The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042534	Citrobacter freundii strain E51 chromosome, complete genome	5070767	802261	872271	5070767	tRNA,protease,integrase,plate	Cronobacter_phage(14.29%)	52	815420:815438	869692:869710
WP_044713759.1|802261_802687_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_044713761.1|802689_804525_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_044713831.1|804491_805538_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_044713832.1|805554_806853_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_044713763.1|806849_807383_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_044713765.1|807385_808729_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_044713767.1|808733_809543_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_071698371.1|809551_812287_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.7	8.2e-87
WP_167736229.1|812283_813030_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_044713772.1|813034_814456_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_136345917.1|814479_818004_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
815420:815438	attL	AGCTGAAAGCCTTCTGGCA	NA	NA	NA	NA
WP_136345916.1|818014_819382_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_044713777.1|819384_819864_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_044713779.1|820064_820922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_136345915.1|822559_822883_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_130715145.1|823317_823689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136345914.1|824526_825075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167736230.1|825075_829182_-	RHS domain-containing protein	NA	S5W9C6	Leptospira_phage	32.8	1.9e-07
WP_136345913.1|829249_831361_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	6.2e-26
WP_136345912.1|832957_833230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130715124.1|833544_835041_+	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_130715148.1|835139_835796_+	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_136345911.1|835792_839080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136345910.1|839081_840230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130715127.1|840328_842401_+	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_136345909.1|842478_846672_+	hypothetical protein	NA	A0A2H4PQT3	Staphylococcus_phage	29.5	3.8e-75
WP_088903068.1|846960_847422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048213204.1|849624_850182_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	53.5	1.8e-20
WP_088903070.1|850389_851649_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	44.6	1.3e-82
WP_003846348.1|851992_852700_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_003838203.1|853168_855304_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_003027130.1|855356_856613_-	nucleoside permease	NA	NA	NA	NA	NA
WP_167736231.1|856824_857910_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
WP_003027126.1|857996_858266_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_003846351.1|858293_859346_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003027117.1|859506_860226_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_003027115.1|860225_860552_+	YggL family protein	NA	NA	NA	NA	NA
WP_003838208.1|860601_861321_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_044713806.1|861509_862556_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_003838210.1|862672_863680_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_088903071.1|863742_864879_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_003027104.1|864871_865465_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_003027101.1|865472_865763_-	YggU family protein	NA	NA	NA	NA	NA
WP_003825417.1|865759_866326_-	YggT family protein	NA	NA	NA	NA	NA
WP_003838215.1|866344_867049_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_088903072.1|867066_868047_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_006686843.1|868043_868460_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_123924839.1|868459_869095_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_003027083.1|869198_870146_-	glutathione synthase	NA	NA	NA	NA	NA
869692:869710	attR	TGCCAGAAGGCTTTCAGCT	NA	NA	NA	NA
WP_003027080.1|870165_870897_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016150969.1|870971_871679_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_003838223.1|871773_872271_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP042534	Citrobacter freundii strain E51 chromosome, complete genome	5070767	923085	964010	5070767	tRNA,integrase,transposase	uncultured_Caudovirales_phage(30.77%)	39	947045:947059	954979:954993
WP_003026944.1|923085_924066_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
WP_003026938.1|924322_924589_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_003026936.1|924569_924977_+	protein YgfX	NA	NA	NA	NA	NA
WP_003026933.1|925021_925543_-	flavodoxin FldB	NA	NA	NA	NA	NA
WP_088903084.1|925656_926553_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	27.6	4.3e-29
WP_003825520.1|926576_927290_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_048232743.1|927295_929029_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.5e-62
WP_096878465.1|929120_930218_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_003026911.1|930228_931746_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.9	1.3e-86
WP_136345903.1|931823_932378_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_016150941.1|932544_933303_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A7K9	Microcystis_virus	37.3	3.2e-09
WP_000778549.1|933620_934814_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.0	5.4e-136
WP_000460992.1|935020_936169_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_000022894.1|936165_937941_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001135895.1|938133_938487_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	8.2e-24
WP_000855179.1|938534_938897_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_016538087.1|938914_940666_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_016538086.1|940712_942002_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_000065761.1|942014_942440_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	3.3e-51
WP_001057013.1|942470_944228_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_000034287.1|944248_944611_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_001286343.1|944686_945232_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000145398.1|945240_945954_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.6	5.6e-96
WP_000423544.1|945955_946279_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000665320.1|946464_947040_-	hypothetical protein	NA	NA	NA	NA	NA
947045:947059	attL	GATTATCCCTGGATA	NA	NA	NA	NA
WP_000985661.1|947142_947349_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000347296.1|947452_948034_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000003883.1|948412_949210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000219087.1|950102_951341_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001515348.1|951816_952389_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_000167917.1|952588_953512_+	cation transporter	NA	NA	NA	NA	NA
WP_001324664.1|953684_954287_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	1.1e-07
WP_001324663.1|954378_954570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019441.1|954704_955685_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	2.3e-185
954979:954993	attR	GATTATCCCTGGATA	NA	NA	NA	NA
WP_001324800.1|955934_957065_+	DUF4297 domain-containing protein	NA	NA	NA	NA	NA
WP_087451024.1|957433_958553_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_004958618.1|960284_961577_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_172740623.1|961575_962469_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219087.1|962771_964010_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP042534	Citrobacter freundii strain E51 chromosome, complete genome	5070767	1828982	1837401	5070767	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_136345870.1|1828982_1829930_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.3	1.7e-07
WP_003844383.1|1829913_1830645_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|1830625_1830733_-	protein YohO	NA	NA	NA	NA	NA
WP_049002964.1|1830784_1831516_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.8e-105
WP_003027348.1|1831741_1833427_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_003840155.1|1833423_1834143_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003027346.1|1834189_1834660_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
WP_071697500.1|1834702_1835161_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	69.3	1.0e-50
WP_003027344.1|1835367_1837401_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
>prophage 4
NZ_CP042534	Citrobacter freundii strain E51 chromosome, complete genome	5070767	1876769	1886347	5070767	tRNA,protease	Bacillus_phage(28.57%)	8	NA	NA
WP_167736259.1|1876769_1878716_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	7.0e-40
WP_003036813.1|1878790_1879015_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|1879338_1879659_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036804.1|1879689_1881966_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_003844346.1|1882235_1883597_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.9	4.1e-204
WP_003841759.1|1883756_1884089_-	YegP family protein	NA	NA	NA	NA	NA
WP_003036797.1|1884224_1884947_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_003844344.1|1884943_1886347_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.2	5.0e-32
>prophage 5
NZ_CP042534	Citrobacter freundii strain E51 chromosome, complete genome	5070767	2009569	2017576	5070767	integrase	Salmonella_phage(28.57%)	9	2007675:2007688	2021479:2021492
2007675:2007688	attL	GCAGAACGACAATC	NA	NA	NA	NA
WP_044711147.1|2009569_2010553_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	82.3	2.7e-165
WP_044711145.1|2010557_2010779_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	70.3	3.0e-24
WP_044711143.1|2010955_2011780_-	DUF2303 family protein	NA	U5P439	Shigella_phage	97.4	8.0e-147
WP_072211986.1|2011845_2012226_-	hypothetical protein	NA	U5P4J6	Shigella_phage	97.6	5.3e-61
WP_044711136.1|2012643_2013348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044711135.1|2013393_2014065_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	54.5	3.1e-72
WP_003839058.1|2014828_2015161_+	EmrE family multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_044711132.1|2015263_2016442_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	55.7	9.9e-106
WP_003839062.1|2016883_2017576_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.1	8.0e-07
2021479:2021492	attR	GATTGTCGTTCTGC	NA	NA	NA	NA
>prophage 6
NZ_CP042534	Citrobacter freundii strain E51 chromosome, complete genome	5070767	2055623	2094758	5070767	integrase,portal,tail,capsid,protease,terminase,head	Salmonella_phage(25.0%)	55	2055442:2055501	2097426:2097549
2055442:2055501	attL	GATTTAAAATCCCTCGGCGTTCGCGCTGTGTGGGTTCAAGTCCCACTCCGGGTACCATGG	NA	NA	NA	NA
WP_071692372.1|2055623_2056634_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	86.9	1.0e-172
WP_065944714.1|2056633_2056861_-	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	88.0	4.6e-36
WP_172740629.1|2056894_2057173_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	57.3	6.2e-19
WP_003834015.1|2057175_2057565_-	hypothetical protein	NA	S4TTI6	Salmonella_phage	79.7	5.3e-56
WP_167736265.1|2057561_2058254_-	hypothetical protein	NA	A0A1C9IHU7	Salmonella_phage	56.8	2.2e-28
WP_167736266.1|2058243_2058480_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	81.7	1.9e-24
WP_167736394.1|2058485_2058842_-	hypothetical protein	NA	A0A0K2FJF6	Enterobacteria_phage	68.8	5.9e-38
WP_167736267.1|2059192_2059759_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_167736268.1|2060323_2061364_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	86.9	7.2e-161
WP_167736269.1|2061363_2061777_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	72.1	3.1e-46
WP_151564552.1|2062527_2062743_-	hypothetical protein	NA	A0A193GYF6	Enterobacter_phage	46.5	2.3e-13
WP_160180129.1|2062987_2063635_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	62.5	9.3e-74
WP_032207801.1|2063739_2063937_+	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	66.7	1.9e-17
WP_160180131.1|2063962_2064427_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	90.1	5.8e-70
WP_160180134.1|2064667_2064853_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.4	1.3e-12
WP_065944720.1|2064836_2065781_+	conserved phage C-terminal domain-containing protein	NA	K7PLZ7	Enterobacterial_phage	81.2	6.4e-148
WP_160180136.1|2065783_2066227_+	hypothetical protein	NA	U5P0U0	Shigella_phage	30.7	8.2e-13
WP_160180138.1|2066226_2066895_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	80.1	4.0e-96
WP_003833987.1|2066881_2067100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160180140.1|2067101_2067419_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	56.7	2.4e-27
WP_069891578.1|2067418_2067808_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	66.7	3.5e-44
WP_003833980.1|2067824_2068550_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	53.1	9.8e-56
WP_160180142.1|2068546_2069536_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	71.4	3.8e-143
WP_160180144.1|2069550_2070129_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	55.6	9.3e-49
WP_096878852.1|2070207_2070687_-	hypothetical protein	NA	F1C594	Cronobacter_phage	56.7	4.2e-39
WP_016150433.1|2070935_2071214_+	hypothetical protein	NA	K7PGZ9	Enterobacteria_phage	95.7	4.3e-44
WP_160180146.1|2071185_2071734_+	glycoside hydrolase family protein	NA	K7PM52	Enterobacteria_phage	91.8	1.5e-96
WP_160180788.1|2071730_2072246_+	DUF2514 family protein	NA	A0A291LBG9	Klebsiella_phage	49.4	1.2e-07
WP_160180149.1|2072372_2073242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160180151.1|2073417_2073768_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	79.3	1.0e-50
WP_136346206.1|2073925_2074423_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.6	3.3e-63
WP_136346205.1|2074426_2076178_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	71.6	9.7e-259
WP_136346204.1|2076188_2076374_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	59.3	9.9e-13
WP_136346203.1|2076373_2077603_+|portal	phage portal protein	portal	U5P411	Shigella_phage	82.7	1.3e-204
WP_016150486.1|2077589_2078243_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	85.5	2.3e-104
WP_016150485.1|2078256_2079465_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	82.9	6.2e-188
WP_048221283.1|2079790_2080114_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.0	8.6e-20
WP_142972778.1|2080123_2080462_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.9	7.3e-38
WP_086539186.1|2080458_2080908_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	85.9	5.0e-66
WP_048221286.1|2080904_2081252_+	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	75.7	8.3e-45
WP_167736270.1|2081309_2082014_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	73.1	1.8e-91
WP_016150478.1|2082041_2082431_+	hypothetical protein	NA	K7PKV6	Enterobacterial_phage	84.5	1.6e-57
WP_167736271.1|2082439_2082718_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	92.4	4.4e-41
WP_167736272.1|2082774_2083110_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	78.4	5.2e-44
WP_167736273.1|2083156_2086468_+|tail	phage tail tape measure protein	tail	S4TTF9	Salmonella_phage	80.6	0.0e+00
WP_079934714.1|2086510_2086771_+	DUF1327 domain-containing protein	NA	Q5G8W5	Enterobacteria_phage	60.5	5.5e-17
WP_079934715.1|2086775_2087063_-	hypothetical protein	NA	I6S632	Salmonella_phage	85.3	3.6e-38
WP_167736274.1|2087225_2087819_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	95.9	1.2e-107
WP_038642083.1|2087818_2088403_+	hypothetical protein	NA	S4TND4	Salmonella_phage	96.4	6.0e-104
WP_167736275.1|2088409_2088808_+	hypothetical protein	NA	S4TR39	Salmonella_phage	93.2	7.2e-69
WP_167736276.1|2088807_2091531_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	94.7	0.0e+00
WP_167736277.1|2091533_2092478_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	65.5	1.2e-117
WP_167736278.1|2092487_2093909_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	50.1	4.7e-110
WP_000497432.1|2094047_2094290_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	3.4e-29
WP_130714570.1|2094368_2094758_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	72.9	3.9e-51
2097426:2097549	attR	GATTTAAAATCCCTCGGCGTTCGCGCTGTGTGGGTTCAAGTCCCACTCCGGGTACCATGGGAAAGAACAGAATAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTACGGGTGGTTTTTTTGT	NA	NA	NA	NA
>prophage 7
NZ_CP042534	Citrobacter freundii strain E51 chromosome, complete genome	5070767	2728157	2734507	5070767	integrase,transposase	Staphylococcus_phage(16.67%)	7	2718065:2718123	2732569:2732627
2718065:2718123	attL	ATAAAAAACACGCTGCAAAATCAACAAAATATAATCAACTTGCTTAATTACTCTGCAAT	NA	NA	NA	NA
WP_075335826.1|2728157_2729318_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	6.0e-39
WP_088902365.1|2729406_2730180_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.6	8.0e-40
WP_088902366.1|2730341_2731349_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	36.0	4.2e-57
WP_088902367.1|2731332_2731911_-	S-adenosylmethionine-binding protein	NA	A0A193GYV6	Enterobacter_phage	71.7	2.9e-79
WP_088902368.1|2732250_2732568_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U2JGI6	Escherichia_phage	57.0	2.7e-26
WP_088902369.1|2733045_2733768_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
2732569:2732627	attR	ATAAAAAACACGCTGCAAAATCAACAAAATATAATCAACTTGCTTAATTACTCTGCAAT	NA	NA	NA	NA
WP_003836510.1|2733754_2734507_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	6.7e-07
>prophage 8
NZ_CP042534	Citrobacter freundii strain E51 chromosome, complete genome	5070767	2818286	2828324	5070767	tRNA	Cedratvirus(14.29%)	10	NA	NA
WP_003836641.1|2818286_2819066_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	7.9e-11
WP_048216528.1|2819062_2820505_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
WP_003836643.1|2820566_2821280_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003836644.1|2821596_2822061_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_003030567.1|2822138_2822888_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_003030569.1|2822887_2823439_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003832584.1|2823499_2824480_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_003030571.1|2824633_2824933_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_003030574.1|2824937_2827325_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003832580.1|2827340_2828324_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
>prophage 9
NZ_CP042534	Citrobacter freundii strain E51 chromosome, complete genome	5070767	2836839	2878612	5070767	lysis,integrase,holin,capsid	Cronobacter_phage(29.63%)	66	2831903:2831925	2878793:2878815
2831903:2831925	attL	ACACGTAAGATCACATACAAAGA	NA	NA	NA	NA
WP_167736307.1|2836839_2839317_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	87.5	0.0e+00
WP_167736308.1|2839303_2839696_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	87.9	4.0e-64
WP_167736309.1|2839705_2840176_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	91.7	2.6e-78
WP_167736310.1|2840175_2840673_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.3	5.1e-88
WP_167736396.1|2840672_2843000_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	51.7	7.3e-145
WP_049003437.1|2843783_2844455_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	50.2	7.7e-55
WP_049003435.1|2844512_2845256_-	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	86.7	5.9e-72
WP_032608745.1|2845318_2845702_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	2.3e-40
WP_049003432.1|2845698_2846163_-	hypothetical protein	NA	A0A2P1MXA4	Escherichia_phage	45.5	3.1e-31
WP_049003430.1|2846165_2846522_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	58.1	4.2e-28
WP_049003424.1|2846673_2846844_-	hypothetical protein	NA	A0A1V0E5P1	Salmonella_phage	50.0	1.7e-11
WP_049003423.1|2846843_2847224_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	53.7	4.5e-28
WP_152960162.1|2847226_2847454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049003420.1|2847465_2848548_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	69.9	7.6e-145
WP_049003418.1|2848559_2848991_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	68.5	3.8e-47
WP_049003417.1|2848994_2850383_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.4	5.3e-151
WP_049003415.1|2850454_2850967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065241400.1|2851007_2852012_-|capsid	minor capsid protein	capsid	F1C5D8	Cronobacter_phage	67.7	9.3e-113
WP_152692361.1|2851944_2853414_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	60.2	2.9e-155
WP_049003411.1|2853424_2854987_-	hypothetical protein	NA	G8C7P3	Escherichia_phage	93.1	1.4e-304
WP_049003408.1|2854983_2855634_-	phage protein	NA	G8C7P2	Escherichia_phage	80.1	3.8e-91
WP_049003406.1|2855637_2855856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049003405.1|2856024_2856303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049003464.1|2856303_2856762_-|lysis	lysis protein	lysis	A0A2H4FNE5	Salmonella_phage	76.6	4.9e-53
WP_167736311.1|2856770_2857220_-	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	84.6	4.0e-68
WP_122008274.1|2857206_2857512_-|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	86.1	1.1e-43
WP_049003324.1|2857670_2857859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049003320.1|2858306_2858996_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	1.3e-52
WP_049003316.1|2858992_2859133_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	74.2	3.0e-06
WP_049003315.1|2859129_2859741_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	50.2	2.4e-39
WP_049003313.1|2859733_2860402_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	96.4	1.3e-126
WP_049003311.1|2860398_2860569_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	60.7	3.8e-11
WP_049003308.1|2860561_2861011_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	51.4	2.4e-36
WP_049003307.1|2861210_2861465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049003305.1|2861464_2861722_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	80.3	8.0e-29
WP_049003302.1|2862141_2862354_-	hypothetical protein	NA	K7PKY3	Enterobacterial_phage	91.4	5.8e-33
WP_049003300.1|2862350_2862623_-	hypothetical protein	NA	A0A220IH78	Escherichia_phage	69.7	2.6e-25
WP_167736312.1|2862619_2863162_-	DUF551 domain-containing protein	NA	A0A193GYX5	Enterobacter_phage	45.6	4.7e-10
WP_167736313.1|2863158_2863806_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	82.6	4.3e-111
WP_167736314.1|2864353_2864653_-	protein ren	NA	M1FPD5	Enterobacteria_phage	52.6	4.8e-17
WP_167736315.1|2864654_2865344_-	phage replication protein	NA	G8C7U6	Escherichia_phage	93.0	4.7e-124
WP_167736316.1|2865340_2866282_-	replication protein	NA	A5VW95	Enterobacteria_phage	80.2	2.4e-54
WP_167736317.1|2866467_2867010_-	regulator	NA	M9NZI6	Enterobacteria_phage	93.9	3.8e-89
WP_032936025.1|2867040_2867268_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	98.7	9.2e-37
WP_032936028.1|2867378_2868083_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	64.6	5.2e-86
WP_167736318.1|2868097_2868787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167736319.1|2869648_2869846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172740632.1|2869901_2870543_+	hypothetical protein	NA	A5PJ37	Escherichia_virus	38.2	5.7e-23
WP_160180348.1|2870578_2870959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167736321.1|2871110_2871320_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	89.9	7.0e-31
WP_167736322.1|2871390_2872362_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	59.8	1.3e-42
WP_160180351.1|2872369_2872654_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	90.4	4.7e-46
WP_160180352.1|2872671_2873418_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	65.8	1.8e-65
WP_160180354.1|2873414_2874032_+	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	57.8	1.2e-59
WP_160180356.1|2874028_2874457_+	regulator	NA	M9NYX4	Enterobacteria_phage	95.1	1.7e-71
WP_160180358.1|2874453_2874606_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	3.6e-05
WP_167736323.1|2874602_2875154_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.4	2.0e-53
WP_163199154.1|2875150_2875369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163199152.1|2875466_2875685_+	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_163199150.1|2875681_2875903_+	TraR/DksA C4-type zinc finger protein	NA	A0A0N7C211	Escherichia_phage	54.5	6.3e-14
WP_163199148.1|2875902_2876316_+	DUF2591 family protein	NA	G0ZNC2	Cronobacter_phage	53.2	3.6e-23
WP_163199146.1|2876278_2876518_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	45.5	1.3e-09
WP_163199144.1|2876527_2876719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163199143.1|2876728_2877103_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	61.4	1.4e-34
WP_032936075.1|2877209_2877446_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	53.7	3.3e-13
WP_167736324.1|2877403_2878612_-|integrase	tyrosine-type recombinase/integrase	integrase	I6R9B6	Salmonella_phage	76.9	1.1e-181
2878793:2878815	attR	ACACGTAAGATCACATACAAAGA	NA	NA	NA	NA
>prophage 10
NZ_CP042534	Citrobacter freundii strain E51 chromosome, complete genome	5070767	2969671	2975441	5070767		uncultured_Caudovirales_phage(57.14%)	8	NA	NA
WP_088902418.1|2969671_2970166_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	32.4	3.4e-07
WP_003030760.1|2971047_2971473_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
WP_016150088.1|2971485_2972775_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	3.2e-166
WP_003030762.1|2972819_2973140_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
WP_008320415.1|2973225_2973924_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	3.8e-89
WP_003840850.1|2974311_2974554_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_003030767.1|2974643_2975153_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_096878644.1|2975288_2975441_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.0	3.1e-20
>prophage 11
NZ_CP042534	Citrobacter freundii strain E51 chromosome, complete genome	5070767	3267175	3332763	5070767	integrase,portal,tail,tRNA,capsid,lysis,plate,terminase,transposase,head	Salmonella_phage(65.38%)	74	3297097:3297114	3331230:3331247
WP_088902490.1|3267175_3268468_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	2.8e-93
WP_003836910.1|3268560_3269904_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	4.3e-81
WP_003831898.1|3269914_3270526_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_136345709.1|3270637_3274699_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	2.9e-88
WP_002439523.1|3274833_3275328_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_003035727.1|3275875_3276844_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	1.9e-62
WP_088902491.1|3276958_3278725_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	26.2	1.4e-23
WP_003847023.1|3278725_3280447_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.6	8.1e-16
WP_032948928.1|3280491_3281196_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002211347.1|3281481_3281700_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_003847025.1|3281779_3282691_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003847027.1|3282799_3283660_+	pirin family protein	NA	NA	NA	NA	NA
WP_016149852.1|3283676_3284354_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_044701666.1|3285274_3286402_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.4	1.6e-28
WP_003035378.1|3286443_3286932_-	YbjO family protein	NA	NA	NA	NA	NA
WP_003035376.1|3286991_3287837_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_003035374.1|3287833_3288787_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_003035373.1|3288796_3289930_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	1.1e-29
WP_003035370.1|3290068_3291181_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_003035368.1|3291614_3292091_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_003836932.1|3292181_3293084_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.0	2.0e-37
WP_003836934.1|3293143_3293866_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_003845523.1|3293849_3294140_-	YbjC family protein	NA	NA	NA	NA	NA
WP_003035358.1|3294312_3294576_+	glutaredoxin, GrxA family	NA	A0A2I7SAE2	Vibrio_phage	67.9	3.8e-26
WP_003035356.1|3294610_3294991_-	membrane protein	NA	NA	NA	NA	NA
WP_003035354.1|3295260_3296946_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3297097:3297114	attL	TTTTTGTTGCCTGAAATT	NA	NA	NA	NA
WP_150344849.1|3297181_3297529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058842448.1|3297556_3297772_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	70.8	3.6e-22
WP_167736336.1|3297839_3298940_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	94.3	9.6e-188
WP_167736337.1|3298936_3299422_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	96.9	5.9e-65
WP_167736338.1|3299418_3302193_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.3	1.0e-116
WP_167736339.1|3302185_3302305_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
WP_032233623.1|3302319_3302622_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	94.9	1.5e-42
WP_024552851.1|3302676_3303192_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.2	5.1e-91
WP_048232591.1|3303201_3304374_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	94.6	3.2e-213
WP_080700401.1|3304613_3304865_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.5	2.4e-22
WP_048232592.1|3304857_3305139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001397640.1|3306832_3307438_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	98.0	4.6e-115
WP_167736340.1|3307430_3308339_-|plate	baseplate J/gp47 family protein	plate	E5G6N8	Salmonella_phage	92.7	5.2e-147
WP_048232594.1|3308325_3308685_-	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	95.8	3.0e-58
WP_167736341.1|3308681_3309260_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	95.3	1.6e-104
WP_016150805.1|3309328_3309775_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	88.4	4.2e-65
WP_167736342.1|3309767_3310199_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	94.4	5.8e-72
WP_167736343.1|3310294_3310723_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	94.3	1.3e-63
WP_000871620.1|3310719_3311094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167736344.1|3311098_3311608_-	glycoside hydrolase family protein	NA	A0A1S6KZY9	Salmonella_phage	96.4	1.7e-91
WP_000171565.1|3311588_3311804_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|3311807_3312011_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_057068446.1|3312010_3312475_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	97.4	4.2e-84
WP_000059173.1|3312568_3313219_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_048232602.1|3313222_3314287_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	2.3e-194
WP_048232604.1|3314303_3315137_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	94.6	1.6e-126
WP_167736345.1|3315279_3317046_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	94.4	0.0e+00
WP_167736346.1|3317045_3317771_+|terminase	terminase-like family protein	terminase	E5FFI8	Burkholderia_phage	33.3	3.8e-23
WP_167736347.1|3317767_3318808_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.1	1.8e-175
WP_016242316.1|3318858_3319197_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_016242317.1|3319196_3320177_-	hypothetical protein	NA	A4PE73	Ralstonia_virus	42.8	8.9e-52
WP_019077493.1|3320417_3320678_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	60.3	9.0e-20
WP_019077494.1|3320751_3320985_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	90.9	1.1e-32
WP_001154444.1|3320996_3321185_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_167736348.1|3321343_3323752_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	94.8	0.0e+00
WP_167736349.1|3323742_3324600_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	80.0	4.2e-130
WP_016150819.1|3324596_3324824_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	3.3e-34
WP_167736350.1|3324823_3325057_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	96.1	4.1e-32
WP_167736351.1|3325124_3325466_-	DUF5347 family protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
WP_167736352.1|3325429_3325630_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	95.5	3.9e-31
WP_087451024.1|3325729_3326849_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_167736353.1|3326859_3327372_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	98.2	3.2e-85
WP_012016743.1|3327404_3327626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167736354.1|3327721_3328318_+	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	42.5	3.6e-40
WP_167736355.1|3328338_3330015_+	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	66.0	1.3e-79
WP_130997529.1|3330097_3331150_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.9	3.0e-106
WP_172740633.1|3331176_3331386_-	hypothetical protein	NA	NA	NA	NA	NA
3331230:3331247	attR	TTTTTGTTGCCTGAAATT	NA	NA	NA	NA
WP_088902493.1|3331551_3332763_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	89.9	6.6e-190
>prophage 1
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	0	7694	306224		Salmonella_phage(100.0%)	9	NA	NA
WP_007372340.1|1202_1688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009651680.1|1775_2093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241545.1|2114_2513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372341.1|2831_3059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372342.1|3239_4163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372343.1|4198_4522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372345.1|4804_5023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372346.1|5283_5505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372347.1|6080_7694_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	37.0	2.2e-07
>prophage 2
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	13582	14908	306224	transposase	Enterobacteria_phage(50.0%)	2	NA	NA
WP_058654776.1|13582_14179_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.7	1.4e-39
WP_001067855.1|14203_14908_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 3
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	29705	30826	306224	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_085950818.1|29705_30826_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
>prophage 4
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	36239	40851	306224		Rhizobium_phage(33.33%)	4	NA	NA
WP_007372241.1|36239_37319_-	AAA family ATPase	NA	L7TKP0	Rhizobium_phage	36.4	3.2e-26
WP_007372240.1|37378_37756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372239.1|38127_39237_-	YqaJ viral recombinase family protein	NA	A8HP48	Thalassomonas_phage	30.1	7.6e-07
WP_007372238.1|39294_40851_-	recombinase RecT	NA	F1C5B8	Cronobacter_phage	36.4	6.2e-31
>prophage 5
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	65559	72143	306224		Pseudomonas_phage(33.33%)	7	NA	NA
WP_007372217.1|65559_67035_-	UvrD-helicase domain-containing protein	NA	A0A1S5R1M3	Pseudomonas_phage	32.6	6.0e-44
WP_007372216.1|67210_67498_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_007372215.1|67546_67882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099531010.1|68161_68716_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	32.7	2.5e-19
WP_007372214.1|68751_68961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372213.1|69502_70831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372212.1|71063_72143_-	restriction endonuclease	NA	A0A1P8CWV0	Bacillus_phage	23.8	9.0e-05
>prophage 6
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	81171	124297	306224	transposase	Escherichia_phage(66.67%)	44	NA	NA
WP_001254932.1|81171_82323_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_016241518.1|83381_83807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099531012.1|83820_84096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009652923.1|84382_84697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611902.1|84919_86266_+|transposase	ISNCY-like element ISLad2 family transposase	transposase	NA	NA	NA	NA
WP_000589340.1|86324_87128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000482601.1|87141_88503_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_016239970.1|88655_89096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239971.1|89113_89920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241520.1|90222_90453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372199.1|90885_91848_+	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	41.1	9.6e-59
WP_009652914.1|91861_92248_+	plasmid stability protein	NA	NA	NA	NA	NA
WP_007372197.1|92274_92679_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_024196074.1|92713_93043_+	acid-activated periplasmic chaperone HdeB	NA	NA	NA	NA	NA
WP_007372195.1|93094_93898_-	aquaporin	NA	M1HJ75	Acanthocystis_turfacea_Chlorella_virus	31.5	2.1e-14
WP_007372194.1|93951_95763_-	diol dehydratase reactivase subunit alpha	NA	NA	NA	NA	NA
WP_007372193.1|95773_96202_-	diol dehydratase small subunit	NA	NA	NA	NA	NA
WP_009652918.1|96204_96789_-	propanediol/glycerol family dehydratase medium subunit	NA	NA	NA	NA	NA
WP_016241522.1|96800_98468_-	propanediol/glycerol family dehydratase large subunit	NA	NA	NA	NA	NA
WP_007372190.1|98860_99289_+	heme-binding protein	NA	NA	NA	NA	NA
WP_007372189.1|99311_100475_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_007372188.1|100491_100845_+	glycerol dehydratase reactivase beta/small subunit family protein	NA	NA	NA	NA	NA
WP_007372187.1|100845_101376_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_009653098.1|101353_103279_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_007372185.1|103368_104466_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_007372184.1|104524_104749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372183.1|105026_105305_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_007372182.1|105494_106592_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_007372180.1|107148_108219_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_007372179.1|108229_108862_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_007372178.1|108872_110291_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_007372177.1|110365_112015_+	glycerone kinase	NA	NA	NA	NA	NA
WP_007372176.1|112118_112889_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_072146302.1|113095_113287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|113890_114871_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_057107713.1|116107_117433_-	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_064760475.1|117604_118324_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_149006749.1|118440_118773_+	PACE efflux transporter	NA	NA	NA	NA	NA
WP_001310555.1|118782_119799_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_001567358.1|120599_121304_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.0e-138
WP_001752509.1|121630_122131_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000019452.1|122447_123428_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	4.4e-184
WP_000780222.1|123705_123987_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|123967_124297_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
>prophage 7
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	132215	162503	306224	transposase	Salmonella_phage(28.57%)	27	NA	NA
WP_003100847.1|132215_132773_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_015062794.1|132851_133856_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_047748389.1|134269_134773_+	recombinase family protein	NA	NA	NA	NA	NA
WP_003049965.1|134885_137801_-|transposase	Tn3-like element IS1071 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.0	1.4e-52
WP_052206738.1|137896_138313_+	DUF1772 domain-containing protein	NA	NA	NA	NA	NA
WP_039262298.1|139025_140051_+	2-hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	26.0	4.4e-17
WP_166444224.1|140043_140949_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	37.8	7.5e-05
WP_001067855.1|140894_141599_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_172740641.1|143711_144065_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	2.4e-23
WP_172740642.1|144112_144475_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_172740643.1|144492_146244_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_172740644.1|146293_147583_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	3.0e-172
WP_172740645.1|147595_148021_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	4.0e-49
WP_172740646.1|148051_150184_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_172740647.1|150259_150805_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_172740648.1|150813_151386_-	helix-turn-helix domain-containing protein	NA	Q1MVP4	Enterobacteria_phage	87.9	9.7e-83
WP_172740649.1|151549_154558_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_032951326.1|155594_156179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072194352.1|156230_156551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032951323.1|156660_157143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032951321.1|157240_157669_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	75.7	5.8e-56
WP_007372169.1|157687_158173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009654998.1|158286_159165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372167.1|159176_160160_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	46.5	1.1e-73
WP_007372166.1|160146_160377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372165.1|160373_161195_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	48.9	3.4e-65
WP_071532006.1|161345_162503_-	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	23.5	1.2e-15
>prophage 8
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	172426	173497	306224		unidentified_phage(100.0%)	1	NA	NA
WP_007372151.1|172426_173497_-	phosphoadenosine phosphosulfate reductase family protein	NA	H7BVI4	unidentified_phage	28.4	6.5e-40
>prophage 9
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	177053	215453	306224	transposase	Morganella_phage(20.0%)	34	NA	NA
WP_008786797.1|177053_177455_-	hypothetical protein	NA	Q1MVE8	Enterobacteria_phage	69.9	3.5e-47
WP_007372145.1|178003_178495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000217395.1|178580_179072_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001333498.1|179242_179500_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	65.7	8.3e-18
WP_127649377.1|179788_180169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372144.1|180481_181372_-	DNA replication protein	NA	NA	NA	NA	NA
WP_009652912.1|181521_182787_-	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	60.6	9.8e-144
WP_008786793.1|182786_183203_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.7	1.0e-36
WP_007372141.1|183456_183960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000156884.1|184314_185337_-|transposase	IS110-like element IS5708 family transposase	transposase	NA	NA	NA	NA
WP_081120970.1|187929_188634_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.6e-138
WP_000612626.1|189795_190143_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_007372134.1|190139_190544_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_050998915.1|191670_191931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372130.1|192191_192371_-	hypothetical protein	NA	A0A1B2IAL0	Erwinia_phage	60.7	6.8e-11
WP_007372127.1|193490_193790_+	propanediol utilization microcompartment protein PduA	NA	NA	NA	NA	NA
WP_007372126.1|193789_194605_+	propanediol utilization microcompartment protein PduB	NA	NA	NA	NA	NA
WP_035942271.1|194629_197173_+	glycyl radical protein	NA	NA	NA	NA	NA
WP_035942514.1|197311_198232_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_007372122.1|198266_199094_+	aquaporin	NA	NA	NA	NA	NA
WP_007372121.1|199165_199456_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_007372120.1|199483_200350_+	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_007372119.1|200354_200990_+	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_050998913.1|201003_201483_+	microcompartment protein PduM	NA	NA	NA	NA	NA
WP_007372117.1|201487_201766_+	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_007372116.1|201798_202308_+	heme-binding protein	NA	NA	NA	NA	NA
WP_007372115.1|202304_203699_+	aldehyde dehydrogenase EutE	NA	NA	NA	NA	NA
WP_007372114.1|203714_204827_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_007372113.1|205186_206047_+	PocR ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_145954163.1|206375_207648_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
WP_001300563.1|209649_210762_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_007372383.1|210842_211046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567660.1|211368_212391_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_007372381.1|212414_215453_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.8	9.1e-297
>prophage 10
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	233557	234385	306224		Clostridium_phage(100.0%)	1	NA	NA
WP_000981293.1|233557_234385_+	ParA family protein	NA	J9QE36	Clostridium_phage	27.4	2.0e-12
>prophage 11
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	237866	241359	306224	integrase,transposase	Macacine_betaherpesvirus(50.0%)	4	237626:237638	243080:243092
237626:237638	attL	GATCCTTTTGCGA	NA	NA	NA	NA
WP_000174662.1|237866_238631_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	52.4	1.9e-25
WP_007372351.1|238650_239745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172732022.1|239878_240709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|240654_241359_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
243080:243092	attR	TCGCAAAAGGATC	NA	NA	NA	NA
>prophage 12
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	250043	258683	306224		Salmonella_phage(25.0%)	15	NA	NA
WP_007372267.1|250043_250637_+	hypothetical protein	NA	J9Q753	Salmonella_phage	34.5	1.4e-07
WP_007372268.1|250729_250996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372269.1|251104_251563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372270.1|251598_252075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372271.1|252149_252425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372272.1|252539_252812_+	hypothetical protein	NA	A0A192YCJ5	Morganella_phage	37.2	1.5e-09
WP_007372273.1|252870_253203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007372274.1|253284_253578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241562.1|253672_255745_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	24.4	1.7e-44
WP_016241561.1|255765_256086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024196082.1|256173_256596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024196081.1|256868_257264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241560.1|257445_257637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372278.1|257767_258463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032155220.1|258485_258683_+	restriction alleviation protein, Lar family	NA	A0A0U2QQP4	Escherichia_phage	48.4	2.6e-11
>prophage 13
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	263369	263987	306224		Escherichia_phage(100.0%)	1	NA	NA
WP_007372289.1|263369_263987_+	hypothetical protein	NA	A0A076G6Q2	Escherichia_phage	53.4	4.1e-63
>prophage 14
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	273183	274026	306224		Salmonella_phage(100.0%)	1	NA	NA
WP_007372307.1|273183_274026_+	HNH endonuclease	NA	G0X580	Salmonella_phage	39.5	1.8e-16
>prophage 15
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	277905	287345	306224		Escherichia_phage(50.0%)	11	NA	NA
WP_007372313.1|277905_278910_+	peptide transporter	NA	A0A1B0V750	Salmonella_phage	27.2	3.0e-18
WP_008786583.1|279033_279435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372314.1|279406_281107_+	AAA family ATPase	NA	A0A172JHZ0	Bacillus_phage	36.7	3.5e-96
WP_009653090.1|281244_281469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372316.1|281748_282066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372317.1|282067_282817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241554.1|282837_283524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372318.1|283682_284858_+	ParB/RepB/Spo0J family partition protein	NA	A0A088FQX6	Escherichia_phage	31.3	6.5e-17
WP_007372319.1|285031_285553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372320.1|285549_285918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008786580.1|285926_287345_+	replicative DNA helicase	NA	O80281	Escherichia_phage	73.6	4.3e-188
>prophage 16
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	292373	294213	306224		Burkholderia_virus(50.0%)	3	NA	NA
WP_007372328.1|292373_293198_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	61.1	1.9e-18
WP_008786574.1|293259_293919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007372330.1|293967_294213_+	hypothetical protein	NA	S4TRP7	Salmonella_phage	44.4	2.8e-07
>prophage 17
NZ_CP042535	Citrobacter freundii strain E51 plasmid pE51_001, complete sequence	306224	300457	304367	306224		Salmonella_phage(66.67%)	3	NA	NA
WP_016241550.1|300457_300883_+	hypothetical protein	NA	A0A0K1YBA5	Cronobacter_phage	42.8	1.6e-26
WP_007372337.1|301036_301756_+	HNH endonuclease	NA	G0X580	Salmonella_phage	39.5	2.2e-07
WP_007372338.1|303284_304367_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	56.5	1.1e-79
>prophage 1
NZ_CP042537	Citrobacter freundii strain E51 plasmid pE51_003, complete sequence	87731	2110	36530	87731	transposase,integrase,protease	Escherichia_phage(37.5%)	39	1913:1972	22534:23488
1913:1972	attL	GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATC	NA	NA	NA	NA
WP_001067834.1|2110_2815_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_014344500.1|2848_3121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|3089_4103_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015060105.1|4255_4996_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_015063357.1|5227_5560_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_003159191.1|5686_6241_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|6335_6968_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000679427.1|7124_7472_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|7465_8305_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|8709_10251_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003833285.1|11557_12010_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_012695489.1|12051_12696_-	quinolone resistance pentapeptide repeat protein QnrB2	NA	NA	NA	NA	NA
WP_000259031.1|13186_14026_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|13955_14135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883563.1|14153_14426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|14607_15612_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|15839_17045_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|17055_17361_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|17376_17559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|17587_18352_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|18542_18899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|18844_19429_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|19428_20667_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|20663_21569_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067834.1|21690_22395_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000557454.1|22627_23488_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
22534:23488	attR	GATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTATAGTGTTTTGCAGTTTAGAGGAGATATCGCGATGCATACGCGGAAGGCAATAACGGAGGCGCTTCAAAAACTCGGAGTCCAAACCGGTGACCTCTTGATGGTGCATGCCTCACTTAAAGCGATTGGTCCGGTCGAAGGAGGAGCGGAGACGGTCGTTGCCGCGTTACGCTCCGCGGTTGGGCCGACTGGCACTGTGATGGGATACGCGTCGTGGGACCGATCACCCTACGAGGAGACTCTGAATGGCGCTCGGCTGGATGACGAAGCCCGCCGTACCTGGCTGCCGTTCGATCCCGCAACAGCCGGGACTTACCGTGGGTTCGGCCTGCTGAATCAATTTCTGGTTCAAGCCCCCGGCGCGCGGCGCAGCGCGCACCCCGATGCATCGATGGTCGCGGTTGGTCCGCTGGCTGAAACGCTGACGGAGCCTCACGAACTCGGTCACGCCTTGGGGGAAGGATCGCCCGTCGAGCGGTTCGTTCGCCTTGGCGGGAAGGCCCTGCTGTTGGGTGCGCCGCTAAACTCCGTTACCGCATTGCACTACGCCGAGGCGGTTGCCGATATCCCCAACAAACGGTGGGTGACGTATGAGATGCCGATGCTTGGAAGAGACGGTGAAGTCGCCTGGAAAACGGCATCGGATTACGATTCAAACGGCATTCTCGATTGCTTTGCTATCGAAGGAAAGCCGGATGCGGTTGAAACTATAGCAAATGCTTACGTGAAGCTCGGTCGCCATCGAGAAGGTGTCGTGGGCTTTGCTCAGTGCTACCTGTTCGACGCGCAGGACATCGTGACGTTCGGCGTCACCTATCTTGAGAAGCATTTCGGAACCACTCCGATCGTGCCTCCGCACGAGGCCGTCGAGCGCTCTTGCGAGCCTTCAGGTTAG	NA	NA	NA	NA
WP_000587837.1|23500_24043_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|24524_24716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|24721_24967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|25017_26154_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000971921.1|26268_27639_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|28459_29320_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_011091091.1|29988_30498_-	MucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011091092.1|30545_32633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012579091.1|32645_33596_-	DsbC family protein	NA	NA	NA	NA	NA
WP_045626305.1|33606_34869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077256341.1|34913_35189_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_045626302.1|35413_35797_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_011091025.1|35876_36530_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
