32619_32988_+	type III secretion system protein YscX	NA	NA	NA	NA	NA
WP_002229791.1|32984_33329_+	type III secretion system chaperone YscY	NA	NA	NA	NA	NA
WP_002212971.1|33315_35430_+	type III secretion system export apparatus subunit SctV	NA	NA	NA	NA	NA
WP_002220918.1|35426_35867_+	type III secretion system regulator LcrR	NA	NA	NA	NA	NA
WP_002212973.1|35908_36196_+	type III secretion protein LcrG	NA	NA	NA	NA	NA
WP_002212981.1|36197_37178_+	type III secretion system protein LcrV	NA	NA	NA	NA	NA
WP_002222758.1|37190_37697_+	type III secretion system chaperone LcrH	NA	NA	NA	NA	NA
WP_002212985.1|37674_38880_+	type III secretion system translocon subunit YopB	NA	NA	NA	NA	NA
WP_002212987.1|38898_39819_+	type III secretion system translocon subunit YopD	NA	NA	NA	NA	NA
WP_002229781.1|41156_41366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002222517.1|41696_42989_+	T3SS effector E3 ubiquitin ligase YopM	NA	NA	NA	NA	NA
WP_116442925.1|43230_43476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002393889.1|44224_44575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213004.1|45348_45747_-	type III secretion system chaperone SycT	NA	NA	NA	NA	NA
WP_002213006.1|45746_46715_-|protease	T3SS effector cysteine protease YopT	protease	NA	NA	NA	NA
WP_002213007.1|47214_47763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229770.1|48360_48990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220902.1|51001_52168_+	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
WP_002213354.1|52164_53130_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	3.1e-89
WP_154020274.1|53289_53526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002224342.1|54392_54635_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_002213360.1|54627_54927_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002229754.1|55066_55726_-	type III secretion system effector GTPase activator YopE	NA	NA	NA	NA	NA
WP_002213403.1|55919_56312_+	YopE transcriptional regulator YerA	NA	NA	NA	NA	NA
WP_002220893.1|57121_58294_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.4	1.6e-220
WP_002213267.1|59068_59494_+	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_086016640.1|59641_60741_-|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002229829.1|60840_61170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224338.1|61308_61773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213258.1|61791_62343_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002213256.1|62506_64822_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.6	1.0e-279
WP_042469136.1|67433_67703_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP045159	Yersinia pestis subsp. pestis bv. Medievalis strain SCPM-O-B-6530 plasmid pMT, complete sequence	101698	0	98512	101698	terminase,tail,integrase,transposase	Salmonella_phage(78.21%)	99	4295:4314	92627:92646
WP_002214164.1|0_1065_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002213759.1|1265_1724_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002222711.1|2344_2557_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|2556_2892_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|2888_3068_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|3108_3384_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|3451_3862_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|3845_4217_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
4295:4314	attL	CAATTTGTTTTCTTGTTGGT	NA	NA	NA	NA
WP_002222866.1|4370_5201_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|5204_5405_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_161597819.1|5495_6527_-	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_000920226.1|6574_6841_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|6840_7785_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|7845_8874_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_011114024.1|8993_9425_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	97.9	2.2e-71
WP_002215095.1|9645_9897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213141.1|9969_10533_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002425587.1|10562_10988_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002221186.1|11002_14527_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
WP_002211767.1|14707_15943_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|16039_18406_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002228800.1|18515_18728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228802.1|18990_19377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353208.1|19371_20475_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
WP_002216410.1|21234_21747_-	F1 capsule protein	NA	NA	NA	NA	NA
WP_002211763.1|21827_24329_-	F1 capsule-anchoring protein	NA	NA	NA	NA	NA
WP_002211762.1|24353_25130_-	chaperone Caf1M	NA	NA	NA	NA	NA
WP_002211761.1|25457_26363_+	F1 operon transcriptional regulator Caf1R	NA	NA	NA	NA	NA
WP_002224363.1|26877_27183_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	3.2e-48
WP_002224361.1|27328_27544_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	7.7e-33
WP_002233024.1|27703_28741_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.4	1.8e-207
WP_001297096.1|28816_29596_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|29595_30618_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211744.1|30741_32751_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_002211745.1|32823_33054_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211746.1|33766_34273_-	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211747.1|34671_35451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|35504_35924_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211748.1|35934_36156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|36155_36833_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211750.1|37333_37534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228775.1|37695_39093_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002215070.1|39471_40443_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002211752.1|40439_41645_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002211753.1|41946_42174_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002215068.1|42173_42500_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211754.1|42699_43320_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215065.1|43385_44327_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211756.1|44349_44625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211757.1|45363_45852_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211758.1|45929_47693_+	phospholipase D	NA	NA	NA	NA	NA
WP_002211760.1|49768_50791_-|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002209743.1|51259_52468_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002224263.1|52501_53224_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_002224265.1|53476_54271_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	3.7e-141
WP_002224267.1|54571_54829_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	94.1	1.3e-34
WP_000255944.1|55230_56253_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|56252_57032_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|57165_57774_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|58075_60964_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|61044_61623_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002214118.1|61679_66311_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211773.1|66332_66920_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|66907_67705_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211775.1|67697_68396_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	7.1e-136
WP_000440566.1|68485_68821_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|68862_73440_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|73447_73672_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|73797_74115_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|74174_74921_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|74995_75379_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|75380_75854_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|75844_76189_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|76286_77120_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|77119_77554_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|77597_78260_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|78334_79210_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_162006968.1|80159_81734_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	4.1e-301
WP_002211787.1|81767_83024_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|83026_83668_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|83863_84130_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|84139_85030_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|85035_85290_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|85282_85921_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|85917_86586_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|86585_87284_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|87348_88908_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|88910_89189_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|89248_89671_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|89675_90203_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|90525_91176_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|91260_91488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211801.1|92126_92609_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002211802.1|92814_93096_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
92627:92646	attR	CAATTTGTTTTCTTGTTGGT	NA	NA	NA	NA
WP_002213759.1|93295_93754_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002214145.1|93962_94532_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213303.1|94544_95291_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_038918515.1|95280_95640_-	hypothetical protein	NA	J9Q741	Salmonella_phage	100.0	5.2e-58
WP_002213300.1|97426_98512_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
