The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031223	Psychrobacillus sp. PB01 chromosome, complete genome	4332095	588846	641254	4332095	tRNA,protease,transposase	Bacillus_phage(33.33%)	47	NA	NA
WP_151701939.1|588846_590082_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_151698768.1|591695_592295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151698769.1|592597_593113_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_151698770.1|595003_596281_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_151698771.1|596817_597480_+	peptidase E	NA	NA	NA	NA	NA
WP_151698772.1|598285_598768_-	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_151698773.1|600047_600263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151698774.1|600830_602246_-	dipeptidase	NA	NA	NA	NA	NA
WP_151701940.1|602525_603488_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_151698775.1|606288_606837_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0F6TH34	Sinorhizobium_phage	30.4	4.6e-05
WP_151698776.1|607186_608755_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	26.1	1.3e-41
WP_151698777.1|608931_609114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151698778.1|609161_610166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151698779.1|610252_611011_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_151701941.1|611199_611763_+	NADH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_151698780.1|612096_612546_+	DUF1569 domain-containing protein	NA	NA	NA	NA	NA
WP_151701942.1|613116_613572_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_151698781.1|613564_614875_+	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_151698782.1|615136_615988_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	1.7e-35
WP_151698783.1|615884_616301_-	helix-turn-helix domain-containing protein	NA	A0A0N7GFG6	Staphylococcus_phage	47.8	5.3e-14
WP_151698784.1|616545_617634_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_151698785.1|617636_618272_+	response regulator	NA	W8CYM9	Bacillus_phage	22.7	2.8e-06
WP_151698786.1|618680_619613_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.6	6.5e-28
WP_151698787.1|619629_620856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151698788.1|620852_621944_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_151698789.1|622069_623368_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	63.2	2.6e-152
WP_151698790.1|623692_624103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151698791.1|624234_624639_+	neutral trehalase	NA	NA	NA	NA	NA
WP_151698792.1|624786_625269_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_151698793.1|625507_625687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151698794.1|625717_626026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151698795.1|626387_628577_-	DNA topoisomerase III	NA	NA	NA	NA	NA
WP_151698796.1|628766_629180_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_151698797.1|629183_630032_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_151698798.1|630083_630728_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_151698799.1|630717_631068_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_151698800.1|631717_631897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151698801.1|631968_633255_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_151701943.1|633579_633867_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_151698802.1|633882_634092_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_151698803.1|634168_636586_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	1.8e-117
WP_151698804.1|636698_637244_+	DUF1541 domain-containing protein	NA	NA	NA	NA	NA
WP_151698805.1|637309_637894_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_151698806.1|638130_638805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151698807.1|638816_639308_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_151698808.1|639407_640055_+	YitT family protein	NA	NA	NA	NA	NA
WP_151698809.1|640088_641254_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	1.8e-35
>prophage 2
NZ_CP031223	Psychrobacillus sp. PB01 chromosome, complete genome	4332095	766014	778132	4332095		Synechococcus_phage(25.0%)	9	NA	NA
WP_151698930.1|766014_769269_+	glycosyltransferase	NA	A0A1V0SKE1	Klosneuvirus	33.1	7.6e-07
WP_151698931.1|769338_770712_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.4	3.3e-44
WP_151698932.1|771066_772035_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	57.1	1.3e-100
WP_151698933.1|772050_773004_+	SDR family NAD(P)-dependent oxidoreductase	NA	M4QRT5	Synechococcus_phage	30.5	1.4e-30
WP_151698934.1|773542_774550_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_151698935.1|774808_775681_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	67.5	3.0e-107
WP_151698936.1|775695_776259_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.3	2.0e-40
WP_151698937.1|776264_777287_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.4	1.2e-80
WP_151698938.1|777283_778132_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.3	3.4e-39
>prophage 3
NZ_CP031223	Psychrobacillus sp. PB01 chromosome, complete genome	4332095	836403	872598	4332095	transposase	Bacillus_phage(42.86%)	26	NA	NA
WP_151698977.1|836403_837966_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_151698978.1|837962_838709_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	38.1	2.2e-42
WP_151698979.1|838760_839324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151698980.1|840572_841589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151698981.1|842450_843389_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	30.7	4.9e-15
WP_151698982.1|843398_843815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151698983.1|844706_845840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151698984.1|846223_847549_+	MFS transporter	NA	NA	NA	NA	NA
WP_151698985.1|848199_849444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151698986.1|850326_850527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151698987.1|851081_852368_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_151698988.1|853298_856307_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	4.7e-35
WP_151698989.1|856307_857399_+	response regulator	NA	NA	NA	NA	NA
WP_151698990.1|857634_861660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151698991.1|861767_862619_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.3	1.4e-40
WP_151698992.1|862624_863026_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_151698993.1|863630_864635_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_151698994.1|864646_865603_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_151698995.1|865629_866232_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_151701953.1|866341_867052_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_151701954.1|867057_867909_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.4	5.6e-18
WP_151698996.1|867901_868714_+	ATP-binding cassette domain-containing protein	NA	F2Y165	Organic_Lake_phycodnavirus	28.1	5.7e-12
WP_151698997.1|868732_869644_+	ribokinase	NA	NA	NA	NA	NA
WP_151698998.1|870682_871225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151698999.1|871339_872191_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.0	4.0e-40
WP_151698992.1|872196_872598_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP031223	Psychrobacillus sp. PB01 chromosome, complete genome	4332095	936699	949877	4332095		Bacillus_phage(50.0%)	6	NA	NA
WP_151699032.1|936699_941250_+	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	35.8	1.5e-29
WP_151699033.1|942294_942957_-	response regulator	NA	W8CYM9	Bacillus_phage	27.8	2.8e-09
WP_151699034.1|943057_945136_+	hypothetical protein	NA	W8CYF6	Bacillus_phage	27.3	3.8e-20
WP_151699035.1|945405_945762_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	31.2	1.0e-05
WP_151699036.1|946320_947253_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	42.5	2.3e-25
WP_151699037.1|947429_949877_+	DUF4073 domain-containing protein	NA	B8QTT6	Erwinia_phage	51.7	1.2e-07
>prophage 5
NZ_CP031223	Psychrobacillus sp. PB01 chromosome, complete genome	4332095	1764941	1780007	4332095	integrase,tail	uncultured_Caudovirales_phage(33.33%)	21	1757865:1757879	1773377:1773391
1757865:1757879	attL	AACTTTTGTTTCTTG	NA	NA	NA	NA
WP_151699713.1|1764941_1766108_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5S7K9	Streptococcus_phage	35.3	3.8e-57
WP_151699714.1|1766181_1767189_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151699715.1|1767348_1767585_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151699716.1|1767581_1767848_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151699717.1|1767913_1770172_+	DNA primase	NA	A0A2H4JCU9	uncultured_Caudovirales_phage	40.3	9.3e-153
WP_151699718.1|1770465_1770702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151699719.1|1770698_1771007_+	hypothetical protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	38.0	2.8e-12
WP_151699720.1|1771007_1771382_+	hypothetical protein	NA	A0A288WG73	Bacillus_phage	29.5	1.0e-08
WP_151699721.1|1771387_1771738_+	hypothetical protein	NA	A0A1W6JNN5	Staphylococcus_phage	37.7	1.6e-08
WP_151699722.1|1771756_1772446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151699723.1|1772483_1772750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151699724.1|1772892_1773084_+	DUF3954 domain-containing protein	NA	NA	NA	NA	NA
WP_151699725.1|1773172_1776526_+|tail	phage tail tape measure protein	tail	M1PKM6	Streptococcus_phage	47.0	1.4e-88
1773377:1773391	attR	CAAGAAACAAAAGTT	NA	NA	NA	NA
WP_151699726.1|1776525_1777239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151699727.1|1777243_1777561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151699728.1|1777678_1777870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151699729.1|1777866_1778193_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_151699730.1|1778353_1778545_+	hypothetical protein	NA	R9TQ08	Paenibacillus_phage	61.0	3.2e-14
WP_151699731.1|1778561_1778762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151699732.1|1778835_1779390_-	hypothetical protein	NA	A0A2H4JA12	uncultured_Caudovirales_phage	51.5	2.7e-21
WP_151699733.1|1779404_1780007_-	hypothetical protein	NA	A0A1S5QTS6	Bacillus_phage	49.5	6.0e-51
>prophage 6
NZ_CP031223	Psychrobacillus sp. PB01 chromosome, complete genome	4332095	2272826	2339509	4332095	protease,transposase	Pseudomonas_phage(33.33%)	58	NA	NA
WP_151700172.1|2272826_2274092_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_151700173.1|2274292_2274517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151700174.1|2274578_2275211_-	signal peptidase I	NA	NA	NA	NA	NA
WP_151700175.1|2275459_2275900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151702026.1|2276084_2276906_-	DUF4111 domain-containing protein	NA	NA	NA	NA	NA
WP_151700176.1|2279086_2279530_-	carbon monoxide dehydrogenase	NA	NA	NA	NA	NA
WP_151700177.1|2280259_2280442_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_151700178.1|2280962_2282876_-	squalene--hopene cyclase	NA	NA	NA	NA	NA
WP_151700179.1|2283041_2283236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700180.1|2283361_2283889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700181.1|2284025_2284868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700182.1|2285363_2285936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700183.1|2285950_2286496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700184.1|2287891_2288131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700185.1|2288632_2289142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700186.1|2289431_2290277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151700187.1|2290600_2291023_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_151700188.1|2291117_2291645_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_151700189.1|2291955_2292237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700190.1|2292523_2293114_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_151700191.1|2293147_2293369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700192.1|2293409_2293916_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_151699939.1|2295343_2296485_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.6	1.3e-78
WP_151700193.1|2296901_2298353_+	4-hydroxyphenylacetate 3-monooxygenase, oxygenase component	NA	NA	NA	NA	NA
WP_151700194.1|2298387_2298591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700195.1|2302142_2303339_-	MFS transporter	NA	NA	NA	NA	NA
WP_151700196.1|2303450_2303837_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151700197.1|2303889_2304735_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	52.4	2.2e-75
WP_151700198.1|2306043_2306523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700199.1|2308261_2309479_-	MFS transporter	NA	NA	NA	NA	NA
WP_151700200.1|2309647_2310136_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151700201.1|2310321_2311776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700202.1|2311956_2312502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700203.1|2313779_2314340_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_151700204.1|2315613_2316003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700205.1|2316393_2316588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151700206.1|2316626_2317175_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151700207.1|2317325_2317970_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_151700208.1|2317982_2318327_+	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_151700209.1|2319599_2319926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700210.1|2320180_2321131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700211.1|2321216_2322461_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.1	3.7e-26
WP_151700212.1|2322980_2323850_-	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	36.0	1.3e-22
WP_151699916.1|2325519_2326797_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_151699902.1|2327026_2328192_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	2.4e-35
WP_151700213.1|2328572_2329106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700214.1|2329347_2330145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700215.1|2330137_2330656_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_151700216.1|2331163_2331367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151700217.1|2331661_2331853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700218.1|2332072_2332453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700219.1|2332966_2333242_+	DUF3888 domain-containing protein	NA	NA	NA	NA	NA
WP_151700220.1|2333392_2333770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700221.1|2335154_2335550_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_151700222.1|2335698_2335944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700223.1|2336141_2336510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700224.1|2336785_2337951_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.9	3.1e-35
WP_151702027.1|2338273_2339509_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP031223	Psychrobacillus sp. PB01 chromosome, complete genome	4332095	3448940	3457231	4332095		Synechococcus_phage(33.33%)	8	NA	NA
WP_151701178.1|3448940_3449513_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.2	4.7e-21
WP_151701179.1|3449512_3450568_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	41.3	4.9e-64
WP_151701180.1|3450579_3452001_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	1.3e-51
WP_151701181.1|3451976_3454208_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.2	1.0e-164
WP_151701182.1|3454191_3454878_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_151701183.1|3454874_3455129_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_151701184.1|3455125_3455842_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	44.0	2.0e-48
WP_151701185.1|3455935_3457231_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	24.5	4.7e-16
>prophage 8
NZ_CP031223	Psychrobacillus sp. PB01 chromosome, complete genome	4332095	3551707	3607291	4332095	integrase,transposase	Tupanvirus(38.46%)	35	3543008:3543022	3564965:3564979
3543008:3543022	attL	TAATTTTTAAGCTTA	NA	NA	NA	NA
WP_151701252.1|3551707_3552841_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	35.4	1.8e-56
WP_151702092.1|3552945_3553131_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151701253.1|3553457_3554357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151701254.1|3555010_3556291_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_151701255.1|3556305_3557400_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2I6UG75	Salinibacter_virus	21.0	8.2e-06
WP_151701256.1|3557396_3558356_+|integrase	tyrosine-type recombinase/integrase	integrase	Q8SBN2	Clostridium_phage	25.6	2.1e-05
WP_151701257.1|3559483_3559912_-	DUF4181 domain-containing protein	NA	NA	NA	NA	NA
WP_151702093.1|3561022_3561253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151700231.1|3561556_3562507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151701258.1|3562592_3563837_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.9	9.6e-27
WP_151700233.1|3564357_3565224_-	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	35.3	2.6e-23
3564965:3564979	attR	TAATTTTTAAGCTTA	NA	NA	NA	NA
WP_151701259.1|3566997_3567585_+	hypothetical protein	NA	Q0ILF6	Lactococcus_phage	35.4	3.9e-10
WP_151701260.1|3568096_3571318_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	32.7	3.0e-64
WP_151701261.1|3571651_3571930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151701262.1|3571962_3572142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151701263.1|3572155_3572380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151701264.1|3572585_3573065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151701265.1|3573048_3573285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151701266.1|3573278_3573512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151702094.1|3573546_3573759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151701267.1|3573755_3574793_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_151701268.1|3574827_3575969_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.6	5.8e-79
WP_151701269.1|3576041_3576926_-	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_151701270.1|3576959_3578186_-	cytochrome P450	NA	NA	NA	NA	NA
WP_151701271.1|3578280_3578535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151701272.1|3578916_3579567_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_151701273.1|3579591_3580353_-	putative thioesterase	NA	NA	NA	NA	NA
WP_151701274.1|3580408_3588109_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	29.3	1.3e-182
WP_151701275.1|3588149_3598187_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	28.9	3.4e-170
WP_151701276.1|3598191_3599973_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	28.5	5.2e-58
WP_151701277.1|3600019_3601927_-	hypothetical protein	NA	A0A2K9KZV5	Tupanvirus	23.1	2.8e-25
WP_151701278.1|3602156_3603440_+	MFS transporter	NA	NA	NA	NA	NA
WP_151702095.1|3604364_3605684_+	MFS transporter	NA	NA	NA	NA	NA
WP_151701279.1|3605727_3606948_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_151702096.1|3607135_3607291_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	70.0	7.0e-12
>prophage 9
NZ_CP031223	Psychrobacillus sp. PB01 chromosome, complete genome	4332095	4058085	4090634	4332095	protease,integrase,transposase	Lactococcus_phage(20.0%)	26	4061938:4061957	4077866:4077885
WP_151702102.1|4058085_4059627_+|transposase	IS21 family transposase	transposase	A0A059NT83	Lactococcus_phage	24.8	1.1e-16
WP_151701318.1|4059623_4060397_+	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	32.6	5.2e-31
WP_151701667.1|4060343_4060715_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_151701668.1|4060921_4061398_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
4061938:4061957	attL	TTTGTAAAAAAGATTGATCA	NA	NA	NA	NA
WP_151701669.1|4062031_4062244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151701670.1|4062625_4063072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151701671.1|4063141_4064179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151701672.1|4064627_4065377_-	DUF2290 domain-containing protein	NA	NA	NA	NA	NA
WP_151701673.1|4065373_4067548_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_151702129.1|4067771_4069631_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_151701674.1|4069687_4071514_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_151701675.1|4071599_4073291_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_151701676.1|4073265_4075425_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_151701677.1|4075421_4076261_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_151701678.1|4076267_4077713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151702130.1|4077917_4079720_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	39.5	2.1e-99
4077866:4077885	attR	TGATCAATCTTTTTTACAAA	NA	NA	NA	NA
WP_151701679.1|4080314_4080842_-	chromate transporter	NA	NA	NA	NA	NA
WP_151702131.1|4080838_4081417_-	chromate transporter	NA	NA	NA	NA	NA
WP_151701680.1|4081428_4083033_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_151701681.1|4083067_4084069_-	dipeptide ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	26.1	7.5e-06
WP_151702132.1|4084043_4085048_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.2	5.4e-20
WP_151701682.1|4085056_4086613_-	glutathione ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_151701683.1|4086636_4087533_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_151701684.1|4087549_4088491_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_151701685.1|4089373_4089823_-	AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_151701686.1|4090118_4090634_-|protease	DJ-1/PfpI/YhbO family deglycase/protease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP031223	Psychrobacillus sp. PB01 chromosome, complete genome	4332095	4298742	4308914	4332095	transposase	Bacillus_phage(50.0%)	8	NA	NA
WP_151698809.1|4298742_4299907_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	1.8e-35
WP_151701876.1|4299966_4300755_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	36.5	1.4e-42
WP_151701877.1|4300767_4301580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151701878.1|4301557_4302895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151701879.1|4302885_4304709_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	34.1	1.0e-32
WP_151701880.1|4304714_4305419_-	response regulator	NA	W8CYM9	Bacillus_phage	44.0	6.6e-49
WP_151702149.1|4305679_4307083_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A075BS18	Microcystis_phage	45.3	8.9e-21
WP_151701881.1|4307627_4308914_-	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	36.8	6.8e-68
