The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045145	Yersinia pestis strain SCPM-O-B-6899 (231) chromosome, complete genome	4625829	461888	524325	4625829	protease,tail,transposase	uncultured_Mediterranean_phage(18.18%)	55	NA	NA
WP_002210082.1|461888_463334_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002210083.1|463536_466395_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002228695.1|466419_469260_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_002210086.1|469460_469820_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_002210087.1|469816_470218_-	M15 family metallopeptidase	NA	A0A249XWK9	Proteus_phage	61.0	3.6e-36
WP_002214300.1|470230_470533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210089.1|470666_475157_-	toxin	NA	NA	NA	NA	NA
WP_002220204.1|475213_478807_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_002210090.1|478847_481349_-	toxin	NA	NA	NA	NA	NA
WP_002214297.1|481584_482451_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002210092.1|482711_483623_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002210093.1|483925_484129_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002210094.1|484136_485072_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002210095.1|485073_487029_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002214288.1|488958_489432_+	ribonuclease Ba	NA	NA	NA	NA	NA
WP_002210098.1|489436_489718_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_002210099.1|489829_490378_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_002210100.1|490558_491899_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011055205.1|492147_492792_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	3.4e-52
WP_002210102.1|492999_493386_+	cytochrome b562	NA	NA	NA	NA	NA
WP_002210103.1|493609_494020_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_002210104.1|494372_496040_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_002215779.1|496134_497550_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_002210106.1|497960_498914_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
WP_002210107.1|499147_499624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210109.1|499922_500309_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_002210110.1|500446_500911_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_002210111.1|500922_501858_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
WP_002210112.1|502195_502468_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_002210113.1|502464_503319_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
WP_002213952.1|503624_504107_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_002210115.1|504535_505969_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_002210116.1|506030_506756_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
WP_002210117.1|506762_507308_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_002218352.1|507291_507855_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_002228203.1|507851_508415_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
WP_002210119.1|508663_509650_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
WP_002210120.1|509760_510735_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_002210121.1|510999_511818_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
WP_002210122.1|512035_512818_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_002210123.1|512822_513380_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002210124.1|513392_514016_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_002210125.1|514051_514354_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_002210126.1|514500_514755_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_002210127.1|514908_516171_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_002210128.1|516351_517440_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
WP_002213775.1|517665_518124_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002218066.1|518240_519614_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
WP_002210130.1|519884_520289_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002210131.1|520512_521640_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002210132.1|521953_522382_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002210133.1|522396_522789_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002230558.1|522785_522983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210135.1|523162_523804_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002216203.1|523809_524325_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
>prophage 2
NZ_CP045145	Yersinia pestis strain SCPM-O-B-6899 (231) chromosome, complete genome	4625829	678930	741024	4625829	protease,transposase,tRNA	Escherichia_phage(14.29%)	60	NA	NA
WP_002209144.1|678930_680166_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_002209145.1|680164_681679_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_002209146.1|681689_682160_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_002232017.1|682167_684081_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	M1HNA7	Bacillus_virus	28.2	2.1e-28
WP_002209148.1|684096_686004_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.3e-58
WP_002209149.1|685996_686938_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002209151.1|687053_687359_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_002209152.1|687457_688744_+	GTPase HflX	NA	NA	NA	NA	NA
WP_002209154.1|688984_690244_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_002209155.1|690247_691252_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_002217227.1|691423_691624_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_002209157.1|691723_693022_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.4	1.3e-66
WP_002217229.1|693390_693816_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_002209159.1|694056_696591_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	2.5e-66
WP_002209161.1|696709_697450_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_002353634.1|697869_699501_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_002215294.1|699572_699884_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_002228674.1|700068_700173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|700223_701003_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|701002_702025_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002210152.1|702081_702783_+	esterase	NA	NA	NA	NA	NA
WP_002210153.1|703149_703542_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002430134.1|703550_703868_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_002210155.1|703872_704100_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_002210156.1|704139_704592_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_002213775.1|704787_705246_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210157.1|705367_705823_-	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_002210158.1|705962_706703_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_002228198.1|707045_707666_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002210159.1|707763_708429_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_002210160.1|708583_710554_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_002220539.1|710988_711729_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_002210162.1|711731_712295_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_002210163.1|712630_712843_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_002210164.1|712950_714282_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002210165.1|714559_715198_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002210166.1|715472_717209_+	outer membrane protein assembly factor	NA	NA	NA	NA	NA
WP_002210167.1|717205_721123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210168.1|721125_721482_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002210169.1|721599_722127_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	62.7	9.3e-56
WP_002213775.1|722366_722825_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002216946.1|723037_724051_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	45.8	3.0e-71
WP_002210171.1|724221_725604_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210172.1|725899_726163_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002210173.1|726551_727022_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002210174.1|727485_728424_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002210175.1|728857_729133_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.2	1.1e-18
WP_002210176.1|729316_729664_+	putative DNA-binding transcriptional regulator	NA	A0A0M3LPN5	Mannheimia_phage	45.2	7.3e-09
WP_002210177.1|729760_730732_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	27.6	6.0e-08
WP_002210178.1|730991_731303_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_002210179.1|731322_731580_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002210180.1|731667_732654_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002210181.1|732654_733827_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_002210182.1|733921_734989_-	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	21.9	4.7e-06
WP_002210183.1|734985_735648_-	two-component system response regulator PmrA	NA	W8CYM9	Bacillus_phage	35.5	8.4e-30
WP_002217314.1|735653_737102_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_002210184.1|737359_737836_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002210185.1|737963_738257_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_002228196.1|738403_739033_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_002228195.1|739089_741024_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	44.5	4.4e-119
>prophage 3
NZ_CP045145	Yersinia pestis strain SCPM-O-B-6899 (231) chromosome, complete genome	4625829	1204334	1249001	4625829	protease,integrase,transposase,tRNA	uncultured_virus(30.0%)	43	1225050:1225109	1248978:1250293
WP_002208581.1|1204334_1204814_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_002208580.1|1205077_1205887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002223301.1|1206407_1209293_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.8	1.0e-111
WP_002208578.1|1209499_1209919_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_002208577.1|1210027_1210477_-	NfeD family protein	NA	NA	NA	NA	NA
WP_002208576.1|1210479_1211394_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_002208575.1|1211588_1212458_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_002208574.1|1212534_1213311_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002208573.1|1213697_1214333_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_002208572.1|1214303_1214990_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.6e-31
WP_002208571.1|1214986_1217416_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002208570.1|1217459_1218524_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_002208569.1|1218520_1219045_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_002208568.1|1219340_1220063_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_002208567.1|1220073_1220568_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_002222677.1|1220778_1222164_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.5	2.2e-40
WP_002213775.1|1222510_1222969_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002209775.1|1223115_1223328_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_002209774.1|1223342_1224209_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
WP_002215270.1|1224563_1224746_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
1225050:1225109	attL	CGAGCCTGTCCATAATTCTGTGTAACTGCCACCGTATTAAAGGTGATCGCTCAGGCGGTC	NA	NA	NA	NA
WP_002209743.1|1225085_1226294_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_050882058.1|1226327_1226528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228356.1|1226641_1227139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215266.1|1227274_1227613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079866998.1|1227695_1227974_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y6Q1	Salmonella_phage	73.5	4.2e-31
WP_002354559.1|1228185_1228392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209770.1|1228791_1229394_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_002209769.1|1229386_1230316_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002209768.1|1230325_1230958_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_002209767.1|1230954_1232718_+	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002209766.1|1232710_1234030_+	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_002209765.1|1234011_1234413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215253.1|1234509_1234815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297096.1|1235181_1235961_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|1235960_1236983_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002209764.1|1237076_1237970_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002209763.1|1238024_1239014_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002209762.1|1239039_1239891_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	1.2e-49
WP_002209759.1|1240363_1241992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002209758.1|1242070_1244452_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002209757.1|1244610_1245141_-	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_002209756.1|1245133_1247341_-	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_002209743.1|1247792_1249001_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
1248978:1250293	attR	GACCGCCTGAGCGATCACCTTTAATACGGTGGCAGTTACACAGAATTATGGACAGGCTCGATTAATCAGCCGGAAGATTTTAAACAGTGGTTTGGCCGCTTCGTGACGACACCACGCCATGAACTGGATATCGCCCCCGCACAGCCGCCCTATGATCAGGATGAGATTGTTGATGCCCTGATGGAGGGCGCTGTATTGACGCGCTTAGGTGGGTTGCGAGTTCTGCGTGTTGGCGACAACGTTTTCATTAACAGCGAACGGTTGGAAATGGCCAATGCTGAAGCCGCTGATGCTCTGTGCCGTTACACCATTATTGGCAAAAAAGAGTTGGGCGAGGCACTACAGGATTCGGCTTTCGTCACGGAATTAACCGAATTGATTAATCAGGGCTATTGGTTCTTCAACGAATAATAGCGCTATATACCCTAAATAATGGGTGACAGGTTGTGTAATCCCTGCATTAATTCATCGGCATGCTCAAAGCTGATCGCTTTCGGTACATCGACCAGCGTCTCAAATATAGCTTTTTCTGGGCAAGAAAATGTCACTGGCGGTAGCTCCTCGCGCCAGGTTTCTTCGTTAAGGAATCTGGGATCATCCATTGTCATTTTCGGCCACAGGCGATGGGTACCATGCCATTTGAATTTAGCGTTAAGTGGTACTCTATTCAGCCATGTTGGCAGAGCCGCCTCTGACCAGAGATGAATATGCTGCTCAGCGCCTTTAGAGAGGTAGTGTCCTAATCCGGCCAACTCTAAAGCTGTCAGGCCACCGACATGTATAGGTTGCTCAGACATCCTTTGTAGTGACGCAACAACGCCTTGCCAACTGACTCTGGCCTCTAGCAGGCAATACACCCCGGCGGTAAGCGGCAGTAGGGTTGAGCTGCGCACGGCATTGTCCAAAAAGTGCAGACTCAACCCTTGGTCAAGTAACCACTGTTTAGTCGCTACCATCTCCAATGGCAGGAGTTTGCGAAGTTGTTGCCGTGCGTCTGTGTTTAGCATGGTTTAATAAATCTCCTTTATACGGTGATTACTGCCGTATTTACTGAAATTATCAAACTATTGATGAAGGTTGGTTTGTAAAAGCAAGTATATACGTCAATAAATGCGAATAATAGGAATGCAACACGTAAAAGACCTTCCCCAATATTTCCGGGATATAAGTGTAAAATAAATTCCTCGCGCTATGCTGATACGTTCGCCATTTGTAATGCATTTTTAAATTTGTAGGGAATACAGGAAATAGCATCGATTATTGTGGAAATTATCTTGCTGACTGAGCATTTTTTTTTAATTTAATAAAATAGAGTG	NA	NA	NA	NA
>prophage 4
NZ_CP045145	Yersinia pestis strain SCPM-O-B-6899 (231) chromosome, complete genome	4625829	1624093	1693098	4625829	plate,transposase,tRNA	Escherichia_phage(38.46%)	60	NA	NA
WP_002213759.1|1624093_1624552_+|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002208491.1|1624694_1625204_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002208490.1|1625252_1626980_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	33.3	3.0e-18
WP_002208488.1|1627028_1627286_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_002222180.1|1627784_1628753_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.8	4.8e-74
WP_002213487.1|1628909_1629644_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_002227089.1|1629892_1630879_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_002213368.1|1630969_1632982_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.2	1.7e-142
WP_002213369.1|1633001_1633217_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_002213372.1|1633317_1633665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213374.1|1633796_1634402_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_002213775.1|1635115_1635574_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002222185.1|1635766_1637182_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002211622.1|1638415_1639600_-	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_002211621.1|1640050_1641280_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_002354622.1|1641372_1641687_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_002211618.1|1641956_1642946_-	glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_002211617.1|1643081_1643960_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152329029.1|1644062_1644548_+	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_002211615.1|1644728_1645700_+	glucokinase	NA	NA	NA	NA	NA
WP_002211614.1|1645777_1647025_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_002211613.1|1647290_1648526_+	alanine transaminase	NA	NA	NA	NA	NA
WP_002211611.1|1648789_1649314_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	47.1	9.3e-24
WP_002211610.1|1649408_1649840_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	2.4e-25
WP_002215847.1|1650429_1651101_+	lipoprotein	NA	NA	NA	NA	NA
WP_002215846.1|1651127_1651484_+	DUF4810 domain-containing protein	NA	NA	NA	NA	NA
WP_002211607.1|1651480_1652137_+	DUF799 domain-containing protein	NA	NA	NA	NA	NA
WP_002211606.1|1652382_1652952_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_002228419.1|1652948_1653545_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	49.2	9.2e-44
WP_002211604.1|1654026_1654803_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	41.4	3.9e-42
WP_002211603.1|1654804_1655422_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	1.1e-87
WP_002211602.1|1655433_1657860_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.4	1.1e-255
WP_002211601.1|1658690_1659539_+	DUF4225 domain-containing protein	NA	NA	NA	NA	NA
WP_002354621.1|1659768_1660248_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002211599.1|1660714_1661239_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_002211598.1|1661311_1662361_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	3.9e-21
WP_002215840.1|1662357_1663944_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002211596.1|1663999_1665019_-	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211594.1|1665347_1666442_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_002211590.1|1667707_1668310_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002215321.1|1668667_1669150_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_002211588.1|1669146_1670829_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002224806.1|1670829_1671531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211586.1|1671527_1672865_-	glycosyl transferase	NA	A0A292GJ55	Xanthomonas_phage	32.8	2.0e-70
WP_002215319.1|1672904_1673936_-	fimbrial protein	NA	NA	NA	NA	NA
WP_002211584.1|1673942_1675124_-	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_002211583.1|1675222_1676248_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211582.1|1676247_1678128_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_002215317.1|1678910_1681586_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.3	1.0e-81
WP_002211580.1|1681786_1682332_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211579.1|1682488_1683250_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_002215157.1|1683377_1684928_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002209743.1|1684949_1686158_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211577.1|1686182_1687373_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002211576.1|1687357_1687966_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002211575.1|1688070_1688595_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002211574.1|1688618_1690121_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211573.1|1690446_1690932_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_002211572.1|1691205_1691745_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211571.1|1691748_1693098_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 5
NZ_CP045145	Yersinia pestis strain SCPM-O-B-6899 (231) chromosome, complete genome	4625829	2020162	2038133	4625829	protease,transposase,coat	Escherichia_phage(50.0%)	15	NA	NA
WP_000255944.1|2020162_2021185_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002215943.1|2021591_2021981_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_002210859.1|2022090_2022330_-	YebV family protein	NA	NA	NA	NA	NA
WP_002210858.1|2022537_2023527_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_002210857.1|2023732_2026180_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_002210856.1|2026350_2027103_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002216611.1|2027133_2027691_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216613.1|2027711_2028242_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002210852.1|2028247_2028802_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_002216616.1|2029280_2031932_-	PqiB family protein	NA	NA	NA	NA	NA
WP_002367629.1|2031900_2033148_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_002210850.1|2033379_2033877_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002210849.1|2033972_2034686_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_002210848.1|2034705_2036778_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
WP_002210847.1|2037251_2038133_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 6
NZ_CP045145	Yersinia pestis strain SCPM-O-B-6899 (231) chromosome, complete genome	4625829	2328663	2437794	4625829	lysis,integrase,transposase,tail	Escherichia_phage(14.04%)	109	2333663:2333706	2446809:2446852
WP_002209743.1|2328663_2329872_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002210642.1|2329907_2330666_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_002210643.1|2330966_2331263_+	YciI family protein	NA	NA	NA	NA	NA
WP_002217646.1|2331485_2331731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210644.1|2331846_2332110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210646.1|2332330_2332870_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	42.4	2.1e-26
WP_002388651.1|2333298_2333475_-	YciY family protein	NA	NA	NA	NA	NA
2333663:2333706	attL	AGGAGTAAAGCGTCCGCGCCAAGGATGGCGCGGCTCGAGCCTAC	NA	NA	NA	NA
WP_002210648.1|2333916_2335377_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_002210649.1|2335541_2335865_+	YciU family protein	NA	NA	NA	NA	NA
WP_002210650.1|2336163_2336379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210651.1|2336939_2337941_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	4.7e-24
WP_002210652.1|2337937_2338939_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.2e-14
WP_025470761.1|2338950_2339859_-	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_002210654.1|2339874_2340795_-	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_002218177.1|2340881_2342519_-	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_002210656.1|2343356_2344001_-	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_002210657.1|2344807_2347483_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000255944.1|2348022_2349045_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|2349044_2349824_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210659.1|2350192_2350783_-	thymidine kinase	NA	A0A1Z1LYD5	Serratia_phage	55.8	1.5e-54
WP_002223593.1|2351532_2351940_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_002210664.1|2352374_2353721_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.3	1.9e-81
WP_002210665.1|2354027_2355044_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_002213759.1|2355930_2356389_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002210666.1|2357088_2357553_+	YchJ family protein	NA	NA	NA	NA	NA
WP_002210667.1|2357636_2358506_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	37.3	5.5e-13
WP_002209743.1|2358468_2359677_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211665.1|2360548_2361409_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211667.1|2362218_2363025_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_002211668.1|2363122_2363509_+	pyrimidine (deoxy)nucleoside triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002211669.1|2363521_2363812_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_002211670.1|2363808_2365734_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.4	4.2e-37
WP_002211671.1|2365795_2366842_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_002211673.1|2367066_2367618_-	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_002211674.1|2367780_2369631_+	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_002211675.1|2369747_2370764_+	asparaginase	NA	NA	NA	NA	NA
WP_002211676.1|2370778_2371426_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	33.0	1.8e-21
WP_002217933.1|2371559_2371832_-	YeaC family protein	NA	NA	NA	NA	NA
WP_002211677.1|2371902_2372316_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002224141.1|2372663_2373659_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016579925.1|2373972_2374848_+	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_002430110.1|2374920_2375670_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_002211681.1|2376113_2378048_+	protein kinase YeaG	NA	NA	NA	NA	NA
WP_002216501.1|2378197_2379472_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	1.5e-11
WP_002211683.1|2379579_2380698_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002211684.1|2380732_2381638_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211685.1|2381835_2382705_+	pirin family protein	NA	NA	NA	NA	NA
WP_002216508.1|2382969_2384172_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	29.1	7.6e-29
WP_002211686.1|2384187_2385492_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_002211687.1|2385957_2387493_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_002211688.1|2387710_2388430_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_002211689.1|2388673_2390248_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_002227934.1|2390483_2391014_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_002214494.1|2391430_2391787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211692.1|2392878_2393619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211693.1|2393635_2394835_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
WP_002214492.1|2394838_2396011_+	MFS transporter	NA	NA	NA	NA	NA
WP_002209743.1|2396315_2397524_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_097608205.1|2397744_2398113_-|tail	phage tail protein	tail	B6SCW7	Bacteriophage	42.0	5.0e-08
WP_002211696.1|2398174_2399092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211697.1|2399108_2400107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211698.1|2400106_2403310_-	host specificity protein J	NA	F1C571	Cronobacter_phage	60.5	0.0e+00
WP_002359202.1|2403485_2403707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211700.1|2403881_2404502_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	57.0	3.2e-55
WP_002211701.1|2404557_2404773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002214482.1|2404915_2405467_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	58.0	9.5e-27
WP_002211704.1|2405565_2406573_-	hypothetical protein	NA	A0A2H4J0P1	uncultured_Caudovirales_phage	33.0	4.1e-36
WP_002211705.1|2406646_2406814_-	hypothetical protein	NA	G9L6D7	Escherichia_phage	61.8	5.2e-13
WP_002211706.1|2406937_2407369_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	58.4	2.5e-30
WP_002211707.1|2407447_2408080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211708.1|2408340_2409051_-	peptidase P60	NA	K7P6F5	Enterobacteria_phage	76.8	1.3e-108
WP_002211709.1|2409053_2409806_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
WP_002213759.1|2409926_2410385_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002211710.1|2410690_2411032_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	50.0	1.7e-21
WP_002211711.1|2411034_2414538_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	33.2	5.2e-118
WP_071525538.1|2414538_2414799_-	hypothetical protein	NA	A0A0S2SY90	Pseudomonas_phage	50.0	3.7e-13
WP_002211712.1|2414846_2415158_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	58.3	1.4e-30
WP_002211713.1|2415170_2416091_-|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	49.1	4.4e-61
WP_002211714.1|2416156_2416564_-	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_002211715.1|2416560_2417145_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.6e-48
WP_002211716.1|2417146_2417497_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	56.0	6.9e-31
WP_002211717.1|2417498_2417753_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	53.1	2.2e-18
WP_002211718.1|2417749_2418232_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	46.1	6.4e-27
WP_002211719.1|2418279_2419485_-	hypothetical protein	NA	A0A1B0VMF8	Pseudomonas_phage	79.2	1.8e-142
WP_002211720.1|2419498_2420272_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	62.3	2.8e-69
WP_002211721.1|2420393_2421506_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	58.2	6.0e-121
WP_002228446.1|2421506_2422148_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	54.1	3.8e-59
WP_002228445.1|2422166_2422895_-	hypothetical protein	NA	A0A1B0VMH0	Pseudomonas_phage	51.4	4.6e-61
WP_002211722.1|2422894_2423869_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	81.1	2.3e-153
WP_002209743.1|2423873_2425082_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211723.1|2425129_2425714_-	hypothetical protein	NA	A0A0R6PHH0	Moraxella_phage	70.7	4.8e-69
WP_002211724.1|2425717_2426167_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	72.9	1.0e-47
WP_002211725.1|2426197_2426833_-	hypothetical protein	NA	I6S676	Salmonella_phage	71.4	7.2e-87
WP_002211727.1|2427289_2428003_-	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	60.2	7.6e-69
WP_002211729.1|2428548_2429007_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	45.3	4.9e-21
WP_002211730.1|2428991_2429504_-	lysozyme	NA	I6PBN2	Cronobacter_phage	61.6	9.7e-50
WP_002430108.1|2429534_2429732_-	hypothetical protein	NA	B6SD15	Bacteriophage	64.4	4.9e-18
WP_002215644.1|2429977_2430253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211731.1|2430249_2430459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211732.1|2430882_2431446_-	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
WP_002215638.1|2431494_2431713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215636.1|2431716_2432106_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
WP_002211735.1|2432106_2432712_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
WP_002211736.1|2432785_2433232_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
WP_071525537.1|2433207_2433957_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
WP_002215632.1|2434256_2434517_+	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
WP_001297096.1|2434684_2435464_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|2435463_2436486_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211738.1|2436555_2437794_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
2446809:2446852	attR	AGGAGTAAAGCGTCCGCGCCAAGGATGGCGCGGCTCGAGCCTAC	NA	NA	NA	NA
>prophage 7
NZ_CP045145	Yersinia pestis strain SCPM-O-B-6899 (231) chromosome, complete genome	4625829	2899984	2944502	4625829	lysis,plate,transposase,tRNA	Indivirus(14.29%)	36	NA	NA
WP_002211870.1|2899984_2902012_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
WP_002213775.1|2902175_2902634_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002228565.1|2902851_2903514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211975.1|2904211_2905288_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002211974.1|2905305_2906559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211973.1|2906891_2908073_+	MFS transporter	NA	NA	NA	NA	NA
WP_002211971.1|2908314_2908722_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002211970.1|2908718_2909414_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_016580979.1|2909739_2910624_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_002211968.1|2910979_2912677_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002211966.1|2912957_2913695_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_002211965.1|2914139_2915150_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_002211964.1|2915170_2916691_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.6e-10
WP_002211963.1|2916920_2917913_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_002211961.1|2918660_2919827_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_002211960.1|2919881_2920544_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
WP_002211959.1|2920727_2921879_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_002211958.1|2922014_2922884_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002211957.1|2923157_2924297_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.9	5.2e-35
WP_002211956.1|2924317_2925160_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_002227980.1|2925416_2925629_+	peptide antibiotic darobactin C	NA	NA	NA	NA	NA
WP_002215886.1|2925712_2928073_+	darobactin export ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002211952.1|2928074_2929337_+	darobactin export ABC transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002211951.1|2929338_2930007_+	darobactin export ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
WP_016581226.1|2930016_2931327_+	darobactin maturation radical SAM/SPASM protein DarE	NA	NA	NA	NA	NA
WP_002211949.1|2931861_2933136_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_002211948.1|2933137_2933908_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_002209743.1|2934043_2935252_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002211947.1|2935295_2935949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002227996.1|2936176_2937772_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
WP_002211945.1|2938454_2939078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211944.1|2939289_2940657_-	membrane protein	NA	NA	NA	NA	NA
WP_002211943.1|2940681_2941134_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_002214552.1|2941133_2941715_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002211941.1|2941689_2942775_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002211940.1|2942738_2944502_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 8
NZ_CP045145	Yersinia pestis strain SCPM-O-B-6899 (231) chromosome, complete genome	4625829	2969367	3036460	4625829	protease,plate,transposase,tRNA	Streptococcus_phage(20.0%)	56	NA	NA
WP_002213011.1|2969367_2970720_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002214707.1|2970731_2972282_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002213014.1|2972324_2972825_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002213016.1|2973813_2974662_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_002213017.1|2974760_2975009_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_002228570.1|2975046_2975487_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_002213024.1|2975573_2976362_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213025.1|2976364_2977117_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_002213026.1|2977118_2977838_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002213028.1|2977830_2979069_-	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_002213030.1|2979084_2979822_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002213032.1|2979823_2981107_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_002213034.1|2981096_2981621_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_002213036.1|2981884_2982103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213038.1|2982833_2983580_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.4	3.3e-14
WP_002213039.1|2983733_2986151_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002213046.1|2989796_2990126_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_002213049.1|2990177_2990456_-	acylphosphatase	NA	NA	NA	NA	NA
WP_002213052.1|2990549_2991740_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	28.1	2.1e-26
WP_002213054.1|2991800_2992118_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_002213056.1|2992226_2992643_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_002213058.1|2992958_2993639_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_002213060.1|2993817_2994282_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_002221095.1|2994342_2996397_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	25.8	1.5e-16
WP_002213062.1|2996590_2997037_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002213063.1|2997066_2999205_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_002213064.1|2999306_2999942_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_002213065.1|3000170_3000677_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_002213066.1|3001034_3002096_+	porin OmpA	NA	NA	NA	NA	NA
WP_002213775.1|3002285_3002744_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002226586.1|3002912_3003368_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002224683.1|3003578_3005330_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_002220006.1|3005398_3005917_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_002211286.1|3006182_3006371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255944.1|3007004_3008027_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3008026_3008806_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002213775.1|3009966_3010425_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002228015.1|3010622_3010790_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_002211289.1|3011059_3011638_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_002211290.1|3012011_3013664_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_002211291.1|3013650_3014937_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_002211292.1|3015065_3016979_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.5e-47
WP_002211293.1|3016984_3019105_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_002363919.1|3019207_3020317_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_002211295.1|3020342_3020894_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_002211296.1|3021076_3022087_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_002220013.1|3022695_3025311_-	aminopeptidase N	NA	NA	NA	NA	NA
WP_002228013.1|3026026_3027232_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002211301.1|3027730_3029131_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.2	6.5e-80
WP_002354007.1|3029431_3030511_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	56.5	3.2e-111
WP_002211303.1|3030767_3031958_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_002430096.1|3032111_3032228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211304.1|3032381_3033029_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.3	2.2e-22
WP_002211305.1|3033089_3033638_-	YcbK family protein	NA	A0A0K1LLY2	Rhodobacter_phage	34.7	7.8e-05
WP_002217987.1|3033861_3035718_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_002213775.1|3036001_3036460_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP045145	Yersinia pestis strain SCPM-O-B-6899 (231) chromosome, complete genome	4625829	3207009	3225374	4625829	plate,transposase,coat,tail	Vibrio_phage(25.0%)	19	NA	NA
WP_002213775.1|3207009_3207468_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002208835.1|3207668_3208673_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.7	3.1e-84
WP_002208836.1|3208850_3209078_+	YejL family protein	NA	NA	NA	NA	NA
WP_002208837.1|3209105_3210902_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_002230704.1|3211132_3211516_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.7	7.8e-36
WP_002208839.1|3211872_3213021_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_002208840.1|3213033_3213522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208841.1|3214221_3214584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002208842.1|3214709_3216146_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002208843.1|3216436_3217177_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002208845.1|3217474_3218254_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
WP_002208846.1|3218350_3218698_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
WP_002215458.1|3218694_3218955_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_002208847.1|3218951_3220088_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
WP_002208848.1|3220091_3220547_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
WP_002215460.1|3220543_3221140_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
WP_002208850.1|3221155_3222211_-|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
WP_002208852.1|3222207_3223614_-	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
WP_002208853.1|3223880_3225374_-|coat	coat protein	coat	NA	NA	NA	NA
>prophage 10
NZ_CP045145	Yersinia pestis strain SCPM-O-B-6899 (231) chromosome, complete genome	4625829	3303500	3339716	4625829	transposase,holin,tRNA	uncultured_virus(12.5%)	30	NA	NA
WP_002228612.1|3303500_3304439_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
WP_002210776.1|3304738_3305668_-	DUF4097 domain-containing protein	NA	NA	NA	NA	NA
WP_002213759.1|3306082_3306541_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209743.1|3308352_3309561_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002223532.1|3309735_3310050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228617.1|3310133_3310370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016256670.1|3310510_3310837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228620.1|3310870_3311065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002220152.1|3312278_3313634_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.6	4.1e-55
WP_002220154.1|3314024_3314735_+	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_002220156.1|3314786_3315773_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_002220158.1|3315786_3317529_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.6	6.3e-24
WP_002220159.1|3317533_3318709_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002220162.1|3318721_3319828_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002220163.1|3319866_3320193_-	EthD family reductase	NA	NA	NA	NA	NA
WP_002220165.1|3320203_3320431_-	N5,N10-methylene tetrahydromethanopterin reductase	NA	NA	NA	NA	NA
WP_002220168.1|3320985_3321897_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002220169.1|3321897_3323007_-	alkene reductase	NA	NA	NA	NA	NA
WP_002220170.1|3323354_3324719_-	sigma 54-interacting transcriptional regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.1	1.3e-05
WP_002220171.1|3324705_3326520_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.4	1.0e-16
WP_002220173.1|3326877_3327351_+	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
WP_002213759.1|3328156_3328615_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002214195.1|3329543_3330407_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
WP_002214197.1|3330752_3331601_+	DMT family transporter	NA	NA	NA	NA	NA
WP_002214199.1|3331638_3332532_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002228035.1|3332763_3334812_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
WP_002218278.1|3335176_3335773_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_016581311.1|3335830_3337303_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002220180.1|3337325_3339029_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	9.4e-57
WP_002213775.1|3339257_3339716_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP045145	Yersinia pestis strain SCPM-O-B-6899 (231) chromosome, complete genome	4625829	3409430	3415602	4625829	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_002210709.1|3409430_3409631_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
WP_002215949.1|3409630_3410173_+	ash family protein	NA	NA	NA	NA	NA
WP_002215950.1|3410165_3411125_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
WP_002210707.1|3411121_3412210_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
WP_002210705.1|3412558_3412873_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_002215951.1|3412878_3413196_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
WP_000255944.1|3413800_3414823_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|3414822_3415602_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
>prophage 12
NZ_CP045145	Yersinia pestis strain SCPM-O-B-6899 (231) chromosome, complete genome	4625829	3656871	3732226	4625829	protease,plate,transposase,tRNA	Staphylococcus_phage(25.0%)	54	NA	NA
WP_002213759.1|3656871_3657330_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
WP_002209965.1|3657637_3659632_-	transketolase	NA	NA	NA	NA	NA
WP_002209967.1|3660122_3660875_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_071525520.1|3661020_3661131_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002209968.1|3661164_3661485_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_002213775.1|3661695_3662154_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002209969.1|3662354_3664334_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_002209971.1|3665540_3666695_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.1	1.7e-126
WP_002228653.1|3666887_3667400_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_002209973.1|3667497_3668205_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002209975.1|3668456_3669188_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002209976.1|3669213_3670173_+	glutathione synthase	NA	NA	NA	NA	NA
WP_002209977.1|3670288_3670852_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_002209978.1|3670851_3671274_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_002209979.1|3671453_3672338_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	51.0	3.1e-80
WP_002209980.1|3672341_3673457_+	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	50.7	3.0e-96
WP_002209981.1|3673565_3674690_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_002215609.1|3674709_3675408_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_002209983.1|3675540_3676362_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_002209984.1|3676649_3677204_+	YggT family protein	NA	NA	NA	NA	NA
WP_002215612.1|3677200_3677491_+	YggU family protein	NA	NA	NA	NA	NA
WP_002215614.1|3677590_3678184_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_002209987.1|3678176_3679307_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_002224905.1|3679496_3688829_-	phage minor structural protein	NA	NA	NA	NA	NA
WP_002209989.1|3690168_3691095_-	glutaminase B	NA	NA	NA	NA	NA
WP_002209990.1|3691205_3691532_-	YggL family protein	NA	NA	NA	NA	NA
WP_002209991.1|3691531_3692251_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_002228057.1|3692588_3693704_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002209994.1|3693881_3694154_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_002209995.1|3694336_3695413_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_002209997.1|3695712_3696813_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002209998.1|3696916_3698950_+	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	4.5e-05
WP_002209999.1|3699032_3700016_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002210000.1|3700048_3701548_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	5.2e-19
WP_002210001.1|3701593_3702553_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002210002.1|3703108_3705271_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_002210005.1|3706599_3707235_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_086016632.1|3707842_3708540_-|transposase	IS1 family transposase	transposase	A0A0U2RK18	Escherichia_phage	48.5	1.3e-60
WP_002210008.1|3708635_3709403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210009.1|3709389_3711687_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002210010.1|3711702_3712338_-	DUF2345 domain-containing protein	NA	NA	NA	NA	NA
WP_002216110.1|3713562_3713757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016257642.1|3713940_3714297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210011.1|3714440_3716663_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_002210012.1|3716677_3719026_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.3	3.1e-18
WP_002210013.1|3719022_3721671_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	29.5	4.8e-92
WP_002210014.1|3722088_3722580_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_002228049.1|3722583_3724320_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210015.1|3724319_3725006_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002211664.1|3725002_3726355_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002215896.1|3726366_3727911_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002211662.1|3727953_3728454_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002215900.1|3730729_3731125_-	lipoprotein	NA	NA	NA	NA	NA
WP_002215902.1|3731575_3732226_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 13
NZ_CP045145	Yersinia pestis strain SCPM-O-B-6899 (231) chromosome, complete genome	4625829	4007873	4083745	4625829	plate,transposase	Escherichia_phage(20.0%)	56	NA	NA
WP_000255944.1|4007873_4008896_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|4008895_4009675_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002210424.1|4009936_4010323_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
WP_002210426.1|4010617_4013332_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_002210427.1|4013409_4013943_-	secA regulator SecM	NA	NA	NA	NA	NA
WP_002210428.1|4013971_4014496_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
WP_002228285.1|4014662_4015583_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002210430.1|4015682_4016834_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_002210431.1|4016906_4018163_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_002228100.1|4018189_4019017_-	cell division protein FtsQ	NA	NA	NA	NA	NA
WP_002210432.1|4019018_4019939_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002216457.1|4019931_4021407_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002210434.1|4021544_4022615_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002210435.1|4022611_4023814_-	cell division protein FtsW	NA	NA	NA	NA	NA
WP_002210436.1|4023813_4025130_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_002210437.1|4025132_4026215_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_002210438.1|4026208_4027585_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002210439.1|4027581_4029069_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002210440.1|4029055_4030819_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_002210441.1|4030884_4031202_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_002210442.1|4031198_4032161_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_002210443.1|4032163_4032622_-	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_087768171.1|4033176_4033266_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002210446.1|4033723_4034164_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002210447.1|4034294_4035305_-	catabolite repressor/activator	NA	NA	NA	NA	NA
WP_002213775.1|4035809_4036268_-|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002424260.1|4036466_4036991_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002228103.1|4036963_4038691_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
WP_002216437.1|4039150_4040956_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
WP_002216434.1|4041509_4042466_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
WP_002210452.1|4043143_4043359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050882072.1|4043787_4044246_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210453.1|4044392_4045955_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002210454.1|4045957_4047049_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_002210455.1|4047050_4048481_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_002210456.1|4048495_4049098_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_002224086.1|4049338_4050520_-	MFS transporter	NA	NA	NA	NA	NA
WP_002210461.1|4051183_4052845_+	HTH-type transcriptional regulator SgrR	NA	NA	NA	NA	NA
WP_002214274.1|4053784_4054777_+	thiamine ABC transporter substrate binding subunit	NA	NA	NA	NA	NA
WP_002214276.1|4054752_4056360_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_002210464.1|4056346_4057057_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	34.1	1.0e-20
WP_002210465.1|4057125_4057893_-	DedA family protein	NA	NA	NA	NA	NA
WP_002210466.1|4058088_4060458_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.5e-31
WP_002220588.1|4060918_4063825_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.6	3.0e-23
WP_002210468.1|4064080_4064434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210469.1|4067958_4069569_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002210470.1|4069565_4070921_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002210471.1|4071040_4071532_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_002214737.1|4071524_4071890_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_002210473.1|4071895_4072513_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_002214739.1|4072505_4073609_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002224087.1|4073634_4075854_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_002210474.1|4075866_4078215_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.9	2.1e-14
WP_002210475.1|4078318_4080907_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	28.7	1.9e-77
WP_002210476.1|4080924_4081908_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002210477.1|4081900_4083745_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 14
NZ_CP045145	Yersinia pestis strain SCPM-O-B-6899 (231) chromosome, complete genome	4625829	4209208	4273489	4625829	plate,transposase	Escherichia_phage(28.57%)	46	NA	NA
WP_071525507.1|4209208_4209547_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002209171.1|4209890_4211264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002209170.1|4211235_4211958_-	histidine kinase	NA	NA	NA	NA	NA
WP_002209169.1|4212007_4213333_-	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_002209167.1|4214356_4215673_-	McrC family protein	NA	NA	NA	NA	NA
WP_002209166.1|4215669_4217733_-	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	33.2	5.3e-30
WP_000255944.1|4217866_4218889_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|4218888_4219668_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_086016626.1|4220332_4221432_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	2.2e-46
WP_002218887.1|4227102_4227288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210692.1|4227755_4229345_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.4	2.2e-68
WP_002210691.1|4229404_4230691_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002355296.1|4230838_4231492_-	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_002210689.1|4231541_4231817_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	55.6	3.6e-19
WP_002210688.1|4232005_4232596_-	YjaG family protein	NA	NA	NA	NA	NA
WP_002210687.1|4232641_4233382_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_002210686.1|4233411_4234479_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_002210685.1|4234597_4235383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210684.1|4235475_4236258_-	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_002210683.1|4236354_4236864_+	sigma D regulator	NA	NA	NA	NA	NA
WP_002210682.1|4237239_4239285_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_002210681.1|4239271_4239946_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_002210680.1|4239935_4240733_+	HesA/MoeB/ThiF family protein	NA	A0A1V0SAV8	Catovirus	27.8	1.6e-11
WP_002217275.1|4240729_4240945_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_002228257.1|4240946_4241762_+	thiazole synthase	NA	NA	NA	NA	NA
WP_002210678.1|4241754_4242885_+	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_002213775.1|4243316_4243775_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	NA	NA	NA	NA
WP_002210677.1|4243901_4248122_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.0	8.5e-67
WP_002210676.1|4248250_4252279_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	1.2e-22
WP_002210675.1|4252621_4252990_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_002210674.1|4253056_4253554_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002210673.1|4253918_4254623_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002210672.1|4254626_4255055_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_002210671.1|4255245_4255791_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
WP_002210670.1|4255792_4256176_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002210669.1|4256426_4257611_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
WP_001297096.1|4258667_4259447_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|4259446_4260469_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002217850.1|4260558_4261110_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002212290.1|4261320_4262271_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.2	8.7e-28
WP_002212289.1|4262305_4263265_-	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_002212288.1|4263261_4264299_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_002218887.1|4269966_4270152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002215920.1|4270435_4270969_-	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_002211550.1|4270990_4272442_-	Trk system potassium transporter TrkH	NA	NA	NA	NA	NA
WP_002213759.1|4273030_4273489_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP045147	Yersinia pestis strain SCPM-O-B-6899 (231) plasmid pCD, complete sequence	70303	8910	67503	70303	protease,transposase	Enterobacteria_phage(42.86%)	60	NA	NA
WP_000255944.1|8910_9933_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002213278.1|10596_12003_+	T3SS effector protein-tyrosine-phosphatase YopH	NA	NA	NA	NA	NA
WP_002212907.1|14091_14439_-	type III secretion system exported negative regulator LcrQ/YscM1	NA	NA	NA	NA	NA
WP_002212909.1|14663_15296_-	HrpE/YscL family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_002361471.1|15274_15904_-	type III secretion system sorting platform protein YscK	NA	NA	NA	NA	NA
WP_002212912.1|15903_16638_-	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_002212914.1|16644_16992_-	type III secretion system inner rod subunit SctI	NA	NA	NA	NA	NA
WP_002212915.1|16992_17490_-	YopR family type III secretion effector	NA	NA	NA	NA	NA
WP_002229801.1|17486_17834_-	YscG family type III secretion protein	NA	NA	NA	NA	NA
WP_002212916.1|17835_18099_-	type III secretion system needle filament subunit SctF	NA	NA	NA	NA	NA
WP_002212917.1|18099_18300_-	EscE/YscE/SsaE family type III secretion system needle protein co-chaperone	NA	NA	NA	NA	NA
WP_002212919.1|18296_19556_-	type III secretion system inner membrane ring subunit SctD	NA	NA	NA	NA	NA
WP_002212923.1|19552_21376_-	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_002212925.1|21381_21795_-	type III secretion system chaperone YscB	NA	NA	NA	NA	NA
WP_002229797.1|22020_22119_-	type III secretion system protein YscA	NA	NA	NA	NA	NA
WP_002212931.1|22197_23013_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002222527.1|23136_23532_-	type III secretion system chaperone YscW	NA	NA	NA	NA	NA
WP_002212936.1|24107_25172_-	type III secretion system export apparatus switch protein YscU	NA	NA	NA	NA	NA
WP_002212938.1|25171_25957_-	type III secretion system export apparatus protein SctT	NA	NA	NA	NA	NA
WP_002212945.1|25953_26220_-	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_002212947.1|26221_26875_-	type III secretion system export apparatus protein SctR	NA	NA	NA	NA	NA
WP_002212948.1|26871_27795_-	YscQ/HrcQ family type III secretion apparatus protein	NA	NA	NA	NA	NA
WP_002212950.1|27791_29159_-	type III secretion system needle length determinant	NA	NA	NA	NA	NA
WP_002212952.1|29158_29623_-	type III secretion system central stalk protein YscO	NA	NA	NA	NA	NA
WP_002212955.1|29619_30939_-	EscN/YscN/HrcN family type III secretion system ATPase	NA	NA	NA	NA	NA
WP_002212958.1|31136_32018_+	type III secretion system gatekeeper subunit YopN	NA	NA	NA	NA	NA
WP_002212965.1|31998_32277_+	type III secretion system gatekeeper subunit TyeA	NA	NA	NA	NA	NA
WP_002229794.1|32263_32635_+	type III secretion chaperone SycN	NA	NA	NA	NA	NA
WP_002212969.1|32631_33000_+	type III secretion system protein YscX	NA	NA	NA	NA	NA
WP_002229791.1|32996_33341_+	type III secretion system chaperone YscY	NA	NA	NA	NA	NA
WP_002212971.1|33327_35442_+	type III secretion system export apparatus subunit SctV	NA	NA	NA	NA	NA
WP_002220918.1|35438_35879_+	type III secretion system regulator LcrR	NA	NA	NA	NA	NA
WP_002212973.1|35920_36208_+	type III secretion protein LcrG	NA	NA	NA	NA	NA
WP_002212981.1|36209_37190_+	type III secretion system protein LcrV	NA	NA	NA	NA	NA
WP_002222758.1|37202_37709_+	type III secretion system chaperone LcrH	NA	NA	NA	NA	NA
WP_002212985.1|37686_38892_+	type III secretion system translocon subunit YopB	NA	NA	NA	NA	NA
WP_002212987.1|38910_39831_+	type III secretion system translocon subunit YopD	NA	NA	NA	NA	NA
WP_002229781.1|40956_41166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002222517.1|41496_42789_+	T3SS effector E3 ubiquitin ligase YopM	NA	NA	NA	NA	NA
WP_116442925.1|43030_43276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002393889.1|44024_44375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213004.1|45148_45547_-	type III secretion system chaperone SycT	NA	NA	NA	NA	NA
WP_002213006.1|45546_46515_-|protease	T3SS effector cysteine protease YopT	protease	NA	NA	NA	NA
WP_002213007.1|47014_47563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002229770.1|48160_48790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002220902.1|50801_51968_+	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
WP_002213354.1|51964_52930_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	3.1e-89
WP_154020274.1|53089_53326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002224342.1|54192_54435_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_002213360.1|54427_54727_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002229754.1|54866_55526_-	type III secretion system effector GTPase activator YopE	NA	NA	NA	NA	NA
WP_002213403.1|55719_56112_+	YopE transcriptional regulator YerA	NA	NA	NA	NA	NA
WP_002220893.1|56921_58094_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.4	1.6e-220
WP_002213267.1|58868_59294_+	type III secretion system chaperone SycH	NA	NA	NA	NA	NA
WP_086016640.1|59441_60541_-|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
WP_002229829.1|60640_60970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002224338.1|61108_61573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002213258.1|61591_62143_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
WP_002213256.1|62306_64622_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.6	1.0e-279
WP_042469136.1|67233_67503_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP045146	Yersinia pestis strain SCPM-O-B-6899 (231) plasmid pMT, complete sequence	100979	0	97793	100979	tail,terminase,integrase,transposase	Salmonella_phage(79.22%)	98	13544:13561	26602:26619
WP_002214164.1|0_1065_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
WP_002222711.1|1633_1846_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
WP_002227818.1|1845_2181_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
WP_002228796.1|2177_2357_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
WP_002228797.1|2397_2673_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
WP_002222869.1|2740_3151_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
WP_002222868.1|3134_3506_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
WP_002222866.1|3659_4490_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
WP_002213439.1|4493_4694_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
WP_161597819.1|4784_5816_-	recombinase	NA	J9Q736	Salmonella_phage	99.1	6.9e-196
WP_000920226.1|5863_6130_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_002225551.1|6129_7074_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
WP_002213135.1|8277_8709_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.6e-72
WP_002215095.1|8929_9181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002213141.1|9253_9817_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
WP_002425587.1|9846_10272_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.5e-72
WP_002221186.1|10286_13811_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.2	0.0e+00
13544:13561	attL	CCAATGATTCCATACATC	NA	NA	NA	NA
WP_002211767.1|13991_15227_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
WP_002211766.1|15323_17690_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
WP_002228800.1|17799_18012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002228802.1|18274_18661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002353208.1|18655_19759_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
WP_002216410.1|20518_21031_-	F1 capsule protein	NA	NA	NA	NA	NA
WP_002211763.1|21111_23613_-	F1 capsule-anchoring protein	NA	NA	NA	NA	NA
WP_002211762.1|23637_24414_-	chaperone Caf1M	NA	NA	NA	NA	NA
WP_002211761.1|24741_25647_+	F1 operon transcriptional regulator Caf1R	NA	NA	NA	NA	NA
WP_002224363.1|26161_26467_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	97.0	3.2e-48
WP_002224361.1|26612_26828_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	7.7e-33
26602:26619	attR	GATGTATGGAATCATTGG	NA	NA	NA	NA
WP_002233024.1|26987_28025_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.4	1.8e-207
WP_001297096.1|28100_28880_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_000255944.1|28879_29902_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_002211744.1|30025_32035_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
WP_002211745.1|32107_32338_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_002211746.1|33050_33557_-	antirestriction protein	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
WP_002211747.1|33955_34735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002215082.1|34788_35208_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_002211748.1|35218_35440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|35439_36117_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_002211750.1|36617_36818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002228775.1|36979_38377_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_002215070.1|38755_39727_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
WP_002211752.1|39723_40929_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
WP_002211753.1|41230_41458_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002215068.1|41457_41784_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002211754.1|41983_42604_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
WP_002215065.1|42669_43611_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.0e-68
WP_002211756.1|43633_43909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211757.1|44647_45136_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_002211758.1|45213_46977_+	phospholipase D	NA	NA	NA	NA	NA
WP_002211760.1|49052_50075_-|transposase	IS110-like element IS1618 family transposase	transposase	NA	NA	NA	NA
WP_002209743.1|50543_51752_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
WP_002224263.1|51785_52508_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_002224265.1|52760_53555_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	3.7e-141
WP_002224267.1|53855_54113_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	94.1	1.3e-34
WP_000255944.1|54514_55537_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
WP_001297096.1|55536_56316_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
WP_002211769.1|56449_57058_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
WP_002211770.1|57359_60248_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.5e-11
WP_002211771.1|60328_60907_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.4e-27
WP_002214118.1|60963_65595_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
WP_002211773.1|65616_66204_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
WP_002211774.1|66191_66989_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
WP_002211775.1|66981_67680_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	7.1e-136
WP_000440566.1|67769_68105_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_002211776.1|68146_72724_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|72731_72956_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|73081_73399_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_002211778.1|73458_74205_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
WP_002211779.1|74279_74663_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
WP_002211780.1|74664_75138_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
WP_001027662.1|75128_75473_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_002211781.1|75570_76404_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
WP_002211782.1|76403_76838_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
WP_002211783.1|76881_77544_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
WP_002211784.1|77618_78494_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.7	8.5e-163
WP_002231160.1|78520_79417_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.3	3.9e-147
WP_002211786.1|79439_81014_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	2.4e-301
WP_002211787.1|81047_82304_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_002211788.1|82306_82948_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
WP_000176291.1|83143_83410_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|83419_84310_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_002211790.1|84315_84570_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
WP_002211791.1|84562_85201_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
WP_002211792.1|85197_85866_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
WP_002228791.1|85865_86564_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
WP_002211794.1|86628_88188_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
WP_002214131.1|88190_88469_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
WP_002211796.1|88528_88951_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
WP_002214134.1|88955_89483_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
WP_002211799.1|89806_90457_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
WP_002214137.1|90541_90769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002211801.1|91407_91890_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
WP_002211802.1|92095_92377_-	hypothetical protein	NA	J9Q753	Salmonella_phage	93.5	6.1e-46
WP_002213759.1|92576_93035_-|transposase	IS200/IS605-like element IS1541A family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
WP_002214145.1|93243_93813_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_002213303.1|93825_94572_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
WP_038918515.1|94561_94921_-	hypothetical protein	NA	J9Q741	Salmonella_phage	100.0	5.2e-58
WP_002213300.1|96707_97793_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
