The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045038	Salmonella enterica subsp. enterica serovar Muenster strain PJM1 chromosome, complete genome	5000356	85889	102538	5000356	integrase	Enterobacteria_phage(88.89%)	16	91085:91106	102700:102721
WP_023223124.1|85889_88742_-	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	44.2	1.5e-94
WP_023136631.1|88816_89434_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
91085:91106	attL	TTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_112076033.1|91583_93917_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000856729.1|93931_94252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000459302.1|94387_94843_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|94835_95123_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980247.1|95115_95706_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	98.5	8.2e-69
WP_001613634.1|95702_95969_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	1.4e-44
WP_097698898.1|96084_96282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001283042.1|96521_97256_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	5.2e-129
WP_000638635.1|97252_97753_+	transactivation protein	NA	NA	NA	NA	NA
WP_000446129.1|97826_98399_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	8.5e-95
WP_152159340.1|98442_98661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001697486.1|98603_99257_-	DUF2290 domain-containing protein	NA	NA	NA	NA	NA
WP_001697485.1|99258_101355_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001697482.1|101347_102538_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	85.0	1.8e-195
102700:102721	attR	TTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 2
NZ_CP045038	Salmonella enterica subsp. enterica serovar Muenster strain PJM1 chromosome, complete genome	5000356	124596	138998	5000356	integrase	Morganella_phage(37.5%)	18	121765:121780	139169:139184
121765:121780	attL	GTTGAATTTTGCTGAT	NA	NA	NA	NA
WP_010835592.1|124596_127566_-	hypothetical protein	NA	F1C5E9	Cronobacter_phage	35.4	3.9e-82
WP_001651021.1|127575_127896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023223122.1|128237_128612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023223121.1|128711_128987_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001651019.1|128979_129468_-	Fertility inhibition FinO	NA	NA	NA	NA	NA
WP_001651017.1|129681_132444_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	1.6e-295
WP_001651016.1|132436_132784_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	62.2	2.1e-32
WP_001651015.1|132793_133420_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	39.0	6.3e-27
WP_001651014.1|133416_133638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024423.1|133634_133898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001651013.1|133894_134578_-	ash family protein	NA	A0A0P0ZE80	Stx2-converting_phage	45.0	1.2e-07
WP_001651012.1|134574_135072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001651011.1|135068_135248_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001651010.1|135240_136050_-	DNA primase core	NA	A0A0R6PJV6	Moraxella_phage	55.2	4.3e-28
WP_001651009.1|136062_136494_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	1.3e-26
WP_001651008.1|136493_136697_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001651007.1|136790_137642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001651006.1|137738_138998_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	79.4	2.8e-199
139169:139184	attR	GTTGAATTTTGCTGAT	NA	NA	NA	NA
>prophage 3
NZ_CP045038	Salmonella enterica subsp. enterica serovar Muenster strain PJM1 chromosome, complete genome	5000356	664688	740444	5000356	lysis,tRNA,portal,tail,capsid,holin,integrase,plate,head,terminase	Salmonella_phage(42.5%)	97	654502:654522	742729:742749
654502:654522	attL	GATAAGCGCAGCGCCATCAGG	NA	NA	NA	NA
WP_023136705.1|664688_665732_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	58.7	7.4e-113
WP_023212685.1|665746_666559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023136703.1|666560_667151_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	38.7	3.6e-32
WP_023136702.1|667281_667503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024147018.1|669540_669744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023136699.1|670077_671010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023136698.1|670999_671740_+	Hiran domain protein	NA	NA	NA	NA	NA
WP_001748617.1|672224_673262_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	65.6	7.1e-124
WP_001748619.1|673248_674142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748620.1|674170_674749_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	39.5	1.5e-27
WP_001247709.1|674868_675090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460877.1|675120_675624_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|675633_675861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024139063.1|675850_676276_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.9e-23
WP_001748623.1|676275_676677_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.9e-48
WP_071592686.1|676823_677000_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000422609.1|676990_677587_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.3	3.8e-74
WP_000153512.1|677583_677913_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	45.2	3.0e-12
WP_001748626.1|677902_678763_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.4	4.9e-131
WP_064441649.1|678759_680781_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.6	7.9e-297
WP_001748628.1|680900_681107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|681080_681404_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_001650413.1|681400_682462_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.3	3.0e-162
WP_051129117.1|682458_684234_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.3	7.5e-291
WP_000018798.1|684394_685195_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	54.8	3.2e-76
WP_000550496.1|685256_686279_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218534.1|686282_686987_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	67.4	1.0e-86
WP_000398492.1|686990_687185_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	58.6	3.3e-11
WP_000447490.1|687245_687734_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	81.3	4.3e-63
WP_000084220.1|687730_688237_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.8	5.2e-64
WP_000560081.1|688233_688941_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.5	3.4e-101
WP_000220205.1|688937_690065_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	3.3e-175
WP_000166743.1|690061_690517_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|690526_690820_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|690816_691158_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376374.1|691157_691490_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.0	2.0e-35
WP_001270304.1|691461_691650_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	79.0	1.5e-21
WP_000411340.1|691636_691894_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_051129153.1|692081_694052_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	69.8	3.6e-270
WP_001002797.1|694048_694378_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|694374_695559_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_152159310.1|695580_696138_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	83.1	2.7e-85
WP_001215677.1|698160_698691_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_000267954.1|698680_699406_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	3.8e-68
WP_000200791.1|699377_699923_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	71.4	3.5e-58
WP_001747522.1|699925_701626_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	1.7e-223
WP_071530430.1|701783_702005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015386347.1|702755_703769_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.2	4.8e-117
WP_015386348.1|703771_703954_-	hypothetical protein	NA	A0A0R6PIB1	Moraxella_phage	55.9	4.5e-10
WP_015386349.1|703995_704610_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.6	7.8e-38
WP_015386350.1|704711_704948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015386351.1|704982_705492_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	1.0e-83
WP_015386352.1|705499_705700_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
WP_047747761.1|705663_706005_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	85.8	1.3e-50
WP_047747762.1|706072_706306_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	77.9	4.6e-23
WP_032634595.1|706305_706533_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	3.9e-35
WP_152159311.1|706529_707390_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	82.2	2.9e-131
WP_152159312.1|707380_709789_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	94.9	0.0e+00
WP_152159313.1|709943_710132_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	96.8	1.0e-25
WP_152159314.1|710142_710376_+	DinI-like family protein	NA	A0A1S6L014	Salmonella_phage	84.4	3.0e-30
WP_152159315.1|710593_710794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152159316.1|710797_711592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023226466.1|711886_712942_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.8	8.1e-176
WP_152159317.1|712938_713664_-|terminase	terminase-like family protein	terminase	E5FFI8	Burkholderia_phage	33.3	2.9e-23
WP_152159318.1|713663_715430_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	94.9	0.0e+00
WP_052939296.1|715572_716406_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	97.5	1.4e-127
WP_152159319.1|716422_717487_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	2.7e-195
WP_152159320.1|717490_718141_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	98.6	9.2e-114
WP_152159321.1|718234_718699_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	94.8	2.5e-81
WP_000868184.1|718698_718902_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|718905_719121_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_023226473.1|719101_719611_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.2	1.4e-93
WP_152159322.1|719615_720011_+	peptidase	NA	A0A1S6KZZ2	Salmonella_phage	97.6	1.2e-60
WP_152159323.1|719992_720418_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	97.2	1.6e-66
WP_001039961.1|720513_720945_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_039505111.1|720937_721384_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	1.7e-66
WP_023223445.1|721452_722031_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	97.9	2.6e-107
WP_023223444.1|722027_722387_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	92.4	1.4e-55
WP_023223443.1|722373_723282_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	92.1	8.3e-145
WP_039505106.1|723274_723802_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	84.1	8.1e-84
WP_053216770.1|723809_725711_+	hypothetical protein	NA	Q37842	Escherichia_phage	76.8	5.1e-96
WP_023223490.1|725736_726147_+|tail	phage tail fiber assembly protein	tail	A0A291LAV4	Bordetella_phage	28.6	2.6e-05
WP_039505102.1|726280_727453_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	95.1	1.1e-213
WP_039505100.1|727462_727978_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.2	6.7e-91
WP_032233623.1|728032_728335_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	94.9	1.5e-42
WP_000763315.1|728349_728469_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_152159324.1|728461_731239_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	39.2	2.2e-116
WP_058800071.1|731235_731721_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	1.5e-71
WP_058800072.1|731717_732818_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	92.6	3.4e-185
WP_039505088.1|732886_733105_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	80.6	5.2e-29
WP_039505087.1|733120_733495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000237780.1|733823_734330_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001183951.1|734386_734950_-	NADAR family protein	NA	A8E2M1	Enterococcus_phage	44.7	1.4e-33
WP_001519776.1|735009_736857_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|737006_738752_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|738987_739203_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023136697.1|739430_740444_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	3.7e-109
742729:742749	attR	GATAAGCGCAGCGCCATCAGG	NA	NA	NA	NA
>prophage 4
NZ_CP045038	Salmonella enterica subsp. enterica serovar Muenster strain PJM1 chromosome, complete genome	5000356	1232235	1295504	5000356	tRNA,portal,transposase,tail,capsid,holin,integrase,head,terminase	Cronobacter_phage(55.26%)	62	1230442:1230458	1288565:1288581
1230442:1230458	attL	GGATGCTGCGAATACCG	NA	NA	NA	NA
WP_000469807.1|1232235_1233003_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1233043_1233391_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030989.1|1233546_1234767_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212375.1|1234759_1235278_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1235717_1236788_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023136471.1|1236797_1237919_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001607154.1|1237976_1238885_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200082.1|1238845_1240006_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1240105_1240153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000615542.1|1240316_1241336_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.2	1.4e-108
WP_000185337.1|1241375_1241681_-	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	47.5	1.6e-15
WP_000661531.1|1241778_1242117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000645096.1|1242142_1242475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681787.1|1242484_1243054_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.3	2.6e-43
WP_000922120.1|1243056_1243275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000994501.1|1243313_1245971_+	hypothetical protein	NA	A0A077K8T2	Ralstonia_phage	47.5	1.2e-244
WP_000088096.1|1245998_1246322_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_054175273.1|1246321_1247341_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_054175274.1|1247337_1249122_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_000273112.1|1249179_1250169_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	2.5e-46
WP_001176503.1|1250203_1251232_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1251243_1251942_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_000491223.1|1252040_1252493_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_000080871.1|1252489_1252972_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1252968_1253673_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1253669_1254797_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1254793_1255249_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1255261_1255558_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1255554_1255896_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1255895_1256228_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_001747519.1|1256154_1256388_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	83.1	1.7e-30
WP_000411500.1|1256374_1256632_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1256819_1258787_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1258783_1259113_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|1259109_1260294_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|1260286_1260874_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_001215677.1|1262897_1263428_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|1263417_1264143_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200789.1|1264114_1264660_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_054175283.1|1264662_1266363_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_001748131.1|1267396_1267783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1267940_1268279_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_125011025.1|1268420_1268606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197660.1|1268550_1269288_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1269419_1270400_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992639.1|1270396_1271128_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|1271257_1273831_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_088137194.1|1279484_1280739_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
WP_023137435.1|1281304_1281760_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	2.3e-34
WP_023137436.1|1281863_1283165_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	3.1e-44
WP_001264473.1|1283161_1283485_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_023137437.1|1283529_1284885_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082643.1|1284999_1287660_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023137438.1|1287713_1288394_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098732.1|1288466_1288886_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
1288565:1288581	attR	GGATGCTGCGAATACCG	NA	NA	NA	NA
WP_000997366.1|1289089_1290127_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1290242_1290932_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1291250_1291634_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188416.1|1291695_1292283_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000365861.1|1292385_1293285_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1293302_1294637_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1294766_1295504_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP045038	Salmonella enterica subsp. enterica serovar Muenster strain PJM1 chromosome, complete genome	5000356	1749790	1758961	5000356	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1749790_1750738_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1750721_1751453_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1751433_1751541_-	protein YohO	NA	NA	NA	NA	NA
WP_001240416.1|1751600_1752332_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1752554_1754240_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1754236_1754956_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1755002_1755470_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_023137005.1|1755526_1756057_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703136.1|1756228_1756687_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_023137006.1|1756927_1758961_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
NZ_CP045038	Salmonella enterica subsp. enterica serovar Muenster strain PJM1 chromosome, complete genome	5000356	1826189	1832486	5000356		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023136762.1|1826189_1827593_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.3	3.1e-21
WP_000981469.1|1827770_1828664_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697850.1|1829040_1830126_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	9.4e-103
WP_023223157.1|1830125_1831025_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_023136761.1|1831072_1831951_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	6.6e-107
WP_001100807.1|1831955_1832486_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	3.7e-52
>prophage 7
NZ_CP045038	Salmonella enterica subsp. enterica serovar Muenster strain PJM1 chromosome, complete genome	5000356	2050367	2056977	5000356	integrase	Pectobacterium_phage(16.67%)	11	2044810:2044824	2055700:2055714
2044810:2044824	attL	AATGACGTGTGAACG	NA	NA	NA	NA
WP_000856225.1|2050367_2050598_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_001633679.1|2050735_2051110_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_001633680.1|2051110_2051986_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2052002_2052356_+	YebY family protein	NA	NA	NA	NA	NA
WP_023137474.1|2052729_2053809_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	53.2	1.3e-101
WP_023137473.1|2053805_2054912_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	66.7	3.3e-55
WP_001014089.1|2054942_2055230_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	95.1	1.9e-39
WP_001633683.1|2055226_2055760_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	42.4	1.6e-10
2055700:2055714	attR	AATGACGTGTGAACG	NA	NA	NA	NA
WP_000789530.1|2056016_2056184_-	lytic enzyme	NA	NA	NA	NA	NA
WP_024134652.1|2056248_2056431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348550.1|2056485_2056977_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.6e-44
>prophage 8
NZ_CP045038	Salmonella enterica subsp. enterica serovar Muenster strain PJM1 chromosome, complete genome	5000356	2717082	2725353	5000356		Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|2717082_2717322_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001529135.1|2718194_2719004_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_152159333.1|2719076_2719454_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.6	4.8e-14
WP_000158845.1|2719601_2720144_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_000733630.1|2720327_2721056_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.6e-61
WP_000275697.1|2721072_2721486_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	3.2e-19
WP_023136605.1|2722530_2723655_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000444508.1|2724102_2725353_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 9
NZ_CP045038	Salmonella enterica subsp. enterica serovar Muenster strain PJM1 chromosome, complete genome	5000356	2913538	2924345	5000356	tail,integrase	Salmonella_phage(100.0%)	11	2902225:2902244	2938469:2938488
2902225:2902244	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_023223252.1|2913538_2914114_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	90.5	5.9e-96
WP_023223254.1|2915516_2916197_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	1.4e-128
WP_023223255.1|2916193_2917393_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	98.0	5.9e-215
WP_023223256.1|2917393_2917747_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	96.6	6.0e-59
WP_023223257.1|2917746_2918502_-	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	92.8	1.0e-127
WP_023209960.1|2918737_2919268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023223259.1|2919274_2919622_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	81.6	8.3e-29
WP_077911190.1|2921279_2922437_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	1.6e-217
WP_001237031.1|2922479_2922719_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2922759_2923008_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|2923052_2924345_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
2938469:2938488	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 10
NZ_CP045038	Salmonella enterica subsp. enterica serovar Muenster strain PJM1 chromosome, complete genome	5000356	4303941	4349475	5000356	transposase	Escherichia_phage(27.27%)	44	NA	NA
WP_001067858.1|4303941_4304646_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000480968.1|4305051_4305888_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|4306193_4306436_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021536379.1|4306477_4307155_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001493765.1|4307233_4308433_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|4308464_4309349_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|4309486_4309879_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_031613424.1|4311743_4312094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|4312470_4312788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|4312838_4313246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|4313275_4313737_-	hypothetical protein	NA	A0A2H4IBJ0	Erwinia_phage	37.9	7.7e-14
WP_001572393.1|4314073_4314304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024136338.1|4314340_4314628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001046767.1|4314665_4314920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|4314965_4315199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975182.1|4315420_4316317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572389.1|4316319_4316835_-	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000833382.1|4317049_4318477_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_000078514.1|4318727_4320047_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000121165.1|4320059_4320263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572381.1|4320326_4321532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|4321528_4322347_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001426317.1|4322989_4323370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|4323427_4324093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|4325055_4325847_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	NA	NA	NA	NA
WP_001354008.1|4326315_4326561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|4326598_4327462_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011264039.1|4327607_4327847_-	macrolide transporter	NA	NA	NA	NA	NA
WP_001067855.1|4327919_4328624_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014837927.1|4328660_4329788_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001330846.1|4329838_4330084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|4330089_4330281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|4330762_4331305_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|4331317_4332178_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|4332494_4333199_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_012477595.1|4334390_4335248_-	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
WP_032623598.1|4335312_4337043_-	peptidoglycan synthetase FtsI	NA	NA	NA	NA	NA
WP_000027057.1|4337451_4338312_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|4338494_4339052_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000608644.1|4339615_4340878_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_015387340.1|4341133_4342009_+	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_001393253.1|4342055_4342388_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001516695.1|4346647_4347304_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|4348083_4349475_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP045038	Salmonella enterica subsp. enterica serovar Muenster strain PJM1 chromosome, complete genome	5000356	4439203	4447436	5000356	transposase	Enterobacteria_phage(28.57%)	7	NA	NA
WP_001682306.1|4439203_4440127_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	94.5	5.4e-168
WP_001000406.1|4440443_4441979_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	88.1	4.8e-262
WP_000609174.1|4442028_4442376_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001201739.1|4442372_4442756_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	50.0	3.0e-11
WP_000096324.1|4443151_4444843_-	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	31.6	3.0e-55
WP_000114859.1|4445090_4446254_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	32.1	1.3e-17
WP_001121575.1|4446623_4447436_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	38.5	3.0e-45
>prophage 12
NZ_CP045038	Salmonella enterica subsp. enterica serovar Muenster strain PJM1 chromosome, complete genome	5000356	4509572	4557840	5000356	integrase,transposase,protease	Escherichia_phage(42.86%)	49	4504219:4504232	4515016:4515029
4504219:4504232	attL	CGGGATGAATATAA	NA	NA	NA	NA
WP_000795947.1|4509572_4510748_-|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	26.9	4.2e-16
WP_001285422.1|4510918_4511131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000255946.1|4512060_4513083_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_001317493.1|4513079_4513862_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001284313.1|4514699_4516199_-	kinase	NA	NA	NA	NA	NA
4515016:4515029	attR	CGGGATGAATATAA	NA	NA	NA	NA
WP_000081622.1|4516224_4517862_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|4517861_4518902_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|4518987_4519626_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|4519625_4520267_-	tellurium resistance protein TerX	NA	NA	NA	NA	NA
WP_024179285.1|4520289_4520928_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|4521390_4521858_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|4521875_4523084_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|4523094_4524051_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_001182411.1|4524050_4525130_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	8.1e-38
WP_001040059.1|4525131_4525905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|4525897_4527040_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|4527049_4528108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000254136.1|4528431_4529013_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|4529012_4530170_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|4530192_4530648_+	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
WP_000255079.1|4530670_4531711_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|4531759_4532338_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|4532405_4532981_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|4533409_4534651_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|4535213_4535495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|4535544_4535736_-	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	58.5	1.4e-09
WP_001371937.1|4535827_4536199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|4536541_4536934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624349.1|4536912_4537224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|4537537_4537831_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|4537835_4539161_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|4539221_4539428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|4539529_4539940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|4539952_4540768_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_001043843.1|4541021_4541447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224687.1|4541995_4542304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|4542319_4543177_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	38.7	1.8e-11
WP_001194555.1|4543238_4543442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|4544130_4544835_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018321.1|4545128_4545944_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_065311128.1|4547862_4548372_+	peptidase M14	NA	NA	NA	NA	NA
WP_065311127.1|4548477_4550379_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001364868.1|4550509_4550704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347021.1|4550765_4550945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202492.1|4552635_4552977_+	RamA family antibiotic efflux transcriptional regulator	NA	NA	NA	NA	NA
WP_071525219.1|4553734_4553923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105383.1|4554010_4555447_+	glutathione synthase	NA	NA	NA	NA	NA
WP_021546935.1|4555864_4556869_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|4557135_4557840_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 13
NZ_CP045038	Salmonella enterica subsp. enterica serovar Muenster strain PJM1 chromosome, complete genome	5000356	4721836	4787058	5000356	lysis,terminase,portal,tail,capsid,holin,integrase,head,protease,plate	Escherichia_phage(41.3%)	78	4751695:4751741	4782433:4782479
WP_000208240.1|4721836_4722367_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|4722376_4723708_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139642.1|4723774_4724704_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|4724796_4725282_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|4725503_4725743_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|4726141_4726987_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_001523753.1|4727007_4728516_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250624.1|4728627_4729638_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796303.1|4729734_4730481_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155238.1|4730587_4731016_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802241.1|4731116_4731713_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|4731825_4732593_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_023137067.1|4732684_4733449_-	epimerase	NA	NA	NA	NA	NA
WP_001543603.1|4733458_4733749_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_023137066.1|4733831_4734707_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|4734735_4735758_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|4735786_4736788_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911133.1|4736784_4737828_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167248.1|4737821_4739357_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|4739612_4740572_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_023137065.1|4740660_4742253_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173080.1|4742266_4742617_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_072101541.1|4742706_4742844_-	CDP-diacylglycerol pyrophosphatase	NA	NA	NA	NA	NA
WP_000061014.1|4742853_4743018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001535809.1|4743115_4743838_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557882.1|4743900_4744941_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_023137064.1|4744950_4745910_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777307.1|4745920_4747255_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750757.1|4747517_4748273_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|4748373_4749363_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|4749566_4750529_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_023137063.1|4750713_4751616_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4751695:4751741	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4751852_4752071_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882949.1|4752152_4753316_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
WP_000978885.1|4753315_4753795_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_023223134.1|4753809_4756257_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	94.8	0.0e+00
WP_000785970.1|4756249_4756369_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|4756401_4756677_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|4756733_4757252_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286720.1|4757264_4758455_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	4.8e-225
WP_010835363.1|4758514_4759108_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.8e-103
WP_022631136.1|4759914_4760448_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.3	5.7e-77
WP_010835343.1|4760452_4761070_-|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	83.6	5.3e-95
WP_023210806.1|4761039_4762506_-|tail	phage tail-like protein	tail	A0A0F7LBW5	Escherichia_phage	84.6	1.1e-143
WP_023223103.1|4762562_4763114_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.5e-104
WP_001121478.1|4763106_4764015_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_000127163.1|4764019_4764367_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093737.1|4764363_4764999_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	9.0e-114
WP_001001780.1|4765065_4765518_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_000917156.1|4765510_4765978_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
WP_001440152.1|4765940_4766114_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000040673.1|4766085_4766511_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	4.7e-66
WP_000736607.1|4766498_4766924_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.8e-58
WP_001144101.1|4766938_4767436_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|4767435_4767717_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|4767720_4767924_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|4767923_4768433_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_023223104.1|4768532_4769276_-|terminase	terminase endonuclease subunit	terminase	Q94MH3	Enterobacteria_phage	98.0	3.1e-121
WP_001248558.1|4769279_4770353_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	100.0	6.7e-202
WP_001074420.1|4770411_4771266_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MF5	Enterobacteria_phage	99.6	2.2e-139
WP_000156844.1|4771439_4773212_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
WP_006678249.1|4773211_4774246_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
WP_023223105.1|4774586_4776419_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.5	4.1e-90
WP_023223106.1|4776535_4778818_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.4	0.0e+00
WP_000027666.1|4778807_4779083_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	97.8	1.6e-43
WP_001113272.1|4779079_4779304_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	97.3	8.5e-35
WP_001277964.1|4779303_4779606_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	97.0	2.5e-45
WP_000288879.1|4779605_4779830_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	2.3e-32
WP_000217677.1|4779893_4780394_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001308179.1|4780563_4780836_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4780972_4781266_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4781335_4782316_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001233463.1|4782501_4783002_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4782433:4782479	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|4783152_4783851_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|4783847_4785221_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000133441.1|4785271_4785667_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_077909921.1|4785678_4786431_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|4786437_4787058_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
