The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045064	Enterobacter roggenkampii strain WCHER090065 chromosome, complete genome	4872204	12860	22311	4872204		Enterobacteria_phage(50.0%)	8	NA	NA
WP_152164581.1|12860_16049_+	DUF1983 domain-containing protein	NA	K7P7G9	Enterobacteria_phage	89.0	0.0e+00
WP_126287103.1|16407_17079_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	72.6	1.7e-86
WP_045409817.1|17186_17420_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	71.1	3.6e-28
WP_126287104.1|19313_19769_+	hypothetical protein	NA	M1FJ98	Enterobacteria_phage	53.8	4.0e-07
WP_126287105.1|19825_20068_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	72.2	1.1e-27
WP_126287106.1|20167_20407_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	73.1	3.4e-29
WP_126287107.1|20406_20727_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	65.1	1.2e-34
WP_059445231.1|21027_22311_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.3e-10
>prophage 2
NZ_CP045064	Enterobacter roggenkampii strain WCHER090065 chromosome, complete genome	4872204	820397	917776	4872204	tRNA,head,holin,terminase,integrase,protease,portal,tail,coat,capsid	Enterobacteria_phage(21.88%)	105	818444:818460	900014:900030
818444:818460	attL	TGCTGTCTTCATCCAGC	NA	NA	NA	NA
WP_014884290.1|820397_821279_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_008500478.1|821472_823521_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.8	1.1e-83
WP_008500477.1|823540_824227_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_008500476.1|824323_824821_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_008500475.1|824953_826237_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_008500474.1|826205_828839_+	PqiB family protein	NA	NA	NA	NA	NA
WP_046092768.1|828916_830359_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_008500472.1|830465_830705_+	YebV family protein	NA	NA	NA	NA	NA
WP_045372529.1|830739_831384_-	protein-serine/threonine phosphatase	NA	Q8HA16	Enterobacteria_phage	47.7	8.2e-54
WP_058653385.1|831550_832492_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_008500468.1|832897_833236_-	YebY family protein	NA	NA	NA	NA	NA
WP_126287158.1|833252_834122_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_058653388.1|834123_834495_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_008500465.1|834632_834863_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	9.1e-16
WP_008500464.1|834973_835624_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_008500463.1|835648_836311_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	34.8	1.1e-05
WP_058653390.1|836307_838368_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_058653392.1|838453_839104_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_058653394.1|839275_840454_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_008500459.1|840495_841137_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_023325516.1|841176_842988_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_008500457.1|843221_844697_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.0	7.8e-76
WP_008500456.1|845053_845923_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008500455.1|846060_847503_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_008500454.1|847549_848521_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_008500453.1|848641_849961_-	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	39.7	3.4e-14
WP_058653437.1|849976_850921_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_023293956.1|850998_851754_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.1	2.1e-16
WP_048029424.1|851750_852536_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_008500449.1|852588_853599_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.2	8.1e-08
WP_126287159.1|853607_854222_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003859749.1|854302_854824_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_008500447.1|854858_855599_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_008500446.1|855626_856070_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_008500445.1|856071_857844_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_058653395.1|858107_858674_+	hydrolase	NA	NA	NA	NA	NA
WP_126287160.1|859038_859278_+	DinI family protein	NA	K7P797	Enterobacteria_phage	92.4	3.5e-34
WP_126287161.1|859335_859749_-|tail	tail assembly chaperone	tail	K7P7H0	Enterobacteria_phage	97.8	2.1e-71
WP_126287162.1|859750_860611_-	hypothetical protein	NA	K7P7B1	Enterobacteria_phage	91.3	4.2e-146
WP_126287163.1|860620_861172_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	35.0	7.0e-22
WP_126287164.1|861772_864949_-	host specificity protein J	NA	O64335	Escherichia_phage	88.3	0.0e+00
WP_058673520.1|865001_865592_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	77.6	4.8e-77
WP_058673519.1|865650_866064_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	64.2	1.4e-51
WP_126287165.1|866093_866804_-	peptidase P60	NA	K7PGV2	Enterobacterial_phage	97.9	1.1e-144
WP_126287166.1|866805_867561_-|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	95.6	1.1e-139
WP_063922237.1|867557_867896_-|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	97.3	2.8e-61
WP_126287167.1|867898_871237_-|tail	phage tail tape measure protein	tail	K7PH87	Enterobacterial_phage	68.7	0.0e+00
WP_000050396.1|871271_871535_-	DUF4035 domain-containing protein	NA	K7P7L5	Enterobacteria_phage	98.9	8.5e-42
WP_126287168.1|871558_871960_-|tail	phage tail protein	tail	K7PGV0	Enterobacterial_phage	99.2	9.5e-69
WP_126287169.1|872014_872485_-|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	98.1	2.2e-80
WP_047389186.1|872539_872887_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	98.3	1.1e-57
WP_016063565.1|872883_873333_-	HK97 gp10 family phage protein	NA	K7PH84	Enterobacterial_phage	100.0	4.0e-76
WP_047352741.1|873329_873668_-|head	phage head closure protein	head	K7P7L2	Enterobacteria_phage	99.1	6.4e-58
WP_077883852.1|873667_873994_-	hypothetical protein	NA	K7PGU9	Enterobacterial_phage	95.4	3.5e-53
WP_047352742.1|874028_875186_-|capsid	phage major capsid protein	capsid	Q77WA0	Escherichia_phage	97.1	8.8e-208
WP_126287170.1|875188_875866_-|head,protease	HK97 family phage prohead protease	head,protease	K7PKL4	Enterobacterial_phage	99.6	1.2e-124
WP_126287171.1|875883_877158_-|portal	phage portal protein	portal	F1C584	Cronobacter_phage	97.4	2.6e-245
WP_126287172.1|877157_878672_-|terminase	terminase large subunit	terminase	Q9MCT1	Enterobacteria_phage	99.6	1.4e-293
WP_126287173.1|878678_879164_-|terminase	terminase	terminase	K7PGU7	Enterobacterial_phage	97.5	2.9e-80
WP_126287174.1|879347_879551_-	hypothetical protein	NA	A0A220NRN5	Escherichia_phage	79.1	1.7e-21
WP_001031354.1|879550_879892_-	HNH endonuclease	NA	K7PM05	Enterobacterial_phage	99.1	4.6e-64
WP_126287175.1|879888_880479_-	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	87.8	1.6e-101
WP_033146307.1|880459_880972_-	HNH endonuclease	NA	K7PJS8	Enterobacterial_phage	98.2	1.9e-98
WP_126287176.1|881012_882470_-	glycosyltransferase family 2 protein	NA	K7PKP3	Enterobacterial_phage	95.1	3.4e-281
WP_126287177.1|882481_882955_-	hypothetical protein	NA	K7PH02	Enterobacteria_phage	89.7	9.8e-73
WP_126287184.1|883080_883275_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	93.6	4.3e-19
WP_047633741.1|883231_883501_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	77.5	1.2e-27
WP_032665922.1|883497_884040_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	74.3	6.2e-79
WP_023150207.1|884039_884318_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	97.8	4.7e-43
WP_023150206.1|884307_884697_-	hypothetical protein	NA	G8C7V8	Escherichia_phage	99.2	8.9e-64
WP_023150205.1|885476_885962_-	HNH endonuclease	NA	A0A2I7RSG2	Vibrio_phage	43.2	6.0e-25
WP_053520795.1|886256_887039_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.4	6.3e-109
WP_126287178.1|887035_888007_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	80.7	9.5e-155
WP_063849193.1|888003_889623_-	DEAD/DEAH box helicase	NA	F1C598	Cronobacter_phage	87.4	2.2e-281
WP_000014299.1|890327_890549_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	98.6	1.5e-31
WP_110820212.1|890646_891315_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	98.2	1.0e-123
WP_126287179.1|891485_891800_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	88.5	6.3e-44
WP_110820211.1|891792_891981_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	96.8	3.9e-25
WP_110820210.1|892148_892508_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	67.5	3.0e-37
WP_110820208.1|892722_893136_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	65.0	4.0e-46
WP_110820207.1|893135_893714_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	68.2	9.8e-75
WP_045285663.1|893725_894469_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	94.3	8.6e-132
WP_110820206.1|894456_894843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110820205.1|894826_895072_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	84.0	3.5e-34
WP_110820204.1|895127_896441_+|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	86.5	3.8e-223
WP_126287180.1|896419_897193_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	79.5	1.8e-55
WP_021240443.1|897244_897640_+	membrane protein	NA	NA	NA	NA	NA
WP_008500441.1|897680_898424_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	2.0e-24
WP_058653399.1|898420_899392_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_126287185.1|899567_900311_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
900014:900030	attR	TGCTGTCTTCATCCAGC	NA	NA	NA	NA
WP_058653403.1|900380_900950_-	VOC family protein	NA	NA	NA	NA	NA
WP_058653405.1|901189_902923_+|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	36.6	1.3e-85
WP_044596634.1|902981_903374_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_087855432.1|903373_905452_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_021240449.1|905444_906593_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_008500432.1|906741_907386_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_008500431.1|907396_907786_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.2	7.7e-07
WP_008500430.1|907803_908853_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	2.3e-05
WP_126287181.1|908849_909716_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_058653408.1|909735_911337_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.9	2.1e-10
WP_058653411.1|911381_913049_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.7	9.3e-09
WP_025912281.1|913133_914096_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_058653413.1|914092_916477_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_023344438.1|916452_917211_-	molecular chaperone	NA	NA	NA	NA	NA
WP_032622788.1|917227_917776_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP045064	Enterobacter roggenkampii strain WCHER090065 chromosome, complete genome	4872204	1209154	1315529	4872204	head,terminase,plate,integrase,protease,portal,tail,lysis,capsid,transposase	Salmonella_phage(14.0%)	114	1287656:1287671	1301884:1301899
WP_008500916.1|1209154_1209850_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_126287267.1|1209979_1210864_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_008500918.1|1210991_1211708_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_058654907.1|1211832_1213221_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_008500921.1|1213272_1214283_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_087855400.1|1214298_1215819_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.5	1.2e-10
WP_008500923.1|1215898_1216897_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_008500924.1|1217192_1218215_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_058654872.1|1218370_1219528_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_008500927.1|1219547_1220216_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	55.8	6.9e-56
WP_058654870.1|1220318_1221467_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_058654868.1|1221605_1222433_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_025913183.1|1222536_1224507_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.9	1.6e-12
WP_008500931.1|1224731_1226201_-	amino acid permease	NA	NA	NA	NA	NA
WP_008500932.1|1226359_1227226_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025913182.1|1227323_1228370_+	YeiH family protein	NA	NA	NA	NA	NA
WP_008500934.1|1228434_1229292_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.2	6.2e-25
WP_008500935.1|1229338_1231024_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_008500936.1|1231040_1231979_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_008500937.1|1231978_1233109_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_058654866.1|1233470_1234652_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_021241515.1|1234648_1234903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008500940.1|1235067_1235640_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_058654865.1|1235757_1236948_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_058654863.1|1237151_1238618_+	fructuronate reductase	NA	E5EQS6	Micromonas_sp._RCC1109_virus	29.7	5.8e-39
WP_058654861.1|1238740_1239727_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_023325679.1|1239748_1240474_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_008500946.1|1240889_1241459_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	3.6e-13
WP_008500947.1|1241586_1243143_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_008500948.1|1243216_1245022_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008500949.1|1245031_1246126_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_058654856.1|1246125_1247151_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_058654855.1|1247152_1248742_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.2	2.7e-18
WP_008500952.1|1248745_1249090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058654853.1|1249368_1250565_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.3	3.8e-20
WP_021241522.1|1250580_1251288_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_126287266.1|1251569_1253330_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.0	8.4e-101
WP_008500956.1|1253455_1253740_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_008500957.1|1253790_1254798_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	2.9e-82
WP_008500958.1|1254932_1255160_+	YejL family protein	NA	NA	NA	NA	NA
WP_087855223.1|1255179_1256940_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_049015053.1|1257194_1257515_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	73.6	1.8e-41
WP_126287265.1|1257514_1257754_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	94.9	1.0e-38
WP_023294054.1|1257854_1258121_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	92.0	1.3e-37
WP_126287435.1|1258162_1259371_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.3	1.9e-48
WP_126287310.1|1259487_1260048_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	84.3	2.3e-84
WP_126287311.1|1260553_1260787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032248699.1|1260767_1261178_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	4.9e-20
WP_126287312.1|1261180_1261933_-	hypothetical protein	NA	E5G6P0	Salmonella_phage	38.5	6.3e-05
WP_126287313.1|1261984_1262578_-	YmfQ family protein	NA	NA	NA	NA	NA
WP_126287314.1|1262574_1263717_-|plate	baseplate J/gp47 family protein	plate	A0A0A8WEY6	Clostridium_phage	34.8	8.0e-12
WP_111986608.1|1263718_1264156_-	hypothetical protein	NA	B5TK74	Pseudomonas_phage	45.8	4.0e-12
WP_000900614.1|1264152_1264695_-|plate	baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	30.8	5.9e-05
WP_001515585.1|1264733_1265819_-	hypothetical protein	NA	M1PVV2	Vibrio_phage	31.5	7.6e-44
WP_126287315.1|1265815_1267219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126287316.1|1267289_1267856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126287317.1|1267903_1269787_-	lytic transglycosylase domain-containing protein	NA	I6ZXX9	Escherichia_phage	51.6	8.3e-30
WP_126287318.1|1269928_1270207_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000896638.1|1270208_1270580_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_063928726.1|1270583_1272086_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	41.6	4.6e-100
WP_049015412.1|1272082_1272280_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_126287319.1|1272283_1272829_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000537794.1|1272825_1273185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047744272.1|1273189_1273600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023157311.1|1273571_1274621_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.7	3.6e-51
WP_023294067.1|1274718_1275123_-|head	head decoration protein	head	NA	NA	NA	NA
WP_063927633.1|1275122_1275692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049015398.1|1275693_1276560_-	S49 family peptidase	NA	A0A248XD65	Klebsiella_phage	46.0	6.2e-49
WP_126287322.1|1276556_1278194_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.2	4.3e-91
WP_000483309.1|1278193_1278457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063928728.1|1278465_1280589_-|terminase	terminase	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.9	2.3e-97
WP_000210383.1|1280530_1281100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001472855.1|1281390_1281894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001472183.1|1281904_1282543_-	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	28.6	1.1e-05
WP_001165319.1|1282619_1283024_-	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_126287323.1|1283056_1283518_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	65.1	2.7e-43
WP_000535562.1|1283517_1284051_-	lysozyme	NA	K7PM52	Enterobacteria_phage	89.0	2.5e-88
WP_000783336.1|1284050_1284353_-	hypothetical protein	NA	O64361	Escherichia_phage	66.3	5.4e-32
WP_126287324.1|1284421_1285474_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	81.4	9.9e-174
WP_000116520.1|1285683_1286088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000016608.1|1286087_1286843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047744248.1|1287312_1288005_-	antitermination protein	NA	NA	NA	NA	NA
1287656:1287671	attL	AGGTCATACCCATAGC	NA	NA	NA	NA
WP_126287325.1|1288026_1289088_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	55.4	1.3e-109
WP_126287327.1|1289084_1289777_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	54.6	2.6e-58
WP_126287336.1|1289880_1291218_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	50.6	3.1e-116
WP_023294082.1|1291223_1292087_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	83.9	5.8e-39
WP_032676944.1|1292076_1292256_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	6.6e-14
WP_032678779.1|1292428_1292977_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	68.7	1.3e-68
WP_001515606.1|1292999_1293215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001515607.1|1293314_1293941_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.2e-46
WP_023294084.1|1294912_1295284_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	90.2	2.9e-56
WP_023294085.1|1295336_1296167_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	77.2	1.5e-116
WP_023294086.1|1296302_1296842_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	75.4	9.2e-75
WP_016247400.1|1296829_1297027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126287329.1|1297023_1297527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023294088.1|1297523_1297745_+	TraR/DksA family transcriptional regulator	NA	A0A0P0ZCX5	Stx2-converting_phage	55.1	6.9e-13
WP_016247403.1|1297751_1297964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023294090.1|1298493_1298715_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	58.1	1.0e-11
WP_023294091.1|1298695_1299268_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	82.4	7.9e-93
WP_001515618.1|1299312_1299522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126287330.1|1299524_1300706_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	30.2	1.5e-32
WP_024189855.1|1301084_1301498_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001515622.1|1301614_1301974_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
1301884:1301899	attR	AGGTCATACCCATAGC	NA	NA	NA	NA
WP_126287332.1|1302354_1303542_-	MFS transporter	NA	NA	NA	NA	NA
WP_008500962.1|1303666_1303927_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_008500963.1|1304136_1304640_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_126287334.1|1304733_1306383_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_008500965.1|1306570_1307860_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.4	3.9e-79
WP_008500966.1|1307822_1309259_-	magnesium transporter	NA	NA	NA	NA	NA
WP_058654905.1|1309449_1311093_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.2	1.3e-10
WP_058654849.1|1311162_1311819_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_008500244.1|1311818_1312877_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	36.6	2.6e-17
WP_008500243.1|1312949_1314005_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000019450.1|1314548_1315529_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
>prophage 4
NZ_CP045064	Enterobacter roggenkampii strain WCHER090065 chromosome, complete genome	4872204	1611616	1648781	4872204	protease,head,terminase,plate	Salmonella_phage(44.74%)	46	NA	NA
WP_126287127.1|1611616_1612528_-	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	63.5	8.1e-23
WP_126287128.1|1612527_1613208_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	75.2	6.7e-99
WP_126287129.1|1613204_1614404_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	82.7	1.8e-179
WP_087855373.1|1614404_1614758_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	75.2	1.9e-44
WP_126287130.1|1614761_1615400_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	49.6	2.0e-60
WP_126287131.1|1615465_1616188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126287132.1|1616195_1617260_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	66.6	1.4e-138
WP_001160174.1|1617262_1617568_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	53.5	9.2e-24
WP_000353819.1|1617569_1618172_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	70.1	5.6e-65
WP_126287133.1|1618171_1620382_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	54.0	3.9e-204
WP_000393957.1|1620559_1620985_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	57.5	1.6e-37
WP_000257257.1|1620988_1621429_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	77.4	7.5e-59
WP_126287134.1|1621439_1622600_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.9	1.3e-158
WP_126287157.1|1622603_1623167_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.0	1.9e-83
WP_001142474.1|1623141_1623531_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	97.7	6.0e-68
WP_126287135.1|1623517_1624072_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	86.4	7.2e-83
WP_126287136.1|1624068_1624476_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	98.5	7.1e-72
WP_059365116.1|1624441_1624810_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	89.3	3.6e-54
WP_108961697.1|1624851_1625793_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	96.8	1.0e-174
WP_006120173.1|1625804_1626308_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	83.8	4.2e-74
WP_126287137.1|1626312_1627545_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	93.2	6.9e-211
WP_049040992.1|1627541_1627742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123260981.1|1627756_1628494_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	95.0	1.5e-107
WP_109867077.1|1628381_1629848_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.7	1.9e-268
WP_126287138.1|1629847_1631470_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	94.3	5.2e-307
WP_039265766.1|1631472_1632045_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	67.9	1.8e-60
WP_126287139.1|1632103_1632640_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	78.1	9.1e-59
WP_126287140.1|1632639_1633212_-	lysozyme	NA	K7P7Q3	Enterobacteria_phage	88.9	1.0e-95
WP_016150496.1|1633183_1633462_-	hypothetical protein	NA	K7P6H9	Enterobacteria_phage	98.9	1.1e-44
WP_126287141.1|1633941_1634376_-	antitermination protein Q	NA	B6SD39	Bacteriophage	61.4	9.1e-41
WP_126287142.1|1634657_1636850_-	replication protein	NA	B6SCY1	Bacteriophage	71.3	5.4e-174
WP_104877621.1|1636853_1637054_-	transcriptional regulator	NA	K7RWG7	Bacteriophage	51.8	7.9e-08
WP_126287143.1|1637195_1637870_+	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	51.6	1.6e-60
WP_048029992.1|1638300_1638813_+	hypothetical protein	NA	C9EH97	Sodalis_phage	51.2	9.7e-42
WP_126287144.1|1639083_1640004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126287145.1|1640006_1641308_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	57.3	9.8e-139
WP_126287146.1|1641322_1641871_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	66.5	6.5e-68
WP_052895624.1|1641915_1642107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096753894.1|1642103_1642940_+|protease	serine protease	protease	V5KSK5	Escherichia_phage	73.3	4.7e-94
WP_126287147.1|1643015_1645082_+	DNA polymerase	NA	Q775A3	Bordetella_phage	68.1	2.1e-276
WP_126287148.1|1645146_1645908_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_126287149.1|1645969_1646185_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_126287150.1|1646181_1646370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126287151.1|1646374_1646650_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	67.1	1.4e-26
WP_126287152.1|1646646_1647354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126287153.1|1647386_1648781_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.7	2.9e-213
>prophage 5
NZ_CP045064	Enterobacter roggenkampii strain WCHER090065 chromosome, complete genome	4872204	1662203	1774917	4872204	tRNA,head,terminase,plate,integrase,protease,portal,tail,lysis,capsid,transposase	Salmonella_phage(59.02%)	114	1663913:1663928	1761302:1761317
WP_032675352.1|1662203_1662941_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_008502189.1|1663073_1664402_+	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	1.8e-47
1663913:1663928	attL	CGAGATGGCGCAGATC	NA	NA	NA	NA
WP_008502190.1|1664455_1664839_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.8e-33
WP_008502191.1|1665153_1665843_+	uracil-DNA glycosylase	NA	A0A1R3T3N6	Sphenicid_alphaherpesvirus	50.0	1.0e-54
WP_008502192.1|1665883_1666984_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_008502193.1|1667188_1667608_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	9.1e-14
WP_008502194.1|1667677_1668376_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_126287156.1|1668411_1671075_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_008502196.1|1671185_1672541_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_008502197.1|1672586_1672910_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_008502198.1|1672906_1674202_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.0	2.0e-43
WP_008502466.1|1679813_1682387_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	9.9e-127
WP_023344708.1|1682516_1683248_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_058654398.1|1683244_1684225_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_008502469.1|1684356_1685094_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_008502470.1|1685362_1685704_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_102000890.1|1685815_1685863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126287306.1|1685970_1687131_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_058654396.1|1687127_1688000_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_008502473.1|1688060_1689182_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_008502474.1|1689192_1690263_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.2e-89
WP_058654395.1|1690477_1690852_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_008502476.1|1690945_1691542_+	YfiR family protein	NA	NA	NA	NA	NA
WP_008502478.1|1692765_1693251_+	OmpA family protein	NA	NA	NA	NA	NA
WP_058654394.1|1693253_1694624_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_058654393.1|1694648_1695068_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914145.1|1695200_1695548_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_008502493.1|1695591_1696359_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_021241995.1|1696390_1696930_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863133.1|1696945_1697194_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_008502496.1|1697310_1698672_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_032623031.1|1698838_1699630_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_025759264.1|1699648_1700935_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_008502499.1|1700987_1701581_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_008502500.1|1701703_1702582_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_058654392.1|1702667_1704329_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_008502502.1|1704467_1704806_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_008502503.1|1704914_1705202_-	RnfH family protein	NA	NA	NA	NA	NA
WP_023325904.1|1705191_1705668_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_008502505.1|1705785_1706268_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_103786876.1|1706847_1707330_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	32.5	2.3e-16
WP_103786877.1|1707356_1707575_-	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	76.4	9.8e-28
WP_103786878.1|1707641_1708742_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	91.8	5.3e-186
WP_103786879.1|1708738_1709224_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	6.5e-72
WP_103786880.1|1709220_1712001_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	39.6	5.3e-118
WP_000763315.1|1711993_1712113_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_001528658.1|1712127_1712430_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	96.0	3.0e-43
WP_024552851.1|1712484_1713000_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.2	5.1e-91
WP_103786881.1|1713009_1714182_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	5.0e-211
WP_126287305.1|1714571_1715576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023293622.1|1715800_1716223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103786883.1|1716231_1717536_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	73.6	2.2e-122
WP_102063550.1|1717532_1718138_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	96.5	1.1e-113
WP_103786884.1|1718130_1719039_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	5.9e-143
WP_023306992.1|1719025_1719385_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	93.3	8.3e-56
WP_103786885.1|1719381_1719960_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.4	6.3e-106
WP_126287304.1|1720028_1720475_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	87.7	9.3e-65
WP_103786887.1|1720467_1720899_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	97.9	1.2e-74
WP_013098791.1|1720994_1721420_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	98.6	8.5e-68
WP_126287303.1|1721419_1721797_-	peptidase	NA	A0A1S6KZZ2	Salmonella_phage	96.8	3.4e-60
WP_080154439.1|1721801_1722311_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	99.4	9.8e-95
WP_000171565.1|1722291_1722507_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|1722510_1722714_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_103786888.1|1722713_1723178_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	1.2e-83
WP_103786889.1|1723271_1723922_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	98.1	1.3e-112
WP_126287302.1|1723925_1724987_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	98.6	2.5e-193
WP_024552864.1|1725003_1725837_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	97.5	5.5e-127
WP_103786891.1|1725979_1727746_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	94.4	0.0e+00
WP_103786892.1|1727745_1728453_+|terminase	terminase-like family protein	terminase	E5FFI8	Burkholderia_phage	31.3	6.9e-22
WP_061068629.1|1728449_1729505_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.6	6.2e-176
WP_103786893.1|1729799_1730642_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	47.3	3.2e-58
WP_032706396.1|1730641_1730860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217561.1|1731146_1731380_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_048977490.1|1731391_1731580_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	1.4e-25
WP_103786894.1|1731741_1734150_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.6	0.0e+00
WP_103786895.1|1735000_1735228_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	5.1e-35
WP_001744223.1|1735227_1735461_-	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	80.5	5.4e-24
WP_013098807.1|1735528_1735870_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.8	7.6e-51
WP_015386352.1|1735833_1736034_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
WP_103786896.1|1736041_1736551_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.2e-84
WP_103786897.1|1736583_1736826_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	93.8	5.8e-37
WP_103786898.1|1736945_1737578_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	90.5	5.3e-106
WP_103786899.1|1737579_1738605_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.6	8.9e-196
WP_152164572.1|1738849_1739971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001395480.1|1739976_1741008_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_121528189.1|1741162_1741708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078309422.1|1741710_1742772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078309424.1|1743313_1743889_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	45.5	1.2e-32
WP_126287422.1|1743893_1745261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152164571.1|1745546_1746527_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.5	1.2e-184
WP_001549565.1|1746895_1748137_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.3	6.7e-105
WP_094169092.1|1748326_1749343_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_057064095.1|1750563_1751184_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001118619.1|1752262_1753186_+|transposase	IS5-like element IS903B family transposase	transposase	NA	NA	NA	NA
WP_047363791.1|1753613_1753841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000643630.1|1754062_1754344_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350435.1|1754378_1754948_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_047363789.1|1755053_1757903_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	1.5e-128
WP_001446316.1|1757902_1758094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047363787.1|1758154_1759969_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	40.8	8.6e-101
WP_126287392.1|1760056_1760515_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_057064085.1|1760537_1761452_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
1761302:1761317	attR	CGAGATGGCGCAGATC	NA	NA	NA	NA
WP_047363781.1|1761554_1762442_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_047363779.1|1762531_1763143_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_047363777.1|1763222_1764368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786816.1|1764357_1764798_+	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	4.5e-11
WP_115601466.1|1764801_1766517_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_126287391.1|1766513_1767011_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_003847784.1|1767982_1769134_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
WP_008786790.1|1769413_1770952_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	93.8	1.7e-278
WP_000612626.1|1771000_1771348_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839182.1|1771344_1771749_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_126287439.1|1771826_1772801_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	57.0	3.0e-92
WP_001189109.1|1773408_1774917_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	1.4e-43
>prophage 6
NZ_CP045064	Enterobacter roggenkampii strain WCHER090065 chromosome, complete genome	4872204	2074653	2146271	4872204	tRNA,protease,transposase,integrase	Staphylococcus_phage(60.0%)	60	2121723:2121764	2149161:2149202
WP_001118619.1|2074653_2075577_-|transposase	IS5-like element IS903B family transposase	transposase	NA	NA	NA	NA
WP_044597673.1|2075730_2076741_+	fimbrial protein	NA	NA	NA	NA	NA
WP_058653976.1|2076758_2078492_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_152164568.1|2078506_2079061_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001395480.1|2079144_2080176_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_008499744.1|2087973_2089950_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_127312443.1|2089958_2090090_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_045335271.1|2090444_2090615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008499745.1|2090753_2091908_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	1.1e-128
WP_008499747.1|2092349_2093747_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_058653978.1|2093805_2094303_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_021242074.1|2094397_2095105_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_021242075.1|2095156_2095888_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_008499751.1|2095907_2096855_+	glutathione synthase	NA	NA	NA	NA	NA
WP_008499752.1|2096937_2097498_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_021242076.1|2097497_2097914_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_058653980.1|2097924_2098905_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_008499756.1|2098922_2099624_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_008499757.1|2099645_2100212_+	YggT family protein	NA	NA	NA	NA	NA
WP_008499758.1|2100208_2100505_+	YggU family protein	NA	NA	NA	NA	NA
WP_032653325.1|2100508_2101102_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_045416357.1|2101094_2102243_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_008499762.1|2102427_2103144_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_003862421.1|2103200_2103527_-	DUF469 domain-containing protein	NA	NA	NA	NA	NA
WP_023294526.1|2103526_2104246_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_021242081.1|2104384_2105443_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_008499765.1|2105469_2105742_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_021242082.1|2105866_2106943_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_008499767.1|2107161_2108418_+	nucleoside permease	NA	NA	NA	NA	NA
WP_058653981.1|2108497_2109301_-	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
WP_045371290.1|2109278_2109818_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_045371292.1|2109814_2111338_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_023326048.1|2111348_2112224_-	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_058653982.1|2112220_2112514_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_058653983.1|2112530_2113553_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_021242089.1|2113566_2114430_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_021242090.1|2114447_2115809_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_123260983.1|2116270_2117779_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_023326051.1|2117768_2118461_+	response regulator	NA	NA	NA	NA	NA
WP_058653985.1|2118549_2120685_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_008499781.1|2120867_2121581_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
2121723:2121764	attL	TCCTTGGTTCGATTCCGAGTCCGGGCACCACTATTTAAAGAA	NA	NA	NA	NA
WP_126287271.1|2122510_2125243_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_126287272.1|2126316_2127513_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DTG6	Proteus_phage	24.4	9.0e-14
WP_126287283.1|2127557_2129114_-	DUF927 domain-containing protein	NA	NA	NA	NA	NA
WP_126287273.1|2129514_2130372_-|integrase	site-specific integrase	integrase	A0A1J0MFS3	Staphylococcus_phage	26.8	1.3e-09
WP_126287274.1|2130685_2131906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126287275.1|2131982_2132357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126287276.1|2132360_2132795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126287284.1|2132916_2133330_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_126287285.1|2133370_2133832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126287277.1|2133810_2134050_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_126287278.1|2134144_2134537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126287279.1|2134585_2135482_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_060617892.1|2135481_2135889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126287280.1|2135869_2136808_-	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	29.0	4.7e-34
WP_047355160.1|2137225_2138782_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	4.9e-105
WP_126287281.1|2138778_2140008_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_126287282.1|2140130_2143247_+	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_047355154.1|2143358_2144168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122008382.1|2144681_2146271_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2149161:2149202	attR	TCCTTGGTTCGATTCCGAGTCCGGGCACCACTATTTAAAGAA	NA	NA	NA	NA
>prophage 7
NZ_CP045064	Enterobacter roggenkampii strain WCHER090065 chromosome, complete genome	4872204	2168016	2226661	4872204	transposase,integrase	Staphylococcus_phage(18.18%)	51	2212449:2212463	2232685:2232699
WP_001118619.1|2168016_2168940_-|transposase	IS5-like element IS903B family transposase	transposase	NA	NA	NA	NA
WP_021544648.1|2169230_2170208_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_001395480.1|2170274_2171306_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_001189109.1|2171952_2173461_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	1.4e-43
WP_152164567.1|2173769_2174180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063615651.1|2174571_2175723_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	2.0e-42
WP_152164566.1|2176144_2176849_-	HrgA protein	NA	NA	NA	NA	NA
WP_001118619.1|2177048_2177972_+|transposase	IS5-like element IS903B family transposase	transposase	NA	NA	NA	NA
WP_008503143.1|2178046_2178430_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_008503144.1|2178432_2179095_-	DedA family protein	NA	NA	NA	NA	NA
WP_008503145.1|2179439_2180216_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_008503146.1|2180396_2181695_-	MFS transporter	NA	NA	NA	NA	NA
WP_045407019.1|2182170_2183583_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_058655028.1|2183600_2185088_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_008503149.1|2185174_2186416_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_021242367.1|2186671_2187637_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	32.5	3.3e-35
WP_058655029.1|2187888_2188887_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_008503152.1|2188957_2189461_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_008503153.1|2189544_2190681_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_008503154.1|2190771_2192793_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_008503155.1|2192978_2194559_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_008503156.1|2194592_2195564_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_008503157.1|2195779_2197267_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	7.5e-18
WP_008503158.1|2197263_2198295_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_058655031.1|2198295_2199273_+	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
WP_025912529.1|2199274_2200276_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_058655033.1|2200287_2201175_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_008503162.1|2201171_2201465_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_045351630.1|2201566_2201854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084831996.1|2201863_2202583_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_023294617.1|2202575_2203106_-	fimbrial protein	NA	NA	NA	NA	NA
WP_008503166.1|2203115_2203661_-	fimbrial protein	NA	NA	NA	NA	NA
WP_126287346.1|2203671_2204679_-	fimbrial protein	NA	NA	NA	NA	NA
WP_023294615.1|2204679_2207307_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_008503169.1|2207384_2208092_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_021242352.1|2208137_2208671_-	fimbrial protein	NA	NA	NA	NA	NA
WP_008503171.1|2208743_2209286_-	fimbrial protein BcfA	NA	NA	NA	NA	NA
WP_084635675.1|2209797_2211204_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.6	7.8e-33
WP_008503173.1|2211613_2213134_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	1.4e-32
2212449:2212463	attL	AAGATCTGAACGATC	NA	NA	NA	NA
WP_039024806.1|2213471_2215031_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	4.9e-12
WP_021242349.1|2215027_2215522_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087855182.1|2215669_2216434_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_023326128.1|2216434_2217604_-	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_110915166.1|2218093_2218345_-	DUF2542 family protein	NA	NA	NA	NA	NA
WP_058653842.1|2218829_2219540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058653843.1|2220573_2221386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058653844.1|2221387_2221978_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	38.9	7.5e-30
WP_088581786.1|2222646_2223794_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
WP_058653846.1|2223869_2224319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058653847.1|2224325_2225006_+	hypothetical protein	NA	Q3LZN7	Bacteriophage	51.5	1.1e-21
WP_126287406.1|2225344_2226661_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.4	2.0e-35
2232685:2232699	attR	GATCGTTCAGATCTT	NA	NA	NA	NA
>prophage 8
NZ_CP045064	Enterobacter roggenkampii strain WCHER090065 chromosome, complete genome	4872204	2434862	2508195	4872204	tRNA,head,terminase,protease,portal,tail,capsid	uncultured_Caudovirales_phage(52.63%)	69	NA	NA
WP_055321273.1|2434862_2437718_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_008502817.1|2437841_2438345_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008502818.1|2438428_2439448_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	31.0	1.9e-44
WP_008502819.1|2439491_2441132_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_126287206.1|2441269_2442772_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.8	2.2e-81
WP_102000900.1|2442751_2443693_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.4	3.4e-16
WP_023326177.1|2444380_2448841_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_008502824.1|2448850_2450269_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_023294675.1|2450450_2451011_-	outer membrane protein	NA	NA	NA	NA	NA
WP_008502826.1|2451007_2453422_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_058655010.1|2453437_2454142_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_008502828.1|2454262_2454940_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_025912562.1|2455390_2455888_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	1.1e-26
WP_008502830.1|2455893_2456532_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_003860436.1|2456840_2457233_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003860434.1|2457248_2457677_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_008502831.1|2457976_2459101_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_008502832.1|2459290_2459689_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_126287207.1|2459860_2461228_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.1	1.3e-21
WP_008502834.1|2461319_2462387_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_008502835.1|2462443_2463382_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_008502836.1|2463779_2464250_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_008502837.1|2464625_2464889_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_008502838.1|2464999_2465266_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_008502839.1|2465327_2465600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008502840.1|2465645_2467100_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_008502841.1|2467190_2469158_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_045337040.1|2469163_2470096_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_003860416.1|2470103_2470307_-	AaeX family protein	NA	NA	NA	NA	NA
WP_008502843.1|2470486_2471413_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_058655008.1|2471632_2472247_+	YagU family protein	NA	NA	NA	NA	NA
WP_021242283.1|2472292_2473738_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_058655007.1|2473822_2477620_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_008502847.1|2477661_2479131_-	ribonuclease G	NA	NA	NA	NA	NA
WP_126287208.1|2479120_2479714_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_008502849.1|2479723_2480212_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_008502850.1|2480211_2481228_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|2481290_2482334_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_008502851.1|2482616_2484557_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_008502852.1|2484739_2485714_+	oxidoreductase	NA	NA	NA	NA	NA
WP_058655006.1|2485791_2486793_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_008502854.1|2486793_2487393_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_008502855.1|2487627_2488080_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_008502856.1|2488101_2488566_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003860388.1|2488576_2489926_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_021242290.1|2490034_2490277_+	YhdT family protein	NA	NA	NA	NA	NA
WP_008502858.1|2490266_2491718_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_008502859.1|2491729_2492611_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_021242291.1|2492738_2493479_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_008502861.1|2493809_2494775_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|2494798_2495095_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_001549737.1|2495248_2495440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126287209.1|2495442_2497104_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.2	0.0e+00
WP_085178567.1|2497087_2497444_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	98.3	9.4e-60
WP_023293255.1|2497719_2498163_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	93.2	1.1e-78
WP_001547824.1|2498162_2498462_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|2498458_2498794_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_046275060.1|2498790_2500032_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.0	3.2e-232
WP_001547826.1|2500033_2500594_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|2500645_2501812_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|2502075_2502588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|2502636_2502972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|2503314_2505450_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_126287211.1|2505449_2505815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126287212.1|2505811_2506180_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	82.0	4.8e-51
WP_126287213.1|2506176_2506449_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_126287214.1|2506441_2506654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126287216.1|2506646_2507327_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	92.7	3.0e-46
WP_071284456.1|2507415_2508195_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 9
NZ_CP045064	Enterobacter roggenkampii strain WCHER090065 chromosome, complete genome	4872204	3402843	3425659	4872204	transposase	Shigella_phage(33.33%)	16	NA	NA
WP_152164583.1|3402843_3404051_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.0	2.3e-102
WP_126287393.1|3404357_3406214_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	39.5	1.7e-19
WP_126287394.1|3406590_3406812_-	MFS transporter	NA	NA	NA	NA	NA
WP_126287395.1|3406916_3407147_-	MFS transporter	NA	NA	NA	NA	NA
WP_126287396.1|3407936_3409316_-	porin	NA	NA	NA	NA	NA
WP_126287397.1|3410033_3411299_-	MFS transporter	NA	NA	NA	NA	NA
WP_126287398.1|3411340_3413464_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_126287399.1|3413574_3414573_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_126287400.1|3415687_3416200_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_126287401.1|3416265_3417696_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_094169092.1|3418508_3419525_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_000156884.1|3419736_3420759_+|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_000427614.1|3421093_3422098_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_126287425.1|3422587_3422923_+	protein secretion chaperonin CsaA	NA	NA	NA	NA	NA
WP_003030308.1|3423019_3424258_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001572362.1|3424636_3425659_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP045064	Enterobacter roggenkampii strain WCHER090065 chromosome, complete genome	4872204	3489551	3552154	4872204	protease,transposase	uncultured_Caudovirales_phage(44.44%)	59	NA	NA
WP_008502917.1|3489551_3490811_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.1	8.0e-05
WP_008502916.1|3490813_3491818_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_003855996.1|3491889_3492087_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_006178975.1|3492191_3493490_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.4	4.9e-66
WP_023293453.1|3493682_3494108_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_008502912.1|3494146_3496588_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.5	2.4e-66
WP_058653824.1|3496654_3497386_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_023293450.1|3497477_3498752_-	MFS transporter	NA	NA	NA	NA	NA
WP_058653825.1|3498946_3500569_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_058653826.1|3500565_3502497_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	5.3e-16
WP_008502907.1|3502669_3502945_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_023616161.1|3503093_3503423_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_058653827.1|3503560_3504283_+	esterase	NA	NA	NA	NA	NA
WP_008502904.1|3504279_3505035_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_006810379.1|3505144_3506209_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_021240705.1|3506568_3507969_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_003856022.1|3507981_3508287_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_058653828.1|3508296_3508764_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_058653829.1|3508776_3509427_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_126287261.1|3509436_3510297_+	L-ribulose-5-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_025911930.1|3510289_3510976_+	L-ribulose-5-phosphate 4-epimerase	NA	NA	NA	NA	NA
WP_058653830.1|3511116_3511392_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_008502896.1|3511730_3512126_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_008502895.1|3512132_3512447_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|3512451_3512679_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_008502894.1|3512720_3513170_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_126287260.1|3513238_3513883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085929690.1|3514077_3514737_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_058654307.1|3515049_3516459_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_058654306.1|3516545_3517208_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_058654305.1|3517452_3519102_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	3.4e-11
WP_025911935.1|3519189_3520155_-	DMT family transporter	NA	NA	NA	NA	NA
WP_058654304.1|3520230_3521055_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_058654303.1|3521136_3521985_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_008502885.1|3522069_3522456_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000227969.1|3524241_3525318_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_008501432.1|3526055_3526796_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_008501431.1|3526789_3527347_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_008501430.1|3527671_3527878_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_008501429.1|3527947_3529285_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_008501428.1|3529496_3530138_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_008501426.1|3530362_3532096_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_126287405.1|3532092_3535869_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_008501424.1|3535871_3536216_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_045415447.1|3536532_3537003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058654300.1|3536999_3537584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118619.1|3537838_3538762_+|transposase	IS5-like element IS903B family transposase	transposase	NA	NA	NA	NA
WP_152164562.1|3538803_3540327_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.8	3.4e-10
WP_058654298.1|3540411_3541413_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_008501420.1|3541399_3542422_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_058654299.1|3542435_3543938_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.8	2.0e-10
WP_021240696.1|3544043_3545000_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_008501423.1|3545309_3545840_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
WP_001118619.1|3545950_3546874_-|transposase	IS5-like element IS903B family transposase	transposase	NA	NA	NA	NA
WP_008501417.1|3546994_3547351_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008501416.1|3547501_3548500_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.1	1.6e-69
WP_025911962.1|3548697_3550077_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_008501414.1|3550154_3550706_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_058654296.1|3550801_3552154_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 11
NZ_CP045064	Enterobacter roggenkampii strain WCHER090065 chromosome, complete genome	4872204	3849817	3868857	4872204	head,integrase,protease,portal,tail,capsid	uncultured_Caudovirales_phage(71.43%)	21	3854222:3854238	3866450:3866466
WP_058654202.1|3849817_3851386_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	56.5	1.1e-19
WP_058654201.1|3851472_3853863_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
3854222:3854238	attL	TATCAATCGGTGTATCA	NA	NA	NA	NA
WP_126287082.1|3854259_3855477_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	58.5	4.9e-132
WP_126287081.1|3855473_3856322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126287080.1|3856533_3856818_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_155685403.1|3856825_3857536_+	DNA-binding protein	NA	A0A1I9KFA9	Aeromonas_phage	50.2	3.3e-48
WP_126287090.1|3858023_3858242_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	93.1	2.7e-33
WP_126287079.1|3858234_3858420_+	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	90.2	6.8e-22
WP_126287078.1|3858412_3858634_+	aminotransferase	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	55.6	1.7e-11
WP_126287077.1|3858630_3858999_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	94.3	2.8e-59
WP_126287076.1|3858995_3859361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126287075.1|3859360_3861040_+|integrase	integrase	integrase	A0A2H4JFA4	uncultured_Caudovirales_phage	67.3	1.8e-39
WP_126287074.1|3861617_3861878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126287073.1|3861912_3862383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126287072.1|3862648_3863818_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	75.1	1.1e-157
WP_126287071.1|3863866_3864427_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	93.5	1.2e-96
WP_126287070.1|3864428_3865673_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.3	2.6e-234
WP_048977713.1|3865665_3865965_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	78.8	7.6e-39
WP_023293251.1|3866532_3867069_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	34.0	4.6e-18
3866450:3866466	attR	TATCAATCGGTGTATCA	NA	NA	NA	NA
WP_008501947.1|3867160_3867823_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_008501946.1|3867930_3868857_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.3	5.3e-22
>prophage 12
NZ_CP045064	Enterobacter roggenkampii strain WCHER090065 chromosome, complete genome	4872204	3979224	4001564	4872204	transposase	Streptococcus_phage(25.0%)	24	NA	NA
WP_001118619.1|3979224_3980148_-|transposase	IS5-like element IS903B family transposase	transposase	NA	NA	NA	NA
WP_021242883.1|3980339_3981443_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.7	1.7e-59
WP_058654073.1|3981454_3982708_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	1.8e-97
WP_007777710.1|3983281_3983623_-	YkfI toxin protein	NA	NA	NA	NA	NA
WP_007777712.1|3983643_3983961_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_007777714.1|3983981_3984203_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|3984211_3984688_-	RadC family protein	NA	NA	NA	NA	NA
WP_126287411.1|3984703_3985162_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	1.5e-14
WP_000194654.1|3985259_3985499_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001385283.1|3985575_3986043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126287412.1|3986065_3986509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144031.1|3986508_3986745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000189411.1|3986785_3987487_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000197387.1|3987703_3988525_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	2.1e-46
WP_127472377.1|3988616_3989480_-	GTPase family protein	NA	NA	NA	NA	NA
WP_152164561.1|3989601_3989991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118619.1|3991013_3991937_+|transposase	IS5-like element IS903B family transposase	transposase	NA	NA	NA	NA
WP_034493089.1|3992476_3993055_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_126287434.1|3993176_3993383_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000227969.1|3993844_3994921_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001189109.1|3995462_3996971_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	1.4e-43
WP_001254932.1|3998133_3999285_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001547737.1|3999204_3999555_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	5.2e-39
WP_126287435.1|4000355_4001564_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.3	1.9e-48
>prophage 13
NZ_CP045064	Enterobacter roggenkampii strain WCHER090065 chromosome, complete genome	4872204	4161754	4273639	4872204	tRNA,holin,integrase,protease,lysis,transposase	Planktothrix_phage(18.18%)	107	4194058:4194117	4210238:4211295
WP_008499307.1|4161754_4162234_-|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_008499308.1|4162432_4163227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058655053.1|4163277_4165776_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.7	3.3e-111
WP_021241620.1|4165884_4166295_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_008499311.1|4166291_4166744_-	NfeD family protein	NA	NA	NA	NA	NA
WP_008499312.1|4166740_4167655_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_058655052.1|4167699_4168551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058655051.1|4168694_4169366_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.8	2.0e-23
WP_023293126.1|4169358_4170141_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_023293125.1|4170190_4171045_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_126287205.1|4171103_4171874_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_122008371.1|4171902_4172529_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_058655100.1|4172496_4173183_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	5.0e-33
WP_058655049.1|4173179_4175594_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_008499321.1|4175777_4176923_+	porin	NA	NA	NA	NA	NA
WP_058655048.1|4177013_4178084_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_023293121.1|4178169_4179237_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_021241611.1|4179233_4179743_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_008499325.1|4179914_4180124_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_058655099.1|4180259_4180982_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_008499327.1|4180985_4181480_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_008499328.1|4181654_4183040_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.9	6.9e-42
WP_008499329.1|4183126_4183648_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_021241606.1|4183721_4184738_-	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_008499331.1|4184821_4186321_-	PTS sugar transporter	NA	NA	NA	NA	NA
WP_004143016.1|4186604_4186817_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_008499332.1|4186818_4187685_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.5	5.0e-30
WP_008499333.1|4187994_4188558_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_008499334.1|4188626_4189172_+	type 1 fimbrial protein subunit FimI	NA	NA	NA	NA	NA
WP_023326827.1|4189206_4189899_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_058655047.1|4189913_4192475_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_039265881.1|4192467_4193475_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_058655046.1|4193484_4194006_+	fimbria assembly protein	NA	NA	NA	NA	NA
4194058:4194117	attL	GGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGTATCTTCCCG	NA	NA	NA	NA
WP_001118619.1|4194134_4195058_+|transposase	IS5-like element IS903B family transposase	transposase	NA	NA	NA	NA
WP_008499339.1|4195123_4195756_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_008499340.1|4196556_4197285_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_058655045.1|4197309_4198008_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_087855541.1|4198527_4199715_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	54.4	4.7e-124
WP_087855535.1|4200747_4201479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048026851.1|4201693_4201891_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	42.6	3.3e-06
WP_088581786.1|4202318_4203466_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
WP_152164558.1|4204043_4204412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118619.1|4204400_4205324_+|transposase	IS5-like element IS903B family transposase	transposase	NA	NA	NA	NA
WP_058654329.1|4205992_4206241_+|lysis	lysis protein	lysis	A0A127KNH9	Pseudomonas_phage	36.4	1.4e-06
WP_058654328.1|4206242_4206782_+	lysozyme	NA	H6WRZ4	Salmonella_phage	76.3	8.8e-78
WP_087855575.1|4206778_4207168_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	48.4	3.4e-23
WP_126287421.1|4207349_4207706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023292743.1|4207878_4208238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058654325.1|4208528_4209377_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.1	1.1e-138
WP_001118619.1|4210314_4211238_+|transposase	IS5-like element IS903B family transposase	transposase	NA	NA	NA	NA
WP_023292719.1|4212354_4212654_+	hypothetical protein	NA	G8C7R5	Escherichia_phage	67.7	1.1e-34
4210238:4211295	attR	GGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGTATCTTCCCGACAACGCAGACCGTTCCGTGGCAAAGCAAAAGTTCAAAATCACCAACTGGCCCACCTACAATAAAGCCCTCATCAACCGTGGCTCCATAACTTTCTGGCTGGATGATGAAGCTATTCAGGCCTGGTATGAGTCAGCAACACCTTCTTCACGAGGCAGACCTCAGCGCTATTCTGACCTTGCCATCACGACTGTGCTGGTCATTAAACGCGTATTCAGGCTGACCCTGCGGGCTGCGCAGGGCTTTATTGATTCCATTTTTTCTCTGATGAACGTTCCGCTACGCTGCCCGGATTACAGCTGTGTCAGCAGGCGGGCAAAGTCGGTTAATGTCAGTTTCAAAACGCCCACCCGGGGTGAAATCGCACACCTGGTAATTGATTCCACCGGGCTGAAGGTCTTCGGTGAAGGCGAGTGGAAAGTCAAAAAGCATGGCCAGGAACGCCGCCGTATCTGGCGTAAGCTGCATCTCGCCGTTGACAGTAAAACACATGAAATCATCTGCGCTGACCTGTCGCTGAACAACGTTACGGACTCAGAGGCCTTCCCCGGGTTAATCCGGCAAACCCACCGGAAAATCAGGTCAGCCGCCGCCGATGGCGCTTACGATACCCGGCTATGTCACGATGAACTGCGGCGTAAGAAAATCAGCGCGCTTATCCCTCCCCGAAAAGGTGCGGGTTACTGGCCCGGTGAATATGCAGACCGTAACCGTGCAGTGGCTAATCAGCGAATGACCGGGAGTAATGCGCGGTGGAAATGGACAACAGATTACAACCGTCGCTCGATAGCGGAAACGGCGATGTACCGGGTAAAACAGCTGTTCGGGGGTTCACTGACGCTGCGTGACTACGATGGTCAGGTTGCGGAGGCTATGGCCCTGGTACGAGCGCTGAACAAAATGACGAAAGCAGGTATGCCTGAAAGCGTGCGTATTGCCTGAAAACACAACCCGCTACGGGGGAGACTTACCCGAAATCTGATTTATTCAACAAAGCCG	NA	NA	NA	NA
WP_058654323.1|4212650_4213292_+	hypothetical protein	NA	G8C7R6	Escherichia_phage	76.5	3.1e-98
WP_126287430.1|4213241_4213628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118619.1|4213719_4214643_-|transposase	IS5-like element IS903B family transposase	transposase	NA	NA	NA	NA
WP_055321782.1|4216771_4217086_+	hypothetical protein	NA	M1FJ98	Enterobacteria_phage	34.0	1.2e-07
WP_055321781.1|4217461_4217653_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_055321780.1|4217688_4217937_+	DNA-binding protein	NA	A0A286S2A4	Klebsiella_phage	50.7	3.7e-15
WP_058654321.1|4218203_4219034_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_045335421.1|4219392_4220409_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_087855608.1|4220505_4222008_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_058654320.1|4222009_4223041_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	1.3e-21
WP_021241596.1|4223190_4223466_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_058654319.1|4223651_4225835_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_058654318.1|4225961_4227935_+	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_058654317.1|4228038_4229427_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_058654316.1|4229671_4230907_+	MFS transporter	NA	NA	NA	NA	NA
WP_058654315.1|4230922_4231948_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_058654314.1|4231940_4233083_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_021241589.1|4233158_4234130_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	32.2	1.2e-24
WP_021241588.1|4234130_4235375_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_058654313.1|4235440_4236877_-	MFS transporter	NA	NA	NA	NA	NA
WP_008499383.1|4236984_4237854_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_058654312.1|4238003_4238606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021241586.1|4238633_4239287_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_023293103.1|4239407_4239776_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_087855609.1|4239765_4240356_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021241583.1|4240546_4241650_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010428317.1|4241682_4242024_+	RamA family antibiotic efflux transcriptional regulator	NA	NA	NA	NA	NA
WP_013097677.1|4242078_4242327_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_087855610.1|4242815_4245524_+	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	28.1	6.5e-68
WP_126287358.1|4245629_4246691_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_087855611.1|4246700_4249856_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_021242649.1|4249785_4250907_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_032656089.1|4251011_4251902_+	oxidoreductase	NA	NA	NA	NA	NA
WP_106106290.1|4252170_4252440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126287360.1|4252555_4252855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045352658.1|4253085_4253589_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_001118619.1|4253996_4254920_+|transposase	IS5-like element IS903B family transposase	transposase	NA	NA	NA	NA
WP_152164557.1|4254961_4255528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058654411.1|4255667_4256123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058654410.1|4256352_4257234_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031275271.1|4257339_4258119_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_021242638.1|4258132_4259812_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_008499406.1|4259832_4260603_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_008499407.1|4260734_4261208_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_058654409.1|4261315_4262020_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	1.2e-21
WP_058654408.1|4262006_4262843_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	4.4e-15
WP_058654407.1|4262835_4263669_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_058654406.1|4263668_4264682_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_126287095.1|4264780_4266349_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023326860.1|4266550_4267249_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_087855614.1|4267282_4268977_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_021242632.1|4269010_4269751_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_058653607.1|4270025_4270673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063618280.1|4270669_4271224_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_023326865.1|4271267_4271831_-	fasciclin domain-containing protein	NA	NA	NA	NA	NA
WP_008500974.1|4271974_4273639_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.8	9.5e-62
>prophage 1
NZ_CP045065	Enterobacter roggenkampii strain WCHER090065 plasmid pMCR10_090065, complete sequence	71775	2165	69075	71775	transposase,integrase	Escherichia_phage(22.22%)	56	25146:25205	32641:33340
WP_032676117.1|2165_3089_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	3.2e-176
WP_000754567.1|3439_3856_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_023293777.1|3852_4083_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_153257569.1|4220_4883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152951883.1|4892_5042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006797591.1|5171_6377_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.1	1.2e-162
WP_006797589.1|6373_7351_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_032627083.1|7432_8704_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	8.3e-151
WP_006796638.1|8703_9135_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_004152765.1|9543_11028_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_024195824.1|12073_12982_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016240393.1|13442_14705_+	cytosine permease	NA	NA	NA	NA	NA
WP_032676105.1|14707_15943_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016240391.1|15939_17178_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_094487604.1|19798_21006_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
WP_000923859.1|21096_21570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001198019.1|21588_22527_-	cation transporter	NA	NA	NA	NA	NA
WP_045358031.1|23222_23837_+	serine recombinase	NA	NA	NA	NA	NA
WP_001118645.1|24109_25033_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
25146:25205	attL	AAGCAGATTACCCAGCTGATTGAGGTCATGCTCGTTGGCCGCGGTGGTGACCAGGCTGTG	NA	NA	NA	NA
WP_032676104.1|26057_27053_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	38.7	3.9e-47
WP_023332837.1|27419_29039_+	phosphoethanolamine--lipid A transferase MCR-10.1	NA	NA	NA	NA	NA
WP_048994037.1|29640_30081_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_152164585.1|30328_31252_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	95.4	2.2e-169
WP_024191312.1|33323_33635_+	hypothetical protein	NA	NA	NA	NA	NA
32641:33340	attR	AAGCAGATTACCCAGCTGATTGAGGTCATGCTCGTTGGCCGCGGTGGTGACCAGGCTGTGGGTCAGGCCACTCTTGGCATCGACACCAATGTGGGCCTTCATGCCAAAGTGCCACTGATTGCCTTTCTTGGTCTGATGCATCTCCGGATCGCGTTGCTGCTCTTTGTTCTTGGTAGAGCTGGGTGCCTCAATGATGGTGGCATCCACCAAAGTGCCTTGGGTCATCATGACGCCTGCTTCGGCCAGCCAGCGATTGATGGTCTTGAACAATTGACGGGCCAGTTGATGCTGCTCGAGCAGGTGGCGGAAATTCATGATGGTGGTGCGATCCGGCAGGGCGCTATCCAGGGATAATCGGGCAAACAGGCGCATGGAGGCGATTTCGTACAGGGCATCTTCCATGGCACCGTCGCTCAGGTTGTACCAATGCTGCATGCAGTGAATACGCAGCATGGTCTCCAGCGGATAGGGCCGTCGGCCATTGCCCGCCTTGGGATAAAACGGCTCGATGACAGCGGTCATATTCTGCCATGGCAGAATCTGCTCCATGCGGGAGAGGAAAATCTCTTTTCGGGTCTGACGGCGCTTAGTGCTGAATTCACTATCGGCGAAGGTGAGTTGATGGCTCATGATGTCCCTCTGGGATGCGCTCCGGATGAATATGATGATCTCATATCAGGAACTTGTTCGCACCTTCCCT	NA	NA	NA	NA
WP_001148851.1|33724_34810_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000217345.1|34843_36001_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_000135555.1|35997_37164_-	histidinol-phosphate transaminase	NA	A0A1X7QHI1	Faustovirus	27.4	1.5e-18
WP_000993475.1|37222_38905_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_000741484.1|38948_40499_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.1	1.9e-80
WP_016240370.1|40613_41399_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.9	3.2e-36
WP_001087990.1|41398_42280_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	29.7	6.4e-25
WP_000069054.1|42291_43278_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000148344.1|43516_44113_-	HutD family protein	NA	NA	NA	NA	NA
WP_001112072.1|44109_45483_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_001294851.1|45724_46525_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_001515701.1|46678_47941_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_000058769.1|47937_48762_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_001181218.1|48993_49671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152164586.1|49716_50640_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	98.4	1.0e-174
WP_006796897.1|51264_51651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861580.1|51659_51851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|52871_53627_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_008786790.1|54171_55710_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	93.8	1.7e-278
WP_000612626.1|55758_56106_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839182.1|56102_56507_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_126287410.1|57050_57230_+	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_072663757.1|57245_57794_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	1.6e-50
WP_108451322.1|57925_58675_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_072663759.1|58664_59987_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.7	2.1e-16
WP_072663760.1|59983_60979_+	hypothetical protein	NA	A0A0B4ZZS0	Mycobacterium_phage	29.3	3.6e-16
WP_072663761.1|60978_62289_+	glycosyl hydrolase	NA	A0A1V0SDW6	Indivirus	29.3	2.2e-29
WP_072663762.1|62285_63827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072663763.1|63836_64946_+	hypothetical protein	NA	A0A1V0SDW6	Indivirus	26.5	6.4e-22
WP_072663764.1|64972_65797_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_001067855.1|66312_67017_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|68370_69075_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
