The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044961	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 chromosome, complete genome	5004306	364500	376502	5004306	integrase	Enterobacteria_phage(33.33%)	15	353307:353320	371807:371820
353307:353320	attL	ACGCGCCAGCGGTT	NA	NA	NA	NA
WP_001043675.1|364500_365553_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|365835_366939_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|366950_368201_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001529718.1|368557_369772_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_001304884.1|369937_370153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000035054.1|370200_370404_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_001529719.1|370403_370835_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_033567214.1|370847_371681_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	9.0e-21
WP_000476150.1|371673_371856_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
371807:371820	attR	AACCGCTGGCGCGT	NA	NA	NA	NA
WP_032150717.1|371849_372878_+	ash family protein	NA	Q8W643	Enterobacteria_phage	53.3	1.0e-13
WP_001065738.1|372870_373065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|373061_373325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|373321_373543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001529721.1|373535_374138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001529722.1|374150_376502_+	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	48.5	6.8e-74
>prophage 2
NZ_CP044961	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 chromosome, complete genome	5004306	994956	1003688	5004306	transposase,protease	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|994956_996075_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|996071_998018_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|998147_998369_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|998692_999013_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|999043_1001320_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1001511_1001970_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_119920232.1|1002142_1002418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085983316.1|1002432_1003688_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NZ_CP044961	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 chromosome, complete genome	5004306	1053714	1144631	5004306	terminase,lysis,tail,protease,integrase,holin,tRNA	Salmonella_phage(60.87%)	92	1056623:1056642	1120519:1120538
WP_001154025.1|1053714_1054518_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1054510_1055833_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1055813_1056518_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1056517_1060984_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1056623:1056642	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1061328_1063170_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1063429_1063978_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1064005_1064653_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1064714_1065905_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1066089_1067181_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1067787_1069188_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1069388_1069850_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301921.1|1069846_1070080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544849.1|1070166_1071381_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1071625_1073062_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1073139_1074342_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020899445.1|1074536_1075829_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000065276.1|1075873_1076122_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1076162_1076402_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_014344386.1|1076444_1077602_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_136614733.1|1077564_1080765_-	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	78.6	0.0e+00
WP_023139985.1|1080891_1081242_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_000917559.1|1081290_1081422_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_000981510.1|1081718_1082153_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_001555460.1|1082258_1082486_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000426364.1|1082520_1082841_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_080072894.1|1082925_1083909_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000800012.1|1083911_1084661_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_020899441.1|1084671_1085019_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000065109.1|1085015_1085474_+	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_000850457.1|1085477_1085786_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000208142.1|1085789_1086434_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_001536080.1|1086433_1086691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|1086745_1087723_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_022630855.1|1087734_1088331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|1088922_1089156_+	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_000763780.1|1089265_1089487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929788.1|1089571_1090174_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_022631099.1|1090173_1090380_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.0e-34
WP_001096542.1|1090382_1090994_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_151884598.1|1090990_1091131_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	9.4e-08
WP_001097242.1|1091127_1091817_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_001534733.1|1092011_1092137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1092272_1092722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1093082_1093769_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_077248428.1|1094044_1094374_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_077907023.1|1094357_1094810_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	3.9e-79
WP_024143045.1|1094827_1095274_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000867564.1|1095742_1096288_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_020899435.1|1097408_1097741_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000725267.1|1097840_1098338_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1098454_1098988_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1099077_1099773_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1099782_1100520_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001576012.1|1100417_1101122_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000178849.1|1104582_1104825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031247858.1|1104878_1107317_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000143167.1|1107316_1107898_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|1108373_1109342_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1109989_1110616_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_031603423.1|1110684_1110984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1110968_1111655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1111925_1112117_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1112543_1115156_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1115363_1116374_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1116539_1117082_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1117078_1118188_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1118286_1120395_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1120407_1122315_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1120519:1120538	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1122329_1123583_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1123587_1125228_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_033567177.1|1125224_1125788_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1126043_1126211_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1126310_1126829_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1126897_1128658_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1128843_1129296_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1129367_1130420_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1130776_1131286_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1131502_1132108_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1132094_1134248_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1134266_1134713_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1134836_1136891_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1136926_1137385_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1137479_1138142_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1138312_1138729_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1138773_1139091_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1139148_1140360_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1140574_1141123_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1141148_1141928_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1141976_1142258_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1142254_1142584_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1142670_1143330_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1143950_1144631_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP044961	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 chromosome, complete genome	5004306	1931343	1938152	5004306	tail,integrase	Salmonella_phage(33.33%)	11	1926206:1926228	1935921:1935943
1926206:1926228	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1931343_1932225_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1932697_1932886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1932950_1933118_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1933374_1933908_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1933961_1934192_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1934381_1934876_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1934935_1935790_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1936163_1936517_-	YebY family protein	NA	NA	NA	NA	NA
1935921:1935943	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1936533_1937409_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1937409_1937784_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1937921_1938152_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP044961	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 chromosome, complete genome	5004306	2013602	2092882	5004306	transposase,plate,terminase,head,portal,tail,protease,integrase,holin,capsid	Salmonella_phage(75.71%)	107	2020140:2020155	2094505:2094520
WP_000502119.1|2013602_2014061_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2014241_2015447_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079806.1|2015525_2017013_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146802.1|2017269_2018673_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2018687_2019095_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2019094_2019463_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_022630963.1|2019534_2021019_+	alpha-amylase	NA	NA	NA	NA	NA
2020140:2020155	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2021058_2021484_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2021669_2022875_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2022871_2023105_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2023369_2023756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2023875_2024190_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2024406_2026089_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2026081_2027077_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2027069_2027777_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2027776_2029147_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2029168_2029612_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2029608_2030826_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2030930_2031398_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2031402_2032407_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2032403_2032817_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2032816_2033194_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2033193_2033931_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2033940_2034210_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2034218_2035013_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2035294_2035918_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2035956_2036205_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2036279_2036507_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2036816_2037632_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2037610_2039323_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2039487_2039733_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2039749_2040661_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2040836_2041757_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2041745_2042216_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2042196_2043627_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2043700_2044396_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2044487_2044787_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2045435_2046632_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2046892_2047081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2047091_2047304_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2047758_2049027_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2049029_2049449_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2049575_2049737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2050930_2051143_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2051139_2051553_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2051600_2051714_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2051788_2052022_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2052135_2052741_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000554735.1|2052710_2054273_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_001207832.1|2054259_2054847_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785581.1|2054849_2055929_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_000605055.1|2055921_2056335_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_001273649.1|2056339_2056873_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066632.1|2056872_2057931_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_033567259.1|2057927_2059268_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001033736.1|2059327_2059777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785381.1|2059793_2061719_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_000588852.1|2061803_2062130_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515953.1|2062126_2062483_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_033567258.1|2062482_2063979_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_065305283.1|2063968_2064133_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_000779213.1|2064154_2064712_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_151884603.1|2064708_2065221_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.1	6.2e-81
WP_033567256.1|2065192_2065597_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_000927721.1|2065593_2065917_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033572442.1|2065919_2066120_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_033572441.1|2066169_2067375_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033567207.1|2067389_2068040_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_000466255.1|2068017_2069259_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605609.1|2069258_2069441_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_033567282.1|2069452_2071186_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000929191.1|2071182_2071677_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135098.1|2071802_2072153_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2072203_2072536_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_097053918.1|2072835_2073114_-	peptidase	NA	Q8SBD8	Shigella_phage	74.4	1.3e-24
WP_001530346.1|2072998_2073391_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2073387_2074002_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2074001_2074283_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2074269_2074656_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2074801_2075059_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2075209_2075962_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_070793644.1|2075975_2076965_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_001061452.1|2076972_2077833_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_000779148.1|2077849_2078239_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_033567232.1|2078247_2079123_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000054228.1|2079119_2079593_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567233.1|2079589_2080564_-	protein phage	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000620702.1|2080560_2080785_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087404.1|2080781_2081924_-	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000509731.1|2081920_2082475_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2082503_2082728_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_071530432.1|2082666_2082852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020636.1|2082825_2083521_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2083726_2084065_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2084027_2084252_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|2084791_2085163_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2085220_2086048_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2086184_2086724_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2086794_2087328_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2087329_2087587_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2087597_2088179_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|2088182_2088752_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2088776_2089019_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2089020_2090010_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2090301_2091099_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2091470_2091761_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2092408_2092882_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2094505:2094520	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 6
NZ_CP044961	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 chromosome, complete genome	5004306	2178877	2189383	5004306		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2178877_2180191_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2180217_2181297_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2181301_2182075_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2182071_2183064_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2183069_2183621_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2183621_2184500_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2184547_2185447_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2185446_2186532_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2186908_2187802_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2187979_2189383_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 7
NZ_CP044961	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 chromosome, complete genome	5004306	2257692	2266863	5004306	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2257692_2259726_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2259966_2260425_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2260596_2261127_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2261183_2261651_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2261697_2262417_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2262413_2264099_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2264321_2265053_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2265112_2265220_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2265200_2265932_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2265915_2266863_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
NZ_CP044961	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 chromosome, complete genome	5004306	2338915	2344680	5004306	tail	Salmonella_phage(50.0%)	6	NA	NA
WP_000806401.1|2338915_2339419_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2339446_2339737_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2340084_2341914_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2341967_2342411_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2342788_2343316_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_058799204.1|2343318_2344680_-	hypothetical protein	NA	A0A0U2SH60	Escherichia_phage	74.4	6.8e-42
>prophage 9
NZ_CP044961	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 chromosome, complete genome	5004306	2684079	2784201	5004306	transposase,terminase,lysis,head,portal,tail,protease,integrase,holin,tRNA,capsid	Salmonella_phage(41.27%)	108	2710223:2710238	2779290:2779305
WP_000940032.1|2684079_2684811_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2684929_2685733_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2685877_2686756_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2686937_2687981_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2687984_2688803_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2688813_2689827_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2689827_2690814_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2690804_2691443_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2691568_2692846_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2692840_2693980_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2694175_2695429_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2695753_2696944_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2697125_2698670_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2699030_2700362_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2700444_2702589_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2702644_2704105_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2704153_2704492_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2704568_2705906_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2705902_2706667_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2706668_2708099_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_000970045.1|2708748_2712636_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
2710223:2710238	attL	AACGCGGAAATCACCA	NA	NA	NA	NA
WP_001747289.1|2712657_2712891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2712891_2714436_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2714486_2715038_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2715062_2715698_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2715701_2717063_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001048530.1|2717073_2717967_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2718082_2718931_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684027.1|2718969_2719887_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2719908_2721105_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2721220_2722147_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2722184_2722445_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2722556_2722937_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_033567169.1|2723680_2724409_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2724420_2725326_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2725322_2726003_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2726276_2727251_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2727267_2729067_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2729471_2730965_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2731443_2731581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2732293_2732458_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2733037_2733103_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2733165_2733378_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2733484_2733712_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2733808_2734387_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2734376_2735201_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2735197_2737570_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2737623_2737866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2737904_2741267_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2741328_2741976_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2741873_2742611_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2742617_2743316_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2743325_2743655_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|2743657_2746753_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|2746724_2747063_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2747059_2747455_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_077248250.1|2747505_2748252_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000033885.1|2748259_2748661_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2748769_2749900_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2749948_2750527_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2750554_2750938_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2750948_2751308_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2751365_2752394_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2752448_2752796_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2752808_2754305_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2754294_2755875_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2755871_2756075_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2756058_2757990_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2757961_2758507_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2758793_2759195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2759430_2759883_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_151884604.1|2759900_2760353_-	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2760336_2760666_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2760941_2761628_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2761842_2762031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2762537_2763101_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_072095218.1|2763191_2763377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097241.1|2763373_2764051_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2764047_2764188_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2764184_2764796_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_001241017.1|2764798_2765005_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_000929803.1|2765004_2765607_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001574100.1|2765646_2765952_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_001217666.1|2765941_2766181_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_071530012.1|2766372_2766654_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	92.5	1.4e-47
WP_000445792.1|2767045_2767519_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000065105.1|2767518_2768043_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_020899441.1|2768039_2768387_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000800012.1|2768397_2769147_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000062941.1|2769149_2770133_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2770217_2770592_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000869364.1|2770557_2770794_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001009037.1|2770923_2771328_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000917562.1|2771726_2771885_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2771906_2772257_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_151257998.1|2772383_2775311_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.5	0.0e+00
WP_077248255.1|2775273_2776431_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2776473_2776713_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2776753_2777038_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2777015_2778245_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2778742_2779222_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2779218_2780175_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
2779290:2779305	attR	TGGTGATTTCCGCGTT	NA	NA	NA	NA
WP_001168374.1|2780174_2780825_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2780856_2781432_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2781428_2781593_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001521719.1|2781592_2781772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000989177.1|2781856_2783479_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2783463_2784201_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP044961	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 chromosome, complete genome	5004306	2788841	2905402	5004306	transposase,plate,terminase,head,portal,tail,integrase,holin,tRNA,capsid	Enterobacteria_phage(59.32%)	113	2885776:2885835	2911005:2911825
WP_000997368.1|2788841_2789879_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|2790082_2790502_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000183639.1|2790574_2791255_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082639.1|2791308_2793969_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2794083_2795439_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|2795483_2795807_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807809.1|2795803_2797105_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
WP_000985653.1|2797208_2797664_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_001235094.1|2803544_2806118_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_000992639.1|2806247_2806979_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2806975_2807956_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2808087_2808825_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2809096_2809435_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000215756.1|2809585_2810392_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	53.2	1.5e-65
WP_072032588.1|2810388_2810595_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001519189.1|2810725_2811022_-	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	67.2	9.0e-16
WP_000078916.1|2811157_2811298_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488105.1|2811488_2811749_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_032419529.1|2811791_2812901_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.1e-194
WP_000005390.1|2813058_2814243_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.7	1.5e-226
WP_000290447.1|2814242_2814755_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	9.2e-93
WP_000665308.1|2814809_2815175_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000763327.1|2815210_2815339_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_032419528.1|2815325_2818133_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	93.8	0.0e+00
WP_000979954.1|2818145_2818634_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000905084.1|2818660_2819260_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.9	6.8e-87
WP_024144069.1|2819479_2819968_+	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	81.4	9.8e-68
WP_010835343.1|2819937_2820555_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	83.6	5.3e-95
WP_022631136.1|2820559_2821093_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.3	5.7e-77
WP_151884605.1|2821095_2822964_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	55.3	8.4e-160
WP_106668242.1|2822960_2823569_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.2e-86
WP_001574602.1|2823561_2824458_-|plate	baseplate J-like family protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	2.1e-156
WP_000213447.1|2824461_2824812_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_097477625.1|2824808_2825390_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	95.3	6.8e-100
WP_000356339.1|2825386_2826022_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_000920594.1|2826014_2826482_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_024132949.1|2826468_2826648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151884606.1|2826619_2827027_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	3.2e-64
WP_000072334.1|2827023_2827416_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	6.4e-70
WP_000104350.1|2827412_2827736_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864913.1|2827738_2827939_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	2.3e-31
WP_000063082.1|2827938_2828433_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_151884607.1|2828535_2829336_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.0	3.2e-124
WP_001055125.1|2829381_2830434_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	93.7	2.7e-187
WP_151884608.1|2830457_2831294_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.2	9.6e-148
WP_151884609.1|2831448_2833200_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087812.1|2833199_2834246_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001140702.1|2834739_2836965_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_000502620.1|2836988_2838110_-	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	3.7e-17
WP_151884610.1|2838290_2841074_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	86.6	0.0e+00
WP_000564227.1|2841070_2841460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124829034.1|2841456_2842074_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	38.3	2.7e-06
WP_032419531.1|2842085_2842385_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	9.6e-42
WP_000153674.1|2842381_2842627_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_024232567.1|2842623_2842827_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000021661.1|2842913_2843027_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.6e-10
WP_000514277.1|2843023_2843266_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_024232568.1|2843277_2843565_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	1.0e-32
WP_024232569.1|2843575_2843917_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	5.1e-55
WP_001001394.1|2843935_2844262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032152547.1|2844357_2844660_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	52.0	2.3e-19
WP_024232571.1|2844726_2845716_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	53.5	3.4e-99
WP_010989056.1|2845883_2845931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200080.1|2846030_2847191_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210995.1|2847151_2848060_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225191.1|2848117_2849239_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2849248_2850319_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2850758_2851277_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2851269_2852490_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2852646_2852994_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2853034_2853802_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2853846_2854395_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2854413_2854662_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2854975_2856337_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2856502_2857294_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2857313_2858600_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|2858720_2859326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2859360_2859951_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2860073_2860952_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2861037_2862699_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2862847_2863186_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2863351_2863642_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2863631_2864108_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2864257_2864740_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237668.1|2865353_2876828_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533858.1|2876892_2878302_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2878298_2880479_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2880486_2881650_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001067855.1|2883102_2883807_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|2884391_2885252_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_023150081.1|2885401_2885803_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
2885776:2885835	attL	TGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|2885839_2886544_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000480968.1|2886604_2887441_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|2887440_2888244_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001043265.1|2888304_2889120_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000240536.1|2889427_2890279_-	replication protein	NA	NA	NA	NA	NA
WP_001067855.1|2890853_2891558_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|2891604_2892909_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000204520.1|2892947_2893655_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|2893651_2893888_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|2893884_2894247_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|2894264_2895959_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|2896010_2896433_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732293.1|2896468_2896744_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|2896757_2897108_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|2897179_2897614_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001089068.1|2898897_2900103_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_001322387.1|2900181_2900808_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001447544.1|2900785_2901472_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|2901479_2901866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562370.1|2901858_2902179_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000599533.1|2902622_2903828_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001352368.1|2904193_2905402_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
2911005:2911825	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCATCAATACTACTCCCTACGTTTCCCGTTACCTTGCTGTCGGTACGTTTACCTCATTGTCTGAAAGGTTATTTGCGAAGTTATCATTAATAATCCACGGGCGTCTGGTATGCGAATCCAGTTCCCCAATCCTGGCGCTTTGCCTGTGCGACCATACGCGCGTAAATAAGCCTGAAACCAAACTTCACCGCTTAACGCTCTCATCTTTCCCGATTTTTACGCAAAAAATCATCACATGATCAAGTGTCATATTAGTTATTGCATTTTACAAATGATATTGGTAATTATTATCATTCTCATTAACGACTTGTTCGATTTATGACGTGGAGAGAGAGGATTTCTCATGCGTATTCTGTTTGTCGGTCCACCACTGTATGGACTGCTATACCCTGTGCTGTCTCTGGCGCAAGCGTTTCGTGTTAATGGCCATGAAGTACTGATTGCAAGCGGTGGCAAATTTGCACAGAAAGCAGCCGAAGCTGGGTTGGTGGTATTTGACGCTGCGCCTGGTTTCGATTCGGAAGCGGGTTATCGCCGTCAGGAGGCATTACGAAAAGAAAATAACATTGGAACAAAAATGGGGAACTTCTCATTCTTCAGCGAAGAGATGACTGACCCGCTGGTCGCGTTCGCCGGGCAGTGGCGACCAGATCTCATCGTCTACCCTCCCCTTGGGGTCGTTGGACCACTGATTGCCGCTAAGTATGACATTCCGGTAGTGATGCAAACCGTCGGCTTCGGTCATACGCCCTGGCACATCAAAG	NA	NA	NA	NA
>prophage 11
NZ_CP044961	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 chromosome, complete genome	5004306	3366809	3408339	5004306	terminase,head,portal,tail,integrase,holin,tRNA,capsid	Cronobacter_phage(68.42%)	48	3362146:3362161	3405561:3405576
3362146:3362161	attL	ATGGCGGCGTAGCCAG	NA	NA	NA	NA
WP_001264394.1|3366809_3367823_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|3368050_3368266_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3368501_3370247_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3370396_3372244_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3372367_3372874_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000340945.1|3373197_3373500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000746531.1|3373931_3374117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680744.1|3374868_3376569_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
WP_000200789.1|3376571_3377117_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000267957.1|3377088_3377814_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000861353.1|3377803_3378358_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000084307.1|3378370_3380605_-|tail	tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_001001828.1|3380614_3381202_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000136921.1|3381194_3382379_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001002797.1|3382375_3382705_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811094.1|3382701_3384672_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_000411339.1|3384859_3385117_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_001670161.1|3385103_3385292_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	77.4	1.5e-21
WP_000376373.1|3385263_3385596_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_000175560.1|3385595_3385937_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3385933_3386227_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3386236_3386692_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|3386688_3387816_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000560080.1|3387812_3388520_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000084218.1|3388516_3389023_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000447487.1|3389019_3389508_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_001218537.1|3389568_3390270_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000550495.1|3390273_3391296_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_000018800.1|3391357_3392161_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_001151939.1|3392321_3394097_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000038213.1|3394093_3395155_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001552031.1|3395151_3395475_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353141.1|3395448_3395655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170874.1|3395774_3397796_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000279404.1|3397792_3398653_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000551169.1|3398643_3398877_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|3398944_3399346_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996837.1|3399345_3399771_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000643375.1|3399760_3399988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|3399997_3400501_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001247711.1|3400531_3400753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514631.1|3400896_3401478_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_000568372.1|3401494_3402061_+	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_001145219.1|3402064_3403102_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000627044.1|3403091_3404873_+	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_000213760.1|3405130_3405898_-	siderophore-interacting protein	NA	NA	NA	NA	NA
3405561:3405576	attR	CTGGCTACGCCGCCAT	NA	NA	NA	NA
WP_000983441.1|3406129_3406777_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478472.1|3406773_3408339_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
>prophage 12
NZ_CP044961	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 chromosome, complete genome	5004306	4443312	4463732	5004306	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4443312_4444041_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4444237_4444528_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4444776_4445232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4445228_4445834_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4445838_4447584_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4447586_4448219_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4448211_4449327_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4449317_4449677_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4449840_4451388_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4451387_4452317_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4452313_4452676_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4453003_4453726_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4453735_4454779_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4454766_4454976_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4454975_4455929_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4455928_4458283_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4458379_4458508_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4458467_4458785_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4458836_4459361_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4459360_4460788_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4460777_4460975_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4460971_4461427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4461586_4461901_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4461913_4462519_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4462521_4462809_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4463384_4463732_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 13
NZ_CP044961	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 chromosome, complete genome	5004306	4490181	4534045	5004306	plate,terminase,head,portal,tail,protease,integrase,holin,tRNA,capsid	Shigella_phage(44.26%)	67	4480753:4480768	4541878:4541893
4480753:4480768	attL	GGCAGTTTTTGTCGCT	NA	NA	NA	NA
WP_000549966.1|4490181_4490616_+	hypothetical protein	NA	A0A0S2SYH1	Pseudomonas_phage	51.0	5.2e-36
WP_001093909.1|4490642_4490915_-	hypothetical protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
WP_001061343.1|4490951_4491524_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	96.8	3.7e-106
WP_000206745.1|4491523_4492333_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	61.8	3.3e-76
WP_001565177.1|4492332_4492695_-	phage protein	NA	U5P092	Shigella_phage	97.5	1.5e-65
WP_000008210.1|4492685_4493222_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_033567165.1|4493349_4494174_-	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	1.1e-148
WP_001323604.1|4494239_4494620_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	1.3e-62
WP_000141753.1|4495039_4495285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514782.1|4495202_4495478_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
WP_001369946.1|4495486_4495690_-	ClpX C4-type zinc finger	NA	A0A1C9IHZ4	Salmonella_phage	68.3	8.9e-15
WP_000848748.1|4495861_4496536_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4496626_4496827_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515829.1|4496870_4497428_+	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_001250269.1|4497603_4497783_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104942.1|4497772_4498714_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_086936917.1|4498710_4499205_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	4.7e-86
WP_001433188.1|4499204_4499858_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_000210170.1|4499854_4500181_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001398927.1|4500177_4500567_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	100.0	5.4e-69
WP_001061444.1|4500586_4501396_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_033567167.1|4501403_4502393_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.1e-194
WP_048306282.1|4502406_4503159_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	99.6	9.0e-145
WP_001624505.1|4503309_4503567_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|4503712_4504099_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|4504085_4504367_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|4504366_4504981_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|4504977_4505370_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_097053918.1|4505254_4505533_+	peptidase	NA	Q8SBD8	Shigella_phage	74.4	1.3e-24
WP_001379492.1|4505832_4506165_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|4506215_4506566_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_048306293.1|4506691_4507177_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	98.8	6.1e-86
WP_000088161.1|4507190_4508924_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	0.0e+00
WP_000605606.1|4508935_4509118_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001514795.1|4509117_4510359_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.0e-241
WP_021578635.1|4510336_4510987_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	3.6e-118
WP_021567480.1|4511001_4512207_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	3.5e-223
WP_021577001.1|4512256_4512484_+	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
WP_000927719.1|4512458_4512782_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702388.1|4512778_4513189_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_022630978.1|4513163_4513670_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	5.0e-91
WP_000779279.1|4513666_4514227_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_000497751.1|4514235_4514406_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_022630977.1|4514389_4515886_+|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000090998.1|4515885_4516242_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|4516241_4516511_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_015675131.1|4516477_4516660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023200330.1|4516652_4518485_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	4.7e-304
WP_001439754.1|4518566_4519079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000219913.1|4519169_4520498_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_000999499.1|4520494_4521574_+|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_022630975.1|4521573_4522122_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000424732.1|4522121_4522547_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630974.1|4522533_4523592_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_000383548.1|4523582_4524167_+	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_023200332.1|4524170_4525703_+	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	97.9	1.6e-241
WP_006678265.1|4525672_4526290_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	100.0	5.7e-113
WP_001747940.1|4526293_4526701_-|tail	tail assembly chaperone	tail	A0A1B0V844	Salmonella_phage	100.0	4.9e-73
WP_006678262.1|4526702_4527431_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	100.0	2.8e-143
WP_000639149.1|4527756_4528320_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_077248251.1|4528344_4528467_+|capsid	capsid protein	capsid	Q9JFR8	Wheat_rosette_stunt_virus	73.5	2.0e-06
WP_033567204.1|4528463_4528712_-	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	98.8	2.0e-37
WP_000332264.1|4528773_4529871_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_022630972.1|4529959_4530997_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891414.1|4531164_4531407_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235551.1|4531581_4532565_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918353.1|4532629_4534045_+	replicative DNA helicase DnaB	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
4541878:4541893	attR	AGCGACAAAAACTGCC	NA	NA	NA	NA
>prophage 1
NZ_CP044962	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014881 plasmid pPNCS014881.1, complete sequence	126750	18822	48548	126750	transposase	Escherichia_phage(60.0%)	20	NA	NA
WP_001067855.1|18822_19527_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|20077_20782_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001550559.1|20815_21307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743213.1|22141_22366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|22576_24070_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|24100_24985_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_094304302.1|25201_26416_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	3.2e-19
WP_001067858.1|27454_28159_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001617865.1|28735_29611_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_000608644.1|29860_31123_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001516695.1|35382_36039_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|36818_38210_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|38246_38819_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|38955_39546_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_000219391.1|40630_41536_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|41657_42362_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|44890_45595_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000587837.1|45737_46280_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|46292_47153_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|47843_48548_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
