The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045149	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) chromosome, complete genome	4546217	235910	303339	4546217	transposase	Escherichia_phage(40.0%)	51	NA	NA
WP_000255944.1|235910_236933_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|236932_237712_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211540.1|237750_238086_+	deoxyribonuclease	NA	NA	NA	NA	NA
WP_002211541.1|238100_239123_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_002211542.1|239232_239721_-	transcription/translation regulatory transformer protein RfaH	NA	NA	NA	NA	NA
WP_002215917.1|239968_241465_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_002215918.1|241519_242221_+	NAD(P)H-flavin reductase	NA	NA	NA	NA	NA
WP_002211545.1|242380_243544_-	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
WP_002211546.1|243555_245745_-	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
WP_002211547.1|246071_247403_+	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_002211548.1|247402_247612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213759.1|247716_248175_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211550.1|248763_250215_+	Trk system potassium transporter TrkH	NA	NA	NA	NA	NA
WP_002215920.1|250236_250770_+	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_002218887.1|251053_251239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002212288.1|256906_257944_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_002212289.1|257940_258900_+	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_002212290.1|258934_259885_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.2	8.7e-28
WP_002217850.1|260095_260647_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255944.1|260736_261759_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|261758_262538_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210669.1|263594_264779_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
WP_002210670.1|265029_265413_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002210671.1|265414_265960_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
WP_002210672.1|266150_266579_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002210673.1|266582_267287_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002210674.1|267651_268149_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002210675.1|268215_268584_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002210676.1|268926_272955_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
WP_002210677.1|273083_277304_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
WP_002213775.1|277430_277889_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210678.1|278320_279451_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002228257.1|279443_280259_-	thiazole synthase	NA	NA	NA	NA	NA
WP_002217275.1|280260_280476_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_002210680.1|280472_281270_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.8	1.6e-11
WP_002210681.1|281259_281934_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_002210682.1|281920_283966_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_002210683.1|284341_284851_-	sigma D regulator	NA	NA	NA	NA	NA
WP_002210684.1|284947_285730_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_002210685.1|285822_286608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210686.1|286726_287794_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_002210687.1|287823_288564_+	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_002210688.1|288609_289200_+	YjaG family protein	NA	NA	NA	NA	NA
WP_002210689.1|289388_289664_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
WP_002355296.1|289713_290367_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210691.1|290514_291801_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002210692.1|291860_293450_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.2e-68
WP_002218887.1|293917_294103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086016626.1|299773_300872_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	2.2e-46
WP_001297096.1|301537_302317_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|302316_303339_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 2
NZ_CP045149	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) chromosome, complete genome	4546217	958314	1013069	4546217	transposase,tRNA,protease,integrase	uncultured_virus(20.0%)	54	953652:953670	1029696:1029714
953652:953670	attL	TAAAGGCGATAACTTTACC	NA	NA	NA	NA
WP_002208581.1|958314_958794_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_002208580.1|959057_959867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002223301.1|960387_963273_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.8	1.0e-111
WP_002208578.1|963479_963899_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_002208577.1|964007_964457_-	NfeD family protein	NA	NA	NA	NA	NA
WP_002208576.1|964459_965374_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_002208575.1|965568_966438_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_002208574.1|966514_967291_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002208573.1|967677_968313_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_002208572.1|968283_968970_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.6e-31
WP_002208571.1|968966_971396_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002208570.1|971439_972504_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002208569.1|972500_973025_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_002208568.1|973320_974043_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_002208567.1|974053_974548_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_016678838.1|974758_976144_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.5	3.8e-40
WP_002213775.1|976490_976949_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002209775.1|977095_977308_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_002209774.1|977322_978189_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
WP_002215270.1|978543_978726_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_002215268.1|978984_979185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228356.1|979298_979796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215266.1|979931_980270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079866998.1|980352_980631_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	73.5	4.2e-31
WP_002354559.1|980842_981049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209770.1|981448_982051_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_002209769.1|982043_982973_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002209768.1|982982_983615_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002209767.1|983611_985375_+	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002209766.1|985367_986687_+	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_002209765.1|986668_987070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215253.1|987166_987472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|987838_988618_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|988617_989640_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002209764.1|989733_990627_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209763.1|990681_991671_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002209762.1|991696_992548_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	1.2e-49
WP_002209759.1|993020_994649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209758.1|994727_997109_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002209757.1|997267_997798_-	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_002209756.1|997790_999998_-	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|1000449_1001658_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209753.1|1002059_1002641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224869.1|1002929_1003052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209752.1|1003175_1005092_-	autotransporter adhesin YapC	NA	NA	NA	NA	NA
WP_002209751.1|1005900_1006140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002227852.1|1006178_1006430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209749.1|1006453_1007026_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002209748.1|1007037_1007439_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_002209746.1|1007671_1008073_-	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_002216002.1|1008340_1008922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209745.1|1009594_1009840_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	7.2e-19
WP_138921619.1|1010052_1012365_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_002213775.1|1012610_1013069_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
1029696:1029714	attR	TAAAGGCGATAACTTTACC	NA	NA	NA	NA
>prophage 3
NZ_CP045149	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) chromosome, complete genome	4546217	1375280	1444142	4546217	plate,tRNA,transposase	Escherichia_phage(38.46%)	60	NA	NA
WP_002213759.1|1375280_1375739_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208491.1|1375881_1376391_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002208490.1|1376439_1378167_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.3	3.0e-18
WP_002208488.1|1378215_1378473_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002222180.1|1378971_1379940_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.8	4.8e-74
WP_002213487.1|1380096_1380831_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002227089.1|1381079_1382066_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_002213368.1|1382156_1384169_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.2	1.7e-142
WP_002213369.1|1384188_1384404_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_002213372.1|1384504_1384852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213374.1|1384983_1385589_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_002213775.1|1386149_1386608_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002222185.1|1386800_1388216_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002211622.1|1389449_1390634_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_002211621.1|1391084_1392314_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_002354622.1|1392406_1392721_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002211618.1|1392990_1393980_-	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_002211617.1|1394115_1394994_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211616.1|1395096_1395573_+	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_002211615.1|1395753_1396725_+	glucokinase	NA	NA	NA	NA	NA
WP_002211614.1|1396802_1398050_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_002211613.1|1398315_1399551_+	alanine transaminase	NA	NA	NA	NA	NA
WP_002211611.1|1399833_1400358_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.1	9.3e-24
WP_002211610.1|1400452_1400884_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	2.4e-25
WP_002215847.1|1401473_1402145_+	lipoprotein	NA	NA	NA	NA	NA
WP_002215846.1|1402171_1402528_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_002211607.1|1402524_1403181_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_002211606.1|1403426_1403996_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_002228419.1|1403992_1404589_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	49.2	9.2e-44
WP_002211604.1|1405070_1405847_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	41.4	3.9e-42
WP_002211603.1|1405848_1406466_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	1.1e-87
WP_002211602.1|1406477_1408904_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.4	1.1e-255
WP_002211601.1|1409734_1410583_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_002354621.1|1410812_1411292_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211599.1|1411758_1412283_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_002211598.1|1412355_1413405_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-21
WP_002215840.1|1413401_1414988_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002211596.1|1415043_1416063_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211594.1|1416391_1417486_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_002211590.1|1418751_1419354_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002215321.1|1419711_1420194_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_002211588.1|1420190_1421873_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002224806.1|1421873_1422575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211586.1|1422571_1423909_-	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	32.8	2.0e-70
WP_002215319.1|1423948_1424980_-	fimbrial protein	NA	NA	NA	NA	NA
WP_002211584.1|1424986_1426168_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002211583.1|1426266_1427292_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211582.1|1427291_1429172_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002215317.1|1429954_1432630_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211580.1|1432830_1433376_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211579.1|1433532_1434294_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002215157.1|1434421_1435972_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|1435993_1437202_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211577.1|1437226_1438417_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211576.1|1438401_1439010_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211575.1|1439114_1439639_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211574.1|1439662_1441165_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211573.1|1441490_1441976_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211572.1|1442249_1442789_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211571.1|1442792_1444142_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 4
NZ_CP045149	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) chromosome, complete genome	4546217	1772238	1790209	4546217	coat,protease,transposase	Escherichia_phage(50.0%)	15	NA	NA
WP_000255944.1|1772238_1773261_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215943.1|1773667_1774057_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_002210859.1|1774166_1774406_-	YebV family protein	NA	NA	NA	NA	NA
WP_002210858.1|1774613_1775603_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_002210857.1|1775808_1778256_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210856.1|1778426_1779179_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002216611.1|1779209_1779767_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|1779787_1780318_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210852.1|1780323_1780878_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216616.1|1781356_1784008_-	PqiB family protein	NA	NA	NA	NA	NA
WP_002367629.1|1783976_1785224_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002210850.1|1785455_1785953_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002210849.1|1786048_1786762_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210848.1|1786781_1788854_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210847.1|1789327_1790209_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 5
NZ_CP045149	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) chromosome, complete genome	4546217	2080387	2200025	4546217	lysis,integrase,tRNA,transposase,tail	Escherichia_phage(13.79%)	119	2085387:2085446	2198433:2198545
WP_002209743.1|2080387_2081596_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210642.1|2081631_2082390_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_002210643.1|2082690_2082987_+	YciI family protein	NA	NA	NA	NA	NA
WP_002217646.1|2083209_2083455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210644.1|2083570_2083834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210646.1|2084054_2084594_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	42.4	2.1e-26
WP_002388651.1|2085022_2085199_-	YciY family protein	NA	NA	NA	NA	NA
2085387:2085446	attL	AGGAGTAAAGCGTCCGCGCCAAGGATGGCGCGGCTCGAGCCTACATGGATGTATTTACGG	NA	NA	NA	NA
WP_002210648.1|2085640_2087101_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_002210649.1|2087265_2087589_+	YciU family protein	NA	NA	NA	NA	NA
WP_002210650.1|2087887_2088103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210651.1|2088663_2089665_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	4.7e-24
WP_002210652.1|2089661_2090663_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.2e-14
WP_025470761.1|2090674_2091583_-	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_002210654.1|2091598_2092519_-	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_002218177.1|2092605_2094243_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_002210656.1|2095080_2095725_-	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_002210657.1|2096531_2099207_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000255944.1|2099746_2100769_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2100768_2101548_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210659.1|2101916_2102507_-	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	55.8	1.5e-54
WP_002223593.1|2103256_2103664_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002210664.1|2104098_2105445_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002210665.1|2105751_2106768_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002210666.1|2108101_2108566_+	YchJ family protein	NA	NA	NA	NA	NA
WP_002210667.1|2108649_2109519_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	5.5e-13
WP_002209743.1|2109481_2110690_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002209743.1|2111421_2112630_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211665.1|2112884_2113745_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211667.1|2114554_2115361_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211668.1|2115458_2115845_+	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211669.1|2115857_2116148_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211670.1|2116144_2118070_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211671.1|2118131_2119178_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002211673.1|2119402_2119954_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211674.1|2120116_2121967_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211675.1|2122083_2123100_+	asparaginase	NA	NA	NA	NA	NA
WP_002211676.1|2123114_2123762_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002217933.1|2123895_2124168_-	YeaC family protein	NA	NA	NA	NA	NA
WP_002211677.1|2124238_2124652_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002224141.1|2124999_2125995_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002211679.1|2126308_2127184_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002430110.1|2127256_2128006_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211681.1|2128449_2130384_+	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002216501.1|2130533_2131808_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211683.1|2131915_2133034_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002211684.1|2133068_2133974_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211685.1|2134171_2135041_+	pirin family protein	NA	NA	NA	NA	NA
WP_002216508.1|2135305_2136508_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211686.1|2136523_2137828_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002211687.1|2138293_2139829_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211688.1|2140046_2140766_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211689.1|2141009_2142584_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002227934.1|2142819_2143350_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002214494.1|2143766_2144123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211692.1|2145214_2145955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211693.1|2145971_2147171_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002214492.1|2147174_2148347_+	MFS transporter	NA	NA	NA	NA	NA
WP_002209743.1|2148651_2149860_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_097608205.1|2150080_2150449_-|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002211696.1|2150510_2151428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211697.1|2151444_2152443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|2152442_2155646_-	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002359202.1|2155821_2156043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|2156217_2156838_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002211701.1|2156893_2157109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214482.1|2157251_2157803_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211704.1|2157901_2158909_-	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002211705.1|2158982_2159150_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211706.1|2159273_2159705_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211707.1|2159783_2160416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211708.1|2160676_2161387_-	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211709.1|2161389_2162142_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002211710.1|2162315_2162657_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002211711.1|2162659_2166163_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_071525538.1|2166163_2166424_-	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211712.1|2166471_2166783_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_002211713.1|2166795_2167716_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211714.1|2167781_2168189_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211715.1|2168185_2168770_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211716.1|2168771_2169122_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211717.1|2169123_2169378_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211718.1|2169374_2169857_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211719.1|2169904_2171110_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211720.1|2171123_2171897_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211721.1|2172018_2173131_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002228446.1|2173131_2173773_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002228445.1|2173791_2174520_-	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002209743.1|2175497_2176706_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211723.1|2176753_2177338_-	hypothetical protein	NA	A0A0R6PHH0	Moraxella_phage	70.7	4.8e-69
WP_002211724.1|2177341_2177791_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211725.1|2177821_2178457_-	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211727.1|2178913_2179627_-	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211729.1|2180172_2180631_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211730.1|2180615_2181128_-	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002430108.1|2181158_2181356_-	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002215644.1|2181601_2181877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211731.1|2181873_2182083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|2182506_2183070_-	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002215638.1|2183118_2183337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215636.1|2183340_2183730_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002211735.1|2183730_2184336_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002211736.1|2184409_2184856_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_071525537.1|2184831_2185581_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002215632.1|2185880_2186141_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_001297096.1|2186308_2187088_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2187087_2188110_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211738.1|2188179_2189418_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
WP_002211739.1|2189444_2189891_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_002211740.1|2189993_2190650_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_002215627.1|2190720_2191806_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_002211743.1|2191946_2192219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220631.1|2192939_2193626_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_002211179.1|2193650_2194463_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_002211180.1|2194466_2194736_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_002211181.1|2194972_2196094_-	ribonuclease D	NA	NA	NA	NA	NA
WP_002220632.1|2196253_2197942_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	28.9	3.0e-31
WP_087768167.1|2198476_2198584_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
2198433:2198545	attR	AGGAGTAAAGCGTCCGCGCCAAGGATGGCGCGGCTCGAGCCTACATGGATGTATTTACGGCGTCTTTACGATCTGCCTGTTCTCTCCGTCGCGGGCACTTTGTCAATAACCTC	NA	NA	NA	NA
WP_002211183.1|2198584_2199190_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_002211184.1|2199326_2200025_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP045149	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) chromosome, complete genome	4546217	2551399	2595917	4546217	plate,lysis,tRNA,transposase	Indivirus(14.29%)	36	NA	NA
WP_002211870.1|2551399_2553427_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
WP_002213775.1|2553590_2554049_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002228565.1|2554266_2554929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211975.1|2555626_2556703_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211974.1|2556720_2557974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211973.1|2558306_2559488_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211971.1|2559729_2560137_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002211970.1|2560133_2560829_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_002211969.1|2561154_2562039_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_002211968.1|2562394_2564092_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002211966.1|2564372_2565110_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_002211965.1|2565554_2566565_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_002211964.1|2566585_2568106_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.6e-10
WP_002211963.1|2568335_2569328_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002211961.1|2570075_2571242_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_002211960.1|2571296_2571959_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_002211959.1|2572142_2573294_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211958.1|2573429_2574299_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211957.1|2574572_2575712_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.9	5.2e-35
WP_002211956.1|2575732_2576575_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002227980.1|2576831_2577044_+	peptide antibiotic darobactin C	NA	NA	NA	NA	NA
WP_002215886.1|2577127_2579488_+	darobactin export ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002211952.1|2579489_2580752_+	darobactin export ABC transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002211951.1|2580753_2581422_+	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
WP_002211950.1|2581431_2582742_+	darobactin maturation radical SAM/SPASM protein DarE	NA	NA	NA	NA	NA
WP_002211949.1|2583276_2584551_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_002211948.1|2584552_2585323_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_002209743.1|2585458_2586667_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211947.1|2586710_2587364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|2587591_2589187_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211945.1|2589869_2590493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211944.1|2590704_2592072_-	membrane protein	NA	NA	NA	NA	NA
WP_002211943.1|2592096_2592549_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002214552.1|2592548_2593130_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211941.1|2593104_2594190_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211940.1|2594153_2595917_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 7
NZ_CP045149	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) chromosome, complete genome	4546217	2620781	2662549	4546217	plate,protease,transposase	Escherichia_phage(40.0%)	38	NA	NA
WP_002213011.1|2620781_2622134_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002214707.1|2622145_2623696_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213014.1|2623738_2624239_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002213016.1|2625227_2626076_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002213017.1|2626174_2626423_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_002228570.1|2626460_2626901_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213024.1|2626987_2627776_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213025.1|2627778_2628531_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_002213026.1|2628532_2629252_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213028.1|2629244_2630483_-	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|2630498_2631236_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213032.1|2631237_2632521_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213034.1|2632510_2633035_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213036.1|2633298_2633517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213038.1|2634247_2634994_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213039.1|2635147_2637565_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213046.1|2641210_2641540_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213049.1|2641591_2641870_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002213052.1|2641963_2643154_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213054.1|2643214_2643532_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213056.1|2643640_2644057_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213058.1|2644372_2645053_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213060.1|2645231_2645696_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002221095.1|2645756_2647811_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.8	1.5e-16
WP_002213062.1|2648004_2648451_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002213063.1|2648480_2650619_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213064.1|2650720_2651356_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213065.1|2651584_2652091_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213066.1|2652448_2653510_+	porin OmpA	NA	NA	NA	NA	NA
WP_002213775.1|2653699_2654158_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002226586.1|2654326_2654782_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002224683.1|2654992_2656744_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002220006.1|2656812_2657331_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002211286.1|2657596_2657785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|2658418_2659441_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2659440_2660220_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213775.1|2661380_2661839_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002213759.1|2662090_2662549_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP045149	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) chromosome, complete genome	4546217	2859147	2877512	4546217	plate,coat,transposase,tail	Vibrio_phage(25.0%)	19	NA	NA
WP_002213775.1|2859147_2859606_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208835.1|2859806_2860811_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002208836.1|2860988_2861216_+	YejL family protein	NA	NA	NA	NA	NA
WP_002208837.1|2861243_2863040_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002230704.1|2863270_2863654_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208839.1|2864010_2865159_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_002208840.1|2865171_2865660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208841.1|2866359_2866722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208842.1|2866847_2868284_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208843.1|2868574_2869315_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208845.1|2869612_2870392_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208846.1|2870488_2870836_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002215458.1|2870832_2871093_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_134809507.1|2871089_2872226_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	2.2e-30
WP_002208848.1|2872229_2872685_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002215460.1|2872681_2873278_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208850.1|2873293_2874349_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002208852.1|2874345_2875752_-	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208853.1|2876018_2877512_-|coat	coat protein	coat	NA	NA	NA	NA
>prophage 9
NZ_CP045149	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) chromosome, complete genome	4546217	2955512	2991728	4546217	holin,tRNA,transposase	uncultured_virus(12.5%)	30	NA	NA
WP_002228612.1|2955512_2956451_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210776.1|2956750_2957680_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002213759.1|2958094_2958553_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209743.1|2960364_2961573_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002223532.1|2961747_2962062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228617.1|2962145_2962382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016256670.1|2962522_2962849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157131901.1|2962895_2963204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220152.1|2964290_2965646_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.6	4.1e-55
WP_002220154.1|2966036_2966747_+	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_002220156.1|2966798_2967785_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_002220158.1|2967798_2969541_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.6	6.3e-24
WP_002220159.1|2969545_2970721_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002220162.1|2970733_2971840_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002220163.1|2971878_2972205_-	EthD family reductase	NA	NA	NA	NA	NA
WP_002220165.1|2972215_2972443_-	N5,N10-methylene tetrahydromethanopterin reductase	NA	NA	NA	NA	NA
WP_002220168.1|2972997_2973909_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002220169.1|2973909_2975019_-	alkene reductase	NA	NA	NA	NA	NA
WP_002220170.1|2975366_2976731_-	sigma 54-interacting transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.1	1.3e-05
WP_002220171.1|2976717_2978532_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.4	1.0e-16
WP_002220173.1|2978889_2979363_+	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
WP_002213759.1|2980168_2980627_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002214195.1|2981555_2982419_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002214197.1|2982764_2983613_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002214199.1|2983650_2984544_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002228035.1|2984775_2986824_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002218278.1|2987188_2987785_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_002218281.1|2987842_2989315_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002220180.1|2989337_2991041_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	9.4e-57
WP_002213775.1|2991269_2991728_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP045149	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) chromosome, complete genome	4546217	3061460	3067632	4546217	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_002210709.1|3061460_3061661_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002215949.1|3061660_3062203_+	ash family protein	NA	NA	NA	NA	NA
WP_002215950.1|3062195_3063155_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
WP_002210707.1|3063151_3064240_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002210705.1|3064588_3064903_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002215951.1|3064908_3065226_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_000255944.1|3065830_3066853_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3066852_3067632_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
>prophage 11
NZ_CP045149	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) chromosome, complete genome	4546217	3681232	3757109	4546217	plate,transposase	Escherichia_phage(20.0%)	56	NA	NA
WP_000255944.1|3681232_3682255_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3682254_3683034_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210424.1|3683295_3683682_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002210426.1|3683976_3686691_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210427.1|3686768_3687302_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|3687330_3687855_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|3688021_3688942_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210430.1|3689041_3690193_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002210431.1|3690265_3691522_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002228100.1|3691548_3692376_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|3692377_3693298_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|3693290_3694766_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002210434.1|3694903_3695974_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002210435.1|3695970_3697173_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210436.1|3697172_3698489_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210437.1|3698491_3699574_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210438.1|3699567_3700944_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210439.1|3700940_3702428_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210440.1|3702414_3704178_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|3704243_3704561_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210442.1|3704557_3705520_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210443.1|3705522_3705981_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|3706535_3706625_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|3707082_3707523_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002210447.1|3707653_3708664_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213775.1|3709168_3709627_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002424260.1|3709825_3710350_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002228103.1|3710322_3712050_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_002216437.1|3712509_3714315_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002216434.1|3714873_3715830_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002210452.1|3716507_3716723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213775.1|3717151_3717610_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210453.1|3717756_3719319_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|3719321_3720413_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|3720414_3721845_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|3721859_3722462_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002224086.1|3722702_3723884_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210461.1|3724547_3726209_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002214274.1|3727148_3728141_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002214276.1|3728116_3729724_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002210464.1|3729710_3730421_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|3730489_3731257_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|3731452_3733822_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002220588.1|3734282_3737189_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210468.1|3737444_3737798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210469.1|3741322_3742933_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210470.1|3742929_3744285_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|3744404_3744896_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|3744888_3745254_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|3745259_3745877_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|3745869_3746973_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002224087.1|3746998_3749218_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_002210474.1|3749230_3751579_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|3751682_3754271_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|3754288_3755272_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210477.1|3755264_3757109_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 12
NZ_CP045149	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) chromosome, complete genome	4546217	3882582	3948531	4546217	plate,protease,transposase	Escherichia_phage(12.5%)	60	NA	NA
WP_071525507.1|3882582_3882921_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002209171.1|3883264_3884638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209170.1|3884609_3885332_-	histidine kinase	NA	NA	NA	NA	NA
WP_002209169.1|3885381_3886707_-	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_002209167.1|3887730_3889047_-	McrC family protein	NA	NA	NA	NA	NA
WP_002209166.1|3889043_3891107_-	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	33.2	5.3e-30
WP_000255944.1|3891240_3892263_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3892262_3893042_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210151.1|3894123_3895017_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210150.1|3895278_3895983_+	pirin family protein	NA	NA	NA	NA	NA
WP_002210149.1|3896806_3897706_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.4	1.0e-49
WP_134954334.1|3897768_3899739_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_002210147.1|3899822_3900176_+	YraN family protein	NA	NA	NA	NA	NA
WP_002210146.1|3900446_3901037_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	32.0	3.2e-12
WP_002210145.1|3901047_3901623_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_002210144.1|3901829_3902555_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_002210143.1|3902551_3903205_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_002210142.1|3903446_3905783_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.4	9.9e-41
WP_134809492.1|3906046_3906970_-	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_002228691.1|3907792_3912250_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_002210138.1|3912259_3913678_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002224291.1|3914118_3914604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002216203.1|3914756_3915272_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
WP_002210135.1|3915277_3915919_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002230558.1|3916098_3916296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210133.1|3916292_3916685_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002210132.1|3916699_3917128_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210131.1|3917441_3918569_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210130.1|3918792_3919197_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002218066.1|3919467_3920841_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002213775.1|3920957_3921416_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210128.1|3921641_3922730_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002210127.1|3922910_3924173_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210126.1|3924326_3924581_-	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210125.1|3924727_3925030_-	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210124.1|3925065_3925689_-	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210123.1|3925701_3926259_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210122.1|3926263_3927046_-	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210121.1|3927263_3928082_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210120.1|3928346_3929321_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210119.1|3929431_3930418_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002228203.1|3930666_3931230_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002218352.1|3931226_3931790_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002210117.1|3931773_3932319_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002210116.1|3932325_3933051_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210115.1|3933112_3934546_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002213952.1|3934974_3935457_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210113.1|3935762_3936617_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002210112.1|3936613_3936886_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210111.1|3937223_3938159_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210110.1|3938170_3938635_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210109.1|3938772_3939159_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210107.1|3939457_3939934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210106.1|3940167_3941121_+	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002215779.1|3941531_3942947_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210104.1|3943041_3944709_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002210103.1|3945061_3945472_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210102.1|3945703_3946090_-	cytochrome b562	NA	NA	NA	NA	NA
WP_011055205.1|3946297_3946942_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210100.1|3947190_3948531_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 1
NZ_CP045151	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) plasmid pCD, complete sequence	68343	43586	66559	68343	protease,transposase	Enterobacteria_phage(50.0%)	20	NA	NA
WP_002213006.1|43586_44555_-|protease	T3SS effector cysteine protease YopT	protease	NA	NA	NA	NA
WP_002213007.1|45054_45603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229770.1|46200_46830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220902.1|48841_50008_+	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
WP_002213354.1|50004_50970_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	3.1e-89
WP_154020274.1|51129_51366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002224342.1|52231_52474_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_002213360.1|52466_52766_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002229754.1|52905_53565_-	type III secretion system effector GTPase activator YopE	NA	NA	NA	NA	NA
WP_002213403.1|53758_54151_+	YopE transcriptional regulator YerA	NA	NA	NA	NA	NA
WP_002220893.1|54960_56133_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.4	1.6e-220
WP_002213267.1|56907_57333_+	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_086016640.1|57480_58580_-|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002229829.1|58679_59009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224338.1|59147_59612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213258.1|59630_60182_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002213256.1|60345_62661_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.6	1.0e-279
WP_042469136.1|65273_65543_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002213246.1|65611_66070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213244.1|66241_66559_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP045150	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) plasmid pMT, complete sequence	100984	0	57063	100984	integrase,transposase,tail	Salmonella_phage(63.16%)	58	13549:13566	26607:26624
WP_002214164.1|0_1065_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|1633_1846_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|1845_2181_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|2177_2357_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|2397_2673_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|2740_3151_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|3134_3506_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|3659_4490_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|4493_4694_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_161597819.1|4784_5816_-	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_000920226.1|5863_6130_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|6129_7074_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213132.1|7134_8163_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
WP_002213135.1|8282_8714_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|8934_9186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213141.1|9258_9822_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002425587.1|9851_10277_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002221186.1|10291_13816_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
13549:13566	attL	CCAATGATTCCATACATC	NA	NA	NA	NA
WP_002211767.1|13996_15232_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|15328_17695_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002228800.1|17804_18017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228802.1|18279_18666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353208.1|18660_19764_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
WP_002216410.1|20523_21036_-	F1 capsule protein	NA	NA	NA	NA	NA
WP_002211763.1|21116_23618_-	F1 capsule-anchoring protein	NA	NA	NA	NA	NA
WP_002211762.1|23642_24419_-	chaperone Caf1M	NA	NA	NA	NA	NA
WP_002211761.1|24746_25652_+	F1 operon transcriptional regulator Caf1R	NA	NA	NA	NA	NA
WP_002224363.1|26166_26472_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	3.2e-48
WP_002224361.1|26617_26833_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	7.7e-33
26607:26624	attR	GATGTATGGAATCATTGG	NA	NA	NA	NA
WP_002233024.1|26992_28030_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.4	1.8e-207
WP_001297096.1|28105_28885_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|28884_29907_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211744.1|30030_32040_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_002211745.1|32112_32343_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211746.1|33055_33562_-	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211747.1|33960_34740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|34793_35213_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211748.1|35223_35445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|35444_36122_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211750.1|36622_36823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228775.1|36984_38382_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002215070.1|38760_39732_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002211752.1|39728_40934_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002211753.1|41235_41463_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002215068.1|41462_41789_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211754.1|41988_42609_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215065.1|42674_43616_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211756.1|43638_43914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211757.1|44652_45141_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211758.1|45218_46982_+	phospholipase D	NA	NA	NA	NA	NA
WP_002211760.1|49057_50080_-|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002209743.1|50548_51757_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002224263.1|51790_52513_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_002224265.1|52765_53560_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	3.7e-141
WP_002224267.1|53860_54118_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	94.1	1.3e-34
WP_000255944.1|54519_55542_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|55541_56321_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|56454_57063_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
>prophage 2
NZ_CP045150	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) plasmid pMT, complete sequence	100984	60334	97798	100984	tail,transposase,terminase	Salmonella_phage(94.87%)	40	NA	NA
WP_002211771.1|60334_60913_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002214118.1|60969_65601_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211773.1|65622_66210_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|66197_66995_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211775.1|66987_67686_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	7.1e-136
WP_000440566.1|67775_68111_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|68152_72730_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|72737_72962_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|73087_73405_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|73464_74211_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|74285_74669_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|74670_75144_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|75134_75479_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|75576_76410_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|76409_76844_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|76887_77550_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|77624_78500_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002231160.1|78526_79423_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.3	3.9e-147
WP_002211786.1|79445_81020_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	2.4e-301
WP_002211787.1|81053_82310_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|82312_82954_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|83149_83416_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|83425_84316_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|84321_84576_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|84568_85207_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|85203_85872_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|85871_86570_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_134809545.1|86634_88194_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	98.8	2.4e-293
WP_002214131.1|88196_88475_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|88534_88957_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|88961_89489_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|89811_90462_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|90546_90774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211801.1|91412_91895_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002211802.1|92100_92382_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002213759.1|92581_93040_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002214145.1|93248_93818_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213303.1|93830_94577_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_038918515.1|94566_94926_-	hypothetical protein	NA	J9Q741	Salmonella_phage	100.0	5.2e-58
WP_002213300.1|96712_97798_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
>prophage 1
NZ_CP045152	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) plasmid pTP33, complete sequence	33990	0	20652	33990	tail,plate	Haemophilus_phage(55.56%)	25	NA	NA
WP_016257336.1|486_1650_+	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	28.0	5.1e-22
WP_016257335.1|1652_2150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016257334.1|2155_3094_+	DUF2184 domain-containing protein	NA	NA	NA	NA	NA
WP_016257333.1|3107_3473_+	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	39.5	2.0e-12
WP_016261355.1|3483_4017_+	hypothetical protein	NA	A0A2H4J4S5	uncultured_Caudovirales_phage	40.7	2.6e-21
WP_025476461.1|4003_4261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016257033.1|4409_4808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016678638.1|4804_6319_+	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	42.3	2.6e-98
WP_016257034.1|6329_6755_+	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	45.7	4.3e-27
WP_016257035.1|6758_7154_+	hypothetical protein	NA	Q776V6	Haemophilus_phage	35.7	1.5e-10
WP_016261354.1|7307_9188_+	hypothetical protein	NA	A0A2I7QS75	Vibrio_phage	31.5	1.3e-06
WP_016257157.1|9184_9952_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	39.9	7.7e-35
WP_016257158.1|9953_10292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016257159.1|10266_11124_+	hypothetical protein	NA	D0UIH8	Aggregatibacter_phage	54.4	1.9e-82
WP_016257160.1|11095_11779_+	hypothetical protein	NA	Q7Y5S7	Haemophilus_phage	59.2	5.8e-42
WP_016257161.1|11775_12138_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	48.2	8.4e-24
WP_016257162.1|12121_13249_+|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	39.9	1.9e-69
WP_016257163.1|13241_13907_+	DUF2612 domain-containing protein	NA	D0UIH4	Aggregatibacter_phage	42.8	2.0e-34
WP_016257164.1|13884_15090_+	hypothetical protein	NA	Q7Y5S2	Haemophilus_phage	48.3	1.8e-30
WP_016257165.1|15101_15515_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	46.3	1.3e-25
WP_016257166.1|15489_16608_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.5	1.6e-33
WP_016261353.1|16621_17269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016257133.1|17322_17565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016261352.1|17545_18574_-	hypothetical protein	NA	A3E2K1	Sodalis_phage	46.9	7.1e-60
WP_016257046.1|18570_20652_-	exodeoxyribonuclease VIII	NA	Q2A0A5	Sodalis_phage	36.4	2.4e-99
>prophage 2
NZ_CP045152	Yersinia pestis strain SCPM-O-DNA-18 (I-3113) plasmid pTP33, complete sequence	33990	24607	33666	33990	terminase,integrase,holin	Salmonella_phage(30.0%)	12	21105:21119	30841:30855
21105:21119	attL	GCCTTGCGCCACAGT	NA	NA	NA	NA
WP_016257349.1|24607_25168_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	51.4	1.3e-47
WP_071588212.1|25146_25362_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_016257348.1|25494_25722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016257347.1|25718_26342_-	ParA family protein	NA	A0A0K1Y6H3	Rhodobacter_phage	36.6	1.7e-27
WP_016257346.1|26961_27264_+|holin	holin	holin	S4TP56	Salmonella_phage	57.3	3.0e-19
WP_025476582.1|27265_27691_+	lysozyme	NA	A0A2I7S753	Vibrio_phage	61.8	2.2e-39
WP_016257344.1|27687_28209_+	DUF2514 domain-containing protein	NA	A0A0M4S5V1	Salmonella_phage	36.5	1.7e-17
WP_016257343.1|28262_29264_+|integrase	site-specific integrase	integrase	Q38045	Staphylococcus_phage	26.3	2.2e-05
WP_016257342.1|29442_30138_+	hypothetical protein	NA	A3E2J6	Sodalis_phage	38.6	1.0e-30
WP_016257341.1|30118_31345_+|terminase	terminase	terminase	H6WRS9	Salmonella_phage	66.8	1.2e-162
30841:30855	attR	ACTGTGGCGCAAGGC	NA	NA	NA	NA
WP_016257340.1|31467_32070_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	3.8e-21
WP_016257338.1|32307_33666_+	DUF1073 domain-containing protein	NA	Q7Y5U6	Haemophilus_phage	31.4	8.3e-56
