The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044957	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 chromosome, complete genome	4787290	975193	983925	4787290	protease,transposase	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|975193_976312_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|976308_978255_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|978384_978606_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|978929_979250_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|979280_981557_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|981748_982207_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_119920232.1|982379_982655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085983316.1|982669_983925_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 2
NZ_CP044957	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 chromosome, complete genome	4787290	1034018	1132814	4787290	integrase,tail,tRNA,terminase,holin,portal,protease,lysis	Salmonella_phage(45.45%)	101	1036927:1036946	1108702:1108721
WP_001154025.1|1034018_1034822_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1034814_1036137_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1036117_1036822_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1036821_1041288_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1036927:1036946	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1041632_1043474_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1043733_1044282_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1044309_1044957_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1045018_1046209_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1046393_1047485_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1048091_1049492_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1049692_1050154_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301921.1|1050150_1050384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544849.1|1050470_1051685_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1051929_1053366_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1053443_1054646_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1054840_1056133_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1056177_1056426_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1056466_1056706_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1056748_1057906_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1057868_1060754_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1060880_1061180_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1061201_1061360_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|1061352_1061613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1061662_1062073_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1062192_1062432_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1062397_1062772_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1062856_1063840_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800013.1|1063842_1064592_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.2	1.1e-137
WP_079832191.1|1064602_1064950_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	95.7	2.3e-55
WP_000065108.1|1064946_1065258_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1065335_1065626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1065917_1066151_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1066262_1066484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1066566_1067169_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001241019.1|1067168_1067375_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_001096552.1|1067377_1067989_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1067985_1068132_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1068121_1068919_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1068985_1069303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1069476_1069602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1069737_1070187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1070547_1071234_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1071509_1071839_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1071822_1072275_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1072292_1072772_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1072979_1073513_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1073469_1075608_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1075604_1075811_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|1075837_1077355_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_001107908.1|1079437_1079761_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1079753_1080053_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1080033_1080600_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1080596_1080998_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1081009_1081759_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1081804_1082203_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1082199_1082529_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1082608_1085596_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1085592_1085925_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1086023_1086521_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1086637_1087171_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1087260_1087956_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1087965_1088703_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1088600_1089305_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000178849.1|1092765_1093008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080193197.1|1093061_1095500_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.6	3.7e-91
WP_000143167.1|1095499_1096081_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001526469.1|1096556_1097525_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000334547.1|1098172_1098799_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1098867_1099167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1099151_1099838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1100108_1100300_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1100726_1103339_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1103546_1104557_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1104722_1105265_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1105261_1106371_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1106469_1108578_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1108590_1110498_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1108702:1108721	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1110512_1111766_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1111770_1113411_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1113407_1113971_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1114226_1114394_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1114493_1115012_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|1115080_1116841_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1117026_1117479_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1117550_1118603_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1118959_1119469_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1119685_1120291_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1120277_1122431_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1122449_1122896_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1123019_1125074_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1125109_1125568_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1125662_1126325_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1126495_1126912_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1126956_1127274_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1127331_1128543_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1128757_1129306_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1129331_1130111_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1130159_1130441_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1130437_1130767_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1130853_1131513_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1132133_1132814_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 3
NZ_CP044957	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 chromosome, complete genome	4787290	1922022	1928831	4787290	integrase,tail	Salmonella_phage(33.33%)	11	1916885:1916907	1926600:1926622
1916885:1916907	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1922022_1922904_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1923376_1923565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1923629_1923797_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1924053_1924587_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1924640_1924871_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1925060_1925555_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1925614_1926469_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1926842_1927196_-	YebY family protein	NA	NA	NA	NA	NA
1926600:1926622	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1927212_1928088_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1928088_1928463_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1928600_1928831_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 4
NZ_CP044957	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 chromosome, complete genome	4787290	2004281	2083625	4787290	integrase,tail,lysis,head,holin,portal,capsid,plate,transposase,protease,terminase	Salmonella_phage(85.07%)	105	2010819:2010834	2085248:2085263
WP_000502119.1|2004281_2004740_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2004920_2006126_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2006204_2007692_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2007948_2009352_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2009366_2009774_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2009773_2010142_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2010213_2011698_+	alpha-amylase	NA	NA	NA	NA	NA
2010819:2010834	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2011737_2012163_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2012348_2013554_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2013550_2013784_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2014048_2014435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2014554_2014869_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2015085_2016768_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2016760_2017756_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2017748_2018456_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2018455_2019826_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2019847_2020291_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2020287_2021505_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2021609_2022077_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2022081_2023086_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2023082_2023496_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2023495_2023873_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2023872_2024610_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2024619_2024889_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2024897_2025692_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2025973_2026597_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2026635_2026884_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2026958_2027186_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2027495_2028311_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2028289_2030002_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2030166_2030412_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2030428_2031340_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2031515_2032436_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2032424_2032895_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2032875_2034306_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2034379_2035075_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2035166_2035466_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2036115_2037312_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2037572_2037761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2037771_2037984_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2038438_2039707_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2039709_2040129_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2040255_2040417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099112411.1|2040718_2040934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2041047_2041269_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2041481_2042489_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_000760554.1|2042773_2043343_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000554737.1|2043342_2044905_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_001207832.1|2044891_2045479_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_014343855.1|2045481_2046003_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_014343856.1|2046037_2046583_-	phage protein	NA	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|2046554_2046968_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2046972_2047506_-|plate	phage baseplate assembly protein V	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066635.1|2047505_2048564_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	99.7	6.6e-202
WP_000863818.1|2048560_2049901_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2049934_2051863_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2051947_2052274_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2052270_2052627_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2052626_2054123_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|2054112_2054277_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|2054280_2054841_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2054837_2055350_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2055321_2055726_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2055722_2056046_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2056048_2056249_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|2056299_2057505_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|2057519_2058170_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2058147_2059389_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2059388_2059571_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2059582_2061316_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2061312_2061807_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2061932_2062283_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2062343_2062646_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2062865_2063285_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2063497_2063983_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2063979_2064594_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2064596_2064941_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2065102_2065537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2065466_2065724_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2065856_2066480_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001202278.1|2066490_2067480_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	9.2e-190
WP_001061457.1|2067487_2068348_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|2068364_2068754_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2068750_2069644_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2069643_2070126_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2070127_2070946_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2070942_2071167_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2071163_2072321_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2072317_2072872_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2072900_2073125_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_071529734.1|2073063_2073249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020636.1|2073222_2073918_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2074732_2075104_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|2075161_2075989_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|2076125_2076665_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2076735_2076966_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2076962_2077478_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2077474_2078092_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2078088_2078922_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2078925_2079495_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2079519_2079762_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2079763_2080753_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2081044_2081842_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2082213_2082504_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2083151_2083625_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2085248:2085263	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 5
NZ_CP044957	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 chromosome, complete genome	4787290	2169619	2180125	4787290		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2169619_2170933_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2170959_2172039_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2172043_2172817_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2172813_2173806_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2173811_2174363_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2174363_2175242_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2175289_2176189_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2176188_2177274_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2177650_2178544_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2178721_2180125_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NZ_CP044957	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 chromosome, complete genome	4787290	2248432	2257603	4787290	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2248432_2250466_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2250706_2251165_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2251336_2251867_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2251923_2252391_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2252437_2253157_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2253153_2254839_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2255061_2255793_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2255852_2255960_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2255940_2256672_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2256655_2257603_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NZ_CP044957	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 chromosome, complete genome	4787290	2277010	2343383	4787290	holin,tail,transposase,lysis	Salmonella_phage(25.0%)	59	NA	NA
WP_000989296.1|2277010_2277706_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2277859_2278744_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2278920_2279640_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2279636_2279882_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2280086_2281328_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_000956095.1|2281321_2282557_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2282631_2283642_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2283657_2285178_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2285311_2286310_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2286808_2287831_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2287980_2289123_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2289137_2289806_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2290135_2290993_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2290981_2291371_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2291375_2292743_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2292959_2293847_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2293879_2295202_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2295245_2297237_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2297581_2299051_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2299240_2300104_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2300224_2301274_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2301352_2302210_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2302274_2303963_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2303979_2304918_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2304917_2306048_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2306416_2307598_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2307662_2308328_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2308329_2308452_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2308839_2309094_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2309417_2309990_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2310202_2311189_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2311218_2311938_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2312351_2312924_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2313249_2314806_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2314912_2316718_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2316727_2317822_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2317821_2318847_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2318848_2320438_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2320441_2320786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2321176_2322367_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2322394_2323090_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2323241_2325002_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2325126_2325411_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2325519_2326140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2326167_2327175_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2327354_2327582_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2327613_2329374_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2329654_2330158_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_020843597.1|2330185_2330476_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_001118621.1|2332095_2333019_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	100.0	8.4e-177
WP_000022213.1|2333772_2334216_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2334593_2335121_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2335123_2336365_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2336957_2337287_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_001526364.1|2337583_2338915_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2338943_2339312_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_014344510.1|2339326_2340316_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	2.4e-190
WP_001115840.1|2340644_2343011_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2343179_2343383_-|tail	tail protein	tail	NA	NA	NA	NA
>prophage 8
NZ_CP044957	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 chromosome, complete genome	4787290	2683165	2784657	4787290	integrase,tail,tRNA,lysis,head,holin,portal,capsid,transposase,protease,terminase	Salmonella_phage(43.55%)	109	2709309:2709324	2779746:2779761
WP_000940032.1|2683165_2683897_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2684015_2684819_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_151884626.1|2684963_2685842_+	alpha/beta fold hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	1.0e-14
WP_000985204.1|2686023_2687067_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2687070_2687889_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2687899_2688913_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2688913_2689900_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2689890_2690529_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2690654_2691932_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2691926_2693066_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2693261_2694515_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2694839_2696030_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2696211_2697756_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_136571518.1|2698116_2699448_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2699530_2701675_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2701730_2703191_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2703239_2703578_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2703654_2704992_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2704988_2705753_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2705754_2707185_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
WP_000970045.1|2707834_2711722_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
2709309:2709324	attL	AACGCGGAAATCACCA	NA	NA	NA	NA
WP_001747289.1|2711743_2711977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2711977_2713522_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2713572_2714124_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2714148_2714784_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2714787_2716149_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001048530.1|2716159_2717053_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2717168_2718017_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2718055_2718973_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|2718994_2720191_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2720306_2721233_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2721270_2721531_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2721642_2722023_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2722022_2722754_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2722765_2723494_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2723505_2724411_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2724407_2725088_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2725361_2726336_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2726352_2728152_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2728556_2730050_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2730504_2730642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2731354_2731519_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2732098_2732164_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2732226_2732439_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2732545_2732773_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2732869_2733448_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2733437_2734262_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2734258_2736631_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2736684_2736927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526393.1|2736965_2740328_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.6	0.0e+00
WP_000246126.1|2740389_2741037_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2740934_2741672_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2741678_2742377_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2742386_2742716_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|2742718_2745814_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|2745785_2746124_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2746120_2746516_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2746566_2747313_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2747320_2747722_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2747830_2748961_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2749009_2749588_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2749615_2749999_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2750009_2750369_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2750426_2751455_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2751509_2751857_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2751869_2753366_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2753355_2754936_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2754932_2755136_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2755119_2757051_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2757022_2757568_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2757854_2758256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2758491_2758944_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|2758961_2759414_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2759397_2759727_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2760002_2760689_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2760903_2761092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2761598_2762162_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_072095218.1|2762252_2762438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097241.1|2762434_2763112_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2763108_2763249_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2763245_2763857_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_001241017.1|2763859_2764066_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_000929791.1|2764065_2764668_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2764702_2764951_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2765067_2765301_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000704096.1|2765570_2766563_+	peptidase M85	NA	NA	NA	NA	NA
WP_000065102.1|2766589_2767108_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	89.8	1.4e-40
WP_000113618.1|2767104_2767452_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	96.5	2.7e-56
WP_000800012.1|2767462_2768212_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_001527034.1|2768214_2769303_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	88.5	1.4e-154
WP_010835408.1|2769387_2769762_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_001274939.1|2769721_2769964_-	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	67.9	5.6e-24
WP_014344514.1|2770036_2770450_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	78.0	1.5e-45
WP_000106861.1|2770592_2771702_+	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	58.4	1.6e-118
WP_000917561.1|2772182_2772341_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	96.2	2.6e-22
WP_014344515.1|2772362_2772713_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	2.7e-59
WP_000017130.1|2772839_2775767_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	95.7	0.0e+00
WP_077905217.1|2775729_2776887_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	1.8e-216
WP_001237032.1|2776929_2777169_+	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	97.5	2.2e-36
WP_014344516.1|2777209_2777494_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	87.2	1.1e-42
WP_001007935.1|2777471_2778701_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	6.4e-233
WP_000589087.1|2779198_2779678_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2779674_2780631_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
2779746:2779761	attR	TGGTGATTTCCGCGTT	NA	NA	NA	NA
WP_001168374.1|2780630_2781281_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2781312_2781888_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2781884_2782049_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001521719.1|2782048_2782228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000989177.1|2782312_2783935_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2783919_2784657_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP044957	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 chromosome, complete genome	4787290	4348157	4368577	4787290	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4348157_4348886_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4349082_4349373_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4349621_4350077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4350073_4350679_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4350683_4352429_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4352431_4353064_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4353056_4354172_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4354162_4354522_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4354685_4356233_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4356232_4357162_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4357158_4357521_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4357848_4358571_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4358580_4359624_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4359611_4359821_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4359820_4360774_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|4360773_4363128_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|4363224_4363353_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4363312_4363630_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4363681_4364206_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4364205_4365633_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4365622_4365820_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4365816_4366272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4366431_4366746_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270440.1|4366758_4367364_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	1.2e-59
WP_001226442.1|4367366_4367654_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4368229_4368577_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP044958	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence	247576	170424	220489	247576	transposase,protease,integrase	Caulobacter_phage(16.67%)	48	168722:168736	188252:188266
168722:168736	attL	AAAAAAGTTACTTTT	NA	NA	NA	NA
WP_001086279.1|170424_171606_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001324690.1|171820_172033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807689.1|173618_174374_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
WP_001232452.1|175858_176932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247564.1|177009_177153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000416123.1|177188_177665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111572.1|177812_178088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011011074.1|178077_178278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000341067.1|178344_178737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012817914.1|178736_179135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493077.1|179149_179353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001209044.1|179758_180565_+	HNH endonuclease	NA	G0X580	Salmonella_phage	37.9	1.3e-13
WP_089617546.1|180670_181090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089617545.1|181397_181847_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	35.4	7.5e-06
WP_001287388.1|182614_183019_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001114073.1|183639_183993_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_000783215.1|184040_184403_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_032248920.1|185805_187305_-	kinase	NA	NA	NA	NA	NA
WP_073528081.1|187332_189066_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
188252:188266	attR	AAAAGTAACTTTTTT	NA	NA	NA	NA
WP_032248959.1|189065_190106_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026585.1|190198_190837_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_032248957.1|190837_191479_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	1.8e-05
WP_073528080.1|191503_192142_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_042014838.1|192947_193142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042014837.1|193404_193863_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_042014833.1|194666_195623_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_004210251.1|195622_196702_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	1.1e-39
WP_004181732.1|196703_197477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042014831.1|197469_198612_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.4	1.8e-32
WP_042014827.1|198623_199682_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
WP_042014825.1|199992_200577_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
WP_042014824.1|200573_201725_+	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_004026604.1|201747_202203_+	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_073528079.1|202226_203267_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.3	4.1e-71
WP_004026609.1|203305_203884_+	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_000301240.1|203970_204546_+	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
WP_001176934.1|204630_205872_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
WP_001100942.1|206208_206856_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001118621.1|207255_208179_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	100.0	8.4e-177
WP_000019452.1|208330_209311_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	4.4e-184
WP_000780222.1|209588_209870_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|209850_210180_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_001084041.1|210855_212928_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000085084.1|212924_214316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001196200.1|214392_214974_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	48.3	5.5e-41
WP_085012003.1|215132_218141_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_010892343.1|218363_219032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000090709.1|219646_220489_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP044959	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.2, complete sequence	93838	0	12622	93838		Enterobacteria_phage(100.0%)	12	NA	NA
WP_001526823.1|2600_2801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000979451.1|2949_3252_+	transcriptional regulator PefB	NA	NA	NA	NA	NA
WP_000748205.1|3526_4045_+	major pilin PefA	NA	NA	NA	NA	NA
WP_000007893.1|4272_6681_+	outer membrane usher protein PefC	NA	NA	NA	NA	NA
WP_001038510.1|6673_7366_+	fimbrial chaperone PefD	NA	NA	NA	NA	NA
WP_010999940.1|7380_7938_+	membrane protein	NA	NA	NA	NA	NA
WP_014343944.1|8190_9066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000004313.1|9497_9710_+	transcriptional regulator PefI	NA	NA	NA	NA	NA
WP_001526811.1|9694_10045_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000178592.1|10289_10943_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_010999938.1|11075_11975_+	YjiK family protein	NA	NA	NA	NA	NA
WP_000725062.1|12064_12622_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	38.5	4.5e-24
>prophage 2
NZ_CP044959	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.2, complete sequence	93838	18251	18992	93838		Xanthomonas_phage(100.0%)	1	NA	NA
WP_000177629.1|18251_18992_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	3.9e-07
>prophage 3
NZ_CP044959	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.2, complete sequence	93838	36844	37264	93838		Salmonella_phage(100.0%)	1	NA	NA
WP_001229397.1|36844_37264_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	88.9	2.2e-68
>prophage 4
NZ_CP044959	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.2, complete sequence	93838	43733	43955	93838		Vibrio_virus(100.0%)	1	NA	NA
WP_001278699.1|43733_43955_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	42.3	1.0e-08
>prophage 5
NZ_CP044959	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.2, complete sequence	93838	54188	58100	93838		Emiliania_huxleyi_virus(33.33%)	5	NA	NA
WP_000117513.1|54188_56186_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.0	5.5e-16
WP_000131520.1|56254_56497_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000741240.1|56551_57070_-	single-stranded DNA-binding protein SSB2	NA	A0A0A0P1Q9	Enterobacteria_phage	82.5	6.8e-51
WP_015059457.1|57100_57229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015983.1|57776_58100_-	hypothetical protein	NA	G8C7V1	Escherichia_phage	56.5	2.0e-13
>prophage 6
NZ_CP044959	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.2, complete sequence	93838	61292	70588	93838	transposase	Escherichia_phage(28.57%)	12	NA	NA
WP_000088645.1|61292_61973_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_000091632.1|62117_62306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|62354_62711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|62703_63174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|63684_64107_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457541.1|64106_65381_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_001541561.1|65462_66440_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_000427676.1|66436_67642_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|68056_68998_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|69029_69596_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|69652_69988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|70171_70588_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
>prophage 7
NZ_CP044959	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.2, complete sequence	93838	74137	74698	93838		Ralstonia_phage(100.0%)	1	NA	NA
WP_001240331.1|74137_74698_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	42.7	1.3e-31
>prophage 8
NZ_CP044959	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.2, complete sequence	93838	80205	80370	93838		Salmonella_phage(100.0%)	1	NA	NA
WP_001576629.1|80205_80370_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 9
NZ_CP044959	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.2, complete sequence	93838	85792	86143	93838		Escherichia_phage(100.0%)	1	NA	NA
WP_001541541.1|85792_86143_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
>prophage 10
NZ_CP044959	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.2, complete sequence	93838	89203	89986	93838	integrase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
WP_000082169.1|89203_89986_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
>prophage 1
NZ_CP044960	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence	91139	0	4471	91139		Enterobacteria_phage(100.0%)	5	NA	NA
WP_151884631.1|823_1030_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000079932.1|1026_1296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001690254.1|2203_3235_-	replication initiation protein	NA	NA	NA	NA	NA
WP_071527963.1|3210_3531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001324596.1|4207_4471_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	6.1e-08
>prophage 2
NZ_CP044960	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence	91139	16335	16896	91139		Ralstonia_phage(100.0%)	1	NA	NA
WP_000014005.1|16335_16896_+	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	33.7	6.1e-05
>prophage 3
NZ_CP044960	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence	91139	20594	24656	91139	integrase	Pseudomonas_phage(50.0%)	4	17795:17807	21943:21955
17795:17807	attL	TTTTTGTCCAGCG	NA	NA	NA	NA
WP_001139955.1|20594_21749_+|integrase	integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.0e-46
WP_001238931.1|21899_22724_+	conjugal transfer protein TraE	NA	NA	NA	NA	NA
21943:21955	attR	CGCTGGACAAAAA	NA	NA	NA	NA
WP_000976353.1|22809_24012_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000977522.1|24071_24656_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	39.8	7.7e-11
>prophage 4
NZ_CP044960	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence	91139	27770	32179	91139		Wolbachia_phage(50.0%)	2	NA	NA
WP_000014584.1|27770_28322_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	1.5e-19
WP_151884632.1|28411_32179_+	DNA primase	NA	A0A1B0VML8	Pseudomonas_phage	29.4	1.3e-18
>prophage 5
NZ_CP044960	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence	91139	60381	69190	91139	transposase	Sodalis_phage(16.67%)	12	NA	NA
WP_000038335.1|60381_61308_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.7e-66
WP_001247862.1|61372_61639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218863.1|61731_62166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348083.1|62188_62434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086167205.1|62455_62755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000117622.1|62894_63395_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	27.3	4.2e-05
WP_151884635.1|63842_65018_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	80.8	1.8e-171
WP_001276261.1|65147_65867_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845900.1|65863_66298_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_151884636.1|66352_68311_-	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	29.2	3.3e-21
WP_112341507.1|68372_68606_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	48.9	7.3e-05
WP_112341509.1|68662_69190_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	71.8	4.6e-47
>prophage 6
NZ_CP044960	Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.3, complete sequence	91139	72942	81089	91139	integrase	Vibrio_phage(16.67%)	11	77946:77960	84545:84559
WP_000086147.1|72942_73626_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
WP_001134387.1|74009_74936_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_151884639.1|74949_75225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618110.1|75329_75578_+	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|75574_76012_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_021293549.1|76011_77286_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.4	1.7e-143
WP_001278818.1|77287_77704_-	recombinase	NA	NA	NA	NA	NA
WP_000688514.1|77696_78677_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
77946:77960	attL	TTCAGCATTATAAAT	NA	NA	NA	NA
WP_000030199.1|79090_79399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144036.1|79485_80130_-	ParA family protein	NA	NA	NA	NA	NA
WP_001164201.1|80309_81089_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.0e-55
84545:84559	attR	TTCAGCATTATAAAT	NA	NA	NA	NA
