The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043028	Pseudobutyrivibrio xylanivorans strain MA3014 chromosome 1, complete sequence	3412851	621708	698036	3412851	integrase,transposase,tRNA	Catovirus(33.33%)	59	693505:693527	697688:697710
WP_151622368.1|621708_622911_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	43.0	1.6e-82
WP_151622369.1|623000_623624_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	26.4	8.0e-06
WP_151622370.1|623818_625090_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_151622371.1|625086_625770_-	transglycosylase SLT domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	57.6	1.6e-31
WP_151622372.1|626339_626966_+	RNase H	NA	A0A2H4JH24	uncultured_Caudovirales_phage	37.4	1.0e-29
WP_151622373.1|626979_628017_+	peptidase M42	NA	NA	NA	NA	NA
WP_151622374.1|628169_629030_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_151625634.1|629238_629937_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_151625635.1|630101_631415_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_151622375.1|631464_631728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151622376.1|631711_632536_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_151622377.1|632513_633506_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_151622378.1|633633_637116_-	DNA polymerase III subunit alpha	NA	A0A0K1Y8F0	Streptomyces_phage	39.4	1.4e-221
WP_151622379.1|637183_638803_-	Na/Pi symporter	NA	NA	NA	NA	NA
WP_151622380.1|638978_640211_-	GTPase HflX	NA	NA	NA	NA	NA
WP_151622381.1|640462_641032_+	energy-coupled thiamine transporter ThiT	NA	NA	NA	NA	NA
WP_151622382.1|641096_642500_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	24.6	5.2e-29
WP_151622383.1|642517_642751_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_151622384.1|642768_643932_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_151622385.1|644023_645121_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_151622386.1|645249_646194_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_151622387.1|646197_647346_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_151622388.1|647345_648884_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	4.1e-11
WP_151622389.1|649021_650200_-	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_151625637.1|650294_650750_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_151622390.1|650763_652161_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_167511264.1|652209_652350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151622391.1|652371_653772_-	DUF342 domain-containing protein	NA	NA	NA	NA	NA
WP_151622392.1|653950_654628_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_151622393.1|654847_657496_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	41.8	5.4e-168
WP_151622394.1|658128_660345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151622395.1|660357_662862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151622396.1|662886_663579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151622397.1|663568_664366_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_151622398.1|664367_665249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151622399.1|665387_666353_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_151622400.1|666352_667237_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_151622401.1|667306_668728_-	exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase	NA	NA	NA	NA	NA
WP_151625639.1|668740_669910_-	UDPGP type 1 family protein	NA	NA	NA	NA	NA
WP_151622402.1|670150_670801_-	NeuD/PglB/VioB family sugar acetyltransferase	NA	NA	NA	NA	NA
WP_151622403.1|670802_671909_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2P1ELT3	Moumouvirus	27.9	1.8e-24
WP_167511265.1|671918_673592_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.2	2.5e-09
WP_151622405.1|673709_674675_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_151622406.1|674667_677556_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.0	1.5e-09
WP_167511266.1|677564_678512_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.9	1.6e-13
WP_151622408.1|678518_679265_-	glycosyl transferase	NA	A0A1V0SBR5	Catovirus	34.6	3.2e-09
WP_167511267.1|679313_680252_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_151622410.1|680292_681342_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	39.1	8.2e-11
WP_151622411.1|681345_683460_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	35.4	8.7e-12
WP_151622412.1|683465_684596_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_151622413.1|684627_685572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151622414.1|685590_686301_-	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	32.4	1.3e-15
WP_151622415.1|686309_687023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151622416.1|687240_688326_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	46.0	8.0e-78
WP_151622417.1|691318_693061_+	hypothetical protein	NA	NA	NA	NA	NA
693505:693527	attL	TTTATCCGAAGGAATTACTTATC	NA	NA	NA	NA
WP_151622418.1|693641_695621_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_151622419.1|695607_696591_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_151622420.1|696587_697622_+|integrase	tyrosine-type recombinase/integrase	integrase	U5Q1D8	Bacillus_phage	27.1	4.0e-10
WP_167511268.1|697628_698036_-|transposase	transposase	transposase	NA	NA	NA	NA
697688:697710	attR	GATAAGTAATTCCTTCGGATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP043028	Pseudobutyrivibrio xylanivorans strain MA3014 chromosome 1, complete sequence	3412851	1073569	1143694	3412851	integrase,transposase,protease	uncultured_Caudovirales_phage(18.18%)	58	1083400:1083416	1124685:1124701
WP_151622744.1|1073569_1074814_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	49.7	4.7e-50
WP_151622745.1|1074932_1075382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167511289.1|1075731_1075896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167511290.1|1075906_1076722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151622747.1|1077111_1077588_+	helix-turn-helix domain-containing protein	NA	A0A1B2LRS2	Wolbachia_phage	35.7	5.0e-08
WP_151622748.1|1078042_1078663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151622749.1|1078911_1080090_+	hypothetical protein	NA	A0A2H4JEI4	uncultured_Caudovirales_phage	41.4	3.5e-10
WP_151622750.1|1080758_1082114_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1083400:1083416	attL	TGAGCGAAGAAGTATTT	NA	NA	NA	NA
WP_151622751.1|1088958_1089261_+	Dabb family protein	NA	NA	NA	NA	NA
WP_151622752.1|1089326_1090154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167511291.1|1090311_1090737_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_151622754.1|1090746_1092096_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_167511292.1|1092263_1093595_+	MFS transporter	NA	NA	NA	NA	NA
WP_151622756.1|1093604_1094756_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151622757.1|1094885_1095848_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_167511293.1|1095855_1096326_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151622759.1|1096325_1096751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151622760.1|1097241_1098531_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_151622761.1|1098621_1099509_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151622762.1|1099658_1100180_+	flavodoxin	NA	NA	NA	NA	NA
WP_151622763.1|1100204_1101044_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.0	7.9e-33
WP_151622764.1|1101226_1101748_+	DUF4256 family protein	NA	NA	NA	NA	NA
WP_151622765.1|1101965_1102736_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_151622766.1|1102847_1103288_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_167511294.1|1103784_1104936_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151622768.1|1104932_1105715_+	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	38.0	1.1e-36
WP_151622769.1|1105735_1106752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013282512.1|1106817_1107255_+	radical SAM mobile pair system MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151622770.1|1107251_1107950_+	radical SAM mobile pair protein A	NA	NA	NA	NA	NA
WP_151622771.1|1107925_1108849_+	radical SAM mobile pair protein B	NA	NA	NA	NA	NA
WP_151622772.1|1109741_1111076_+	MFS transporter	NA	NA	NA	NA	NA
WP_151622773.1|1111002_1112109_+	helix-turn-helix domain-containing protein	NA	A0A2I6QQS2	Streptococcus_phage	36.2	4.1e-05
WP_151622774.1|1112200_1113229_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2R2ZHE2	Clostridioides_phage	28.0	4.5e-14
WP_151622775.1|1113233_1114076_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_151622776.1|1114255_1114990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151622777.1|1115217_1116453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151622778.1|1116820_1117432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151622779.1|1117581_1118505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151622780.1|1118491_1120330_-	beta-hexosaminidase	NA	NA	NA	NA	NA
WP_151622781.1|1120515_1122747_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_151622782.1|1122889_1124464_-|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	28.2	6.4e-44
WP_151622783.1|1124683_1125292_+	DUF3793 family protein	NA	NA	NA	NA	NA
1124685:1124701	attR	TGAGCGAAGAAGTATTT	NA	NA	NA	NA
WP_151622784.1|1125327_1125759_+	flavodoxin	NA	NA	NA	NA	NA
WP_151622785.1|1126008_1127133_+	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_151622786.1|1127137_1127881_+	nickel pincer cofactor biosynthesis protein LarB	NA	A0A288TYA6	Enterococcus_phage	43.4	4.0e-20
WP_151622787.1|1127899_1129087_+	nickel pincer cofactor biosynthesis protein LarC	NA	NA	NA	NA	NA
WP_151622782.1|1129196_1130771_+|transposase	IS1182 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	28.2	6.4e-44
WP_151622788.1|1130905_1131400_-	transporter	NA	NA	NA	NA	NA
WP_151622789.1|1131475_1132120_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_151622790.1|1132072_1132636_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_151622791.1|1132638_1133637_-	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_151622792.1|1133790_1134198_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_151622793.1|1134218_1135892_-	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_151622794.1|1136821_1137643_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_151622795.1|1137645_1138344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151622796.1|1139201_1140632_+	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_151622797.1|1140929_1142951_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.3	5.1e-09
WP_151622798.1|1142962_1143694_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP043028	Pseudobutyrivibrio xylanivorans strain MA3014 chromosome 1, complete sequence	3412851	1235858	1241941	3412851	transposase	Staphylococcus_phage(50.0%)	7	NA	NA
WP_151622874.1|1235858_1236323_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	55.0	2.2e-40
WP_151622875.1|1236340_1237537_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.0	3.0e-102
WP_151622876.1|1237665_1237965_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151622877.1|1237973_1238867_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	35.8	2.7e-39
WP_151622878.1|1238863_1239466_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.8	6.5e-37
WP_151622879.1|1239465_1240563_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	38.0	1.9e-50
WP_151622880.1|1240999_1241941_+	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.6	1.5e-16
>prophage 4
NZ_CP043028	Pseudobutyrivibrio xylanivorans strain MA3014 chromosome 1, complete sequence	3412851	1930269	1939305	3412851	protease,tRNA	Ostreococcus_tauri_virus(16.67%)	8	NA	NA
WP_151625737.1|1930269_1932114_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	H8ZJI5	Ostreococcus_tauri_virus	42.7	5.5e-111
WP_151623404.1|1932162_1932687_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.9	3.7e-12
WP_151623405.1|1932679_1934329_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SD04	Indivirus	21.9	1.9e-06
WP_090155384.1|1934338_1934578_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_028234604.1|1934743_1935016_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	60.7	2.9e-21
WP_167511339.1|1935277_1936468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151623407.1|1936538_1937870_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	44.8	4.1e-100
WP_151623408.1|1937865_1939305_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L0T2	Tupanvirus	44.5	4.7e-110
>prophage 5
NZ_CP043028	Pseudobutyrivibrio xylanivorans strain MA3014 chromosome 1, complete sequence	3412851	2042883	2111072	3412851	transposase,tRNA	Bacillus_phage(50.0%)	54	NA	NA
WP_151623489.1|2042883_2043456_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_028235339.1|2043464_2043725_-	septation regulator SpoVG	NA	NA	NA	NA	NA
WP_151623490.1|2043729_2044863_-	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_151623491.1|2044859_2046143_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_151623492.1|2046440_2047820_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_151623493.1|2048034_2049171_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_151623494.1|2049188_2050181_+	ATP-binding protein	NA	A0A1X9I6C4	Streptococcus_phage	27.7	2.7e-08
WP_151623495.1|2050202_2051381_+	ribose-phosphate diphosphokinase	NA	A0A1L7N134	Ralstonia_phage	26.9	1.0e-09
WP_151623496.1|2051592_2052795_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	44.4	7.7e-90
WP_151622274.1|2053021_2054515_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_151623497.1|2055063_2057244_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_151623498.1|2057369_2059922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151623499.1|2059905_2060394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151623500.1|2060583_2062536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151623501.1|2062577_2063756_-	class B sortase	NA	NA	NA	NA	NA
WP_151623502.1|2063876_2074721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151623503.1|2075036_2076239_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	43.0	2.0e-82
WP_151623504.1|2076528_2077140_-	cell filamentation protein fic	NA	NA	NA	NA	NA
WP_167511349.1|2077144_2077309_-	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_151623505.1|2077532_2079443_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.0	1.2e-52
WP_151623506.1|2079435_2081208_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	28.4	3.1e-34
WP_151623507.1|2081211_2081694_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151623508.1|2081981_2082554_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151623509.1|2082753_2083692_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_151623510.1|2083713_2085933_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_151623511.1|2086144_2087203_+	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_151623512.1|2087384_2088323_-	transketolase family protein	NA	NA	NA	NA	NA
WP_151623513.1|2088322_2089150_-	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	31.2	5.8e-12
WP_151623514.1|2089208_2090633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167511350.1|2090926_2091928_+	zinc dependent phospholipase C family protein	NA	NA	NA	NA	NA
WP_151623516.1|2092395_2092557_+	rubredoxin	NA	NA	NA	NA	NA
WP_151623517.1|2092582_2092933_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	M1PLC0	Streptococcus_phage	41.9	4.3e-17
WP_151623518.1|2093135_2093807_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_151623519.1|2093845_2094541_+	flavin reductase	NA	NA	NA	NA	NA
WP_151623520.1|2094543_2094846_+	Dabb family protein	NA	NA	NA	NA	NA
WP_151623521.1|2094863_2095421_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_151623522.1|2095451_2096234_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_151623523.1|2096248_2096476_+	purine biosynthesis protein PurH	NA	NA	NA	NA	NA
WP_151623524.1|2096546_2097332_+	methyltransferase domain-containing protein	NA	A0A1X9I6N4	Streptococcus_phage	33.3	1.3e-05
WP_151623525.1|2097518_2098064_+|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_151623526.1|2098105_2098684_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.0	3.8e-18
WP_151621986.1|2098716_2099406_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151623527.1|2099641_2100733_+	radical SAM protein	NA	NA	NA	NA	NA
WP_151623528.1|2100751_2101222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151623529.1|2101773_2102043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151623530.1|2102426_2102936_+	hypothetical protein	NA	R9TGI0	Vibrio_phage	29.8	1.2e-07
WP_151623531.1|2102962_2103496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167511351.1|2103515_2103908_+	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_151623533.1|2104571_2105675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167511352.1|2105687_2105855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151623535.1|2105881_2106265_+	glyoxalase	NA	NA	NA	NA	NA
WP_151623537.1|2106307_2107030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151623539.1|2107805_2109299_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_151623541.1|2110178_2111072_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.2	9.3e-40
