The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042540	Enterobacter hormaechei strain C4 chromosome, complete genome	4719578	1617587	1630443	4719578	tRNA,tail,integrase	Enterobacteria_phage(27.27%)	12	1609362:1609377	1636396:1636411
1609362:1609377	attL	CGAGCGCTATGAAGCC	NA	NA	NA	NA
WP_072134628.1|1617587_1618643_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	50.1	2.3e-90
WP_015570955.1|1619252_1620653_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	37.3	1.9e-79
WP_015570954.1|1620821_1622024_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.9	7.6e-45
WP_032665345.1|1622208_1623501_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	95.6	7.2e-243
WP_015570952.1|1623545_1623794_-	excisionase family protein	NA	S4TND0	Salmonella_phage	91.4	5.4e-38
WP_032665346.1|1623944_1624169_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	58.3	8.3e-14
WP_039271183.1|1624169_1624559_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	68.0	2.1e-44
WP_039271179.1|1625135_1625966_-|tail	tail fiber domain-containing protein	tail	A0A192Y7T9	Enterobacteria_phage	31.1	9.3e-34
WP_032665862.1|1626048_1626597_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	80.0	4.5e-77
WP_032665393.1|1626712_1627135_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.1	6.0e-21
WP_032665395.1|1627901_1629368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039271176.1|1629516_1630443_+	helix-turn-helix domain-containing protein	NA	A0A077SL42	Escherichia_phage	45.4	6.2e-71
1636396:1636411	attR	GGCTTCATAGCGCTCG	NA	NA	NA	NA
>prophage 2
NZ_CP042540	Enterobacter hormaechei strain C4 chromosome, complete genome	4719578	1894294	1908151	4719578	terminase,lysis	Salmonella_phage(40.0%)	20	NA	NA
WP_080373385.1|1894294_1895443_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	29.0	4.1e-32
WP_063418870.1|1895403_1896408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080373378.1|1896400_1897843_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_006811588.1|1898264_1898498_+	DinI family protein	NA	A0A0M4REN2	Salmonella_phage	79.2	5.2e-27
WP_017693510.1|1898608_1898818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039271020.1|1898902_1899502_+	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	87.3	1.3e-98
WP_032645668.1|1899507_1899708_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	66.7	3.7e-21
WP_039271017.1|1899710_1899992_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	98.9	9.3e-47
WP_039271015.1|1899988_1900345_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	94.9	3.1e-63
WP_039271013.1|1900341_1900479_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	71.1	2.1e-07
WP_039271011.1|1900478_1901294_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	84.9	8.3e-128
WP_039271009.1|1901452_1901824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039271007.1|1901939_1902164_+|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	87.8	2.2e-30
WP_039271005.1|1902141_1902636_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	96.3	2.1e-89
WP_039271003.1|1902632_1903100_+|lysis	lysis protein	lysis	A0A1V0E5Q6	Salmonella_phage	67.1	4.2e-52
WP_039271001.1|1903134_1903743_+	DUF2441 domain-containing protein	NA	I6PCV9	Cronobacter_phage	60.4	9.7e-73
WP_039270999.1|1903987_1904344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151548414.1|1904444_1905425_+|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	42.2	4.7e-37
WP_039270990.1|1906461_1906881_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	1.4e-35
WP_039270988.1|1906882_1908151_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.4	8.1e-231
>prophage 3
NZ_CP042540	Enterobacter hormaechei strain C4 chromosome, complete genome	4719578	2653358	2660611	4719578	transposase,integrase	Escherichia_phage(16.67%)	11	2653023:2653054	2660694:2660725
2653023:2653054	attL	GCAGATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_039270560.1|2653358_2653946_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	61.0	3.1e-52
WP_039270559.1|2653967_2654438_-	SocA family protein	NA	K4NZT7	Burkholderia_phage	30.4	7.6e-17
WP_039270558.1|2654759_2655077_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	48.1	4.9e-20
WP_039270557.1|2655344_2655605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053337474.1|2655588_2655936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127850788.1|2656012_2656210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039270553.1|2656239_2656674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088581786.1|2656806_2657954_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
WP_039270551.1|2658685_2659201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080338025.1|2659433_2659889_-	hypothetical protein	NA	A0A1W6JP37	Morganella_phage	35.7	7.3e-17
WP_080338024.1|2659921_2660611_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	40.6	4.2e-16
2660694:2660725	attR	GCAGATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 4
NZ_CP042540	Enterobacter hormaechei strain C4 chromosome, complete genome	4719578	2917984	2927231	4719578		Escherichia_phage(25.0%)	9	NA	NA
WP_032103476.1|2917984_2918596_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.3	1.6e-14
WP_039270442.1|2918635_2919616_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_039270440.1|2919807_2920812_+	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	28.7	9.5e-33
WP_023294998.1|2920860_2922027_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.5	1.6e-111
WP_023294999.1|2922280_2923687_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
WP_023295000.1|2923822_2924371_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	9.1e-54
WP_032682169.1|2924381_2925272_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	31.3	2.8e-28
WP_023295002.1|2925284_2926151_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	8.3e-110
WP_032103484.1|2926166_2927231_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	6.4e-104
>prophage 5
NZ_CP042540	Enterobacter hormaechei strain C4 chromosome, complete genome	4719578	3394473	3436220	4719578	terminase,coat,holin,integrase,tail	Escherichia_phage(30.43%)	58	3427395:3427411	3437033:3437049
WP_003860711.1|3394473_3395154_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.0	9.6e-21
WP_032649119.1|3395377_3396352_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003860714.1|3396367_3398173_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
WP_151548453.1|3398355_3398679_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	54.2	6.8e-25
WP_045347937.1|3398678_3398918_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	72.2	7.0e-27
WP_063863880.1|3398992_3399574_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	79.2	2.8e-77
WP_151548454.1|3399731_3400376_+	hypothetical protein	NA	G9JXH9	Shigella_phage	50.3	2.2e-27
WP_022651625.1|3401236_3401524_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	61.5	9.3e-18
WP_063945428.1|3401541_3401880_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	99.1	3.2e-57
WP_151548455.1|3401945_3402878_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	98.1	2.2e-164
WP_151548456.1|3402924_3403371_-	hypothetical protein	NA	G8C7Q2	Escherichia_phage	89.9	1.5e-70
WP_047642180.1|3403360_3403960_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	87.4	1.5e-97
WP_151884558.1|3403962_3404316_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	90.5	1.1e-52
WP_151884559.1|3404317_3404800_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	96.2	3.3e-84
WP_151884560.1|3404802_3405108_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	83.8	1.2e-10
WP_032621539.1|3405147_3406284_-|coat	coat protein	coat	G8C7P7	Escherichia_phage	92.6	8.4e-195
WP_063945437.1|3406728_3408132_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	94.8	2.9e-253
WP_151884561.1|3408136_3409441_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	2.2e-146
WP_151548457.1|3409418_3410405_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	41.7	2.6e-35
WP_072139842.1|3410439_3410688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151548500.1|3410800_3411250_-	hypothetical protein	NA	G8C7T5	Escherichia_phage	71.1	1.2e-56
WP_151548458.1|3411249_3411432_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	86.4	4.2e-16
WP_151548501.1|3411388_3411664_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	80.9	9.2e-31
WP_151548459.1|3411665_3412295_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	88.5	7.1e-103
WP_047642188.1|3412291_3412576_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	2.6e-20
WP_151548460.1|3412562_3412949_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	78.9	1.0e-43
WP_151548461.1|3413369_3413753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151548462.1|3414320_3415136_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	84.5	1.1e-127
WP_151548463.1|3415132_3415273_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	73.7	1.8e-06
WP_151548464.1|3415269_3415881_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	73.4	3.8e-61
WP_151548465.1|3415883_3416084_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	76.9	2.1e-24
WP_151548466.1|3416089_3416689_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	87.3	5.9e-99
WP_017693510.1|3416773_3416983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058646353.1|3417093_3417327_-	DinI family protein	NA	A0A0M4REN2	Salmonella_phage	79.2	6.8e-27
WP_151548467.1|3417470_3419450_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.6	1.3e-203
WP_047642195.1|3419446_3419704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151548468.1|3419703_3420312_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	49.3	8.6e-21
WP_047642158.1|3420315_3420597_-	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	80.5	7.2e-31
WP_151548469.1|3420599_3421088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045629615.1|3421084_3421345_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	74.7	1.3e-29
WP_151548470.1|3421348_3422035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151548471.1|3422046_3422739_-	phage replication protein	NA	G8C7U6	Escherichia_phage	60.4	7.1e-80
WP_151548502.1|3422722_3423715_-	replication protein	NA	A5VW95	Enterobacteria_phage	75.0	1.4e-49
WP_032659815.1|3423888_3424143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151548472.1|3424151_3424694_-	regulator	NA	M9NZI6	Enterobacteria_phage	54.4	2.1e-47
WP_047736767.1|3424696_3424927_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	40.8	4.0e-11
WP_052951377.1|3425029_3425452_+	transcriptional regulator	NA	A0A0H5BBV1	Pseudomonas_phage	51.2	7.1e-06
WP_032619247.1|3425634_3425820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151548473.1|3426241_3429517_+	exodeoxyribonuclease	NA	K7P6V4	Enterobacteria_phage	68.4	0.0e+00
3427395:3427411	attL	GCATCAGCAGCGTGCAG	NA	NA	NA	NA
WP_151548503.1|3429528_3430638_+	enterohemolysin	NA	H6WRX0	Salmonella_phage	80.2	1.5e-167
WP_151548474.1|3430672_3431338_+	morphogenetic protein	NA	Q71T76	Escherichia_phage	50.4	3.9e-51
WP_032674007.1|3431324_3431567_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	89.9	5.1e-33
WP_023314677.1|3431613_3431898_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	81.9	9.5e-39
WP_006811608.1|3431875_3433105_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	98.8	9.9e-242
WP_006811609.1|3433536_3434013_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_023304255.1|3434009_3434963_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_015572138.1|3434962_3435613_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_006176728.1|3435644_3436220_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
3437033:3437049	attR	CTGCACGCTGCTGATGC	NA	NA	NA	NA
>prophage 6
NZ_CP042540	Enterobacter hormaechei strain C4 chromosome, complete genome	4719578	3997448	4025912	4719578	terminase,head,portal,protease,plate,transposase,capsid,tRNA,integrase,tail	uncultured_Caudovirales_phage(54.17%)	36	3995310:3995324	4031033:4031047
3995310:3995324	attL	CCTGCTCGCCCGCGC	NA	NA	NA	NA
WP_015571911.1|3997448_3998462_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.4e-108
WP_001144069.1|3998698_3998914_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_039269725.1|3999029_4000775_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_015571912.1|4000927_4002772_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_017384024.1|4002874_4003381_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_126851081.1|4004004_4004340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151548505.1|4004390_4004729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304451.1|4004737_4005352_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	69.7	2.1e-67
WP_151548482.1|4005365_4007027_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	97.8	0.0e+00
WP_000113647.1|4007010_4007367_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_151548483.1|4007324_4007516_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_151548484.1|4007642_4008086_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	90.5	8.0e-77
WP_001549740.1|4008085_4008379_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	81.4	9.4e-42
WP_001549741.1|4008371_4008710_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	47.7	1.5e-22
WP_151548485.1|4008706_4009942_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	97.6	2.5e-237
WP_108168750.1|4009943_4010504_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	98.4	1.0e-100
WP_108168751.1|4010555_4011722_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.0	2.6e-215
WP_108168752.1|4011965_4012739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108168788.1|4012781_4013018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108168753.1|4013385_4014750_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	96.0	2.7e-256
WP_045324750.1|4014746_4015115_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	99.2	1.3e-61
WP_029401191.1|4015111_4015339_-	hypothetical protein	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	89.2	5.4e-29
WP_078309651.1|4015331_4015517_-	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	85.2	8.3e-20
WP_151548486.1|4015509_4016532_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGN8	uncultured_Caudovirales_phage	39.0	4.6e-43
WP_045341105.1|4016542_4016752_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151548487.1|4016893_4017727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047723480.1|4017719_4019144_-|integrase	integrase family protein	integrase	H7BV31	unidentified_phage	27.2	8.8e-08
WP_108376613.1|4019578_4019938_-|plate	baseplate J-like protein	plate	A0A0F7LCQ9	Escherichia_phage	78.0	4.3e-44
WP_039269723.1|4019943_4020294_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	70.7	4.4e-38
WP_039269721.1|4020995_4021766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039269719.1|4021914_4022364_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	1.4e-47
WP_151884562.1|4022356_4022824_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	67.7	8.8e-58
WP_017382984.1|4022786_4022945_-	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	75.0	1.5e-14
WP_017692646.1|4023515_4023980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017692645.1|4023957_4024350_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_088581786.1|4024764_4025912_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	5.0e-147
4031033:4031047	attR	CCTGCTCGCCCGCGC	NA	NA	NA	NA
>prophage 1
NZ_CP042541	Enterobacter hormaechei strain C4 plasmid pC4_001, complete sequence	155361	34283	107112	155361	integrase,transposase	uncultured_Caudovirales_phage(25.0%)	80	72375:72389	109299:109313
WP_015572054.1|34283_35060_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.2	7.0e-52
WP_015572055.1|35762_36773_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.2	6.3e-85
WP_023327689.1|37513_38680_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	94.3	5.5e-218
WP_013087134.1|38679_39645_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	76.9	9.8e-136
WP_072199628.1|40294_40975_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	62.8	1.6e-79
WP_001067855.1|41042_41747_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_100135256.1|41723_41942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000893479.1|41926_42436_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|42440_42647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|43028_44462_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|44495_45710_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_024139167.1|45716_45929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|45970_46735_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|46877_47144_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|47364_47838_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|47993_49007_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|49077_49782_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001011939.1|49925_50567_-	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	7.3e-55
WP_001239317.1|50716_51217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|51296_52001_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004118521.1|52209_52932_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.5e-96
WP_001549888.1|52989_53418_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_001549887.1|53467_54751_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549886.1|54846_55200_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549885.1|55682_57161_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_004118529.1|57179_58007_+	universal stress protein	NA	NA	NA	NA	NA
WP_001143760.1|58171_61177_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001235713.1|61340_61898_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|62080_62941_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001120891.1|63150_63690_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000480968.1|63661_64498_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|64497_65301_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|65361_66177_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|66505_66682_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|66863_67868_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|69764_70469_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_151548507.1|70480_70738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013087170.1|70746_71460_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.3	8.1e-95
WP_013087171.1|71461_71785_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012540086.1|72085_72352_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_013087172.1|72339_72825_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
72375:72389	attL	CTTTCATCAGGTGGC	NA	NA	NA	NA
WP_000589001.1|73243_74584_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_032072095.1|74839_75262_-	nickel resistance OB fold protein NcrY	NA	NA	NA	NA	NA
WP_004196366.1|75423_76554_-	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_004196355.1|76566_76836_-	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196314.1|76941_78240_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196325.1|78473_79232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196315.1|79285_80206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196359.1|80268_80640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008460269.1|81040_81964_+	chromate resistance protein	NA	NA	NA	NA	NA
WP_008460270.1|81917_83297_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	64.6	1.6e-27
WP_013087175.1|83327_84017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008460272.1|84030_84768_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_009651956.1|84811_85177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087451024.1|85212_86333_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_004196370.1|86652_86892_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	9.1e-19
WP_000323025.1|86891_87179_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_013087178.1|88351_88510_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_044157807.1|89385_89700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087181.1|89760_90222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087182.1|90309_90510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087183.1|90550_91342_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_013087184.1|91383_91719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032662330.1|92407_92701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087187.1|92717_93539_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	42.9	1.8e-50
WP_032662327.1|93567_94107_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_013087191.1|94680_95076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087192.1|95108_95750_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_013087194.1|95946_96300_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_013087195.1|96303_96606_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_151884563.1|96611_97193_+	conjugal transfer protein TraE	NA	NA	NA	NA	NA
WP_013087200.1|98903_99188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087202.1|99638_100127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087204.1|100477_101020_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_013087205.1|101016_101271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151884564.1|102511_104050_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_013087230.1|104077_104863_+	DsbA family protein	NA	NA	NA	NA	NA
WP_013087231.1|104963_105515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023338064.1|105505_105922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013087234.1|106134_107112_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	39.7	1.7e-47
109299:109313	attR	GCCACCTGATGAAAG	NA	NA	NA	NA
>prophage 1
NZ_CP042542	Enterobacter hormaechei strain C4 plasmid pC4_002, complete sequence	88956	2110	36530	88956	transposase,protease,integrase	Escherichia_phage(37.5%)	39	1913:1972	22534:23488
1913:1972	attL	GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATC	NA	NA	NA	NA
WP_001067834.1|2110_2815_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_014344500.1|2848_3121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|3089_4103_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015060105.1|4255_4996_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_015063357.1|5227_5560_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_003159191.1|5686_6241_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|6335_6968_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000679427.1|7124_7472_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|7465_8305_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|8709_10251_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003833285.1|11557_12010_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_012695489.1|12051_12696_-	quinolone resistance pentapeptide repeat protein QnrB2	NA	NA	NA	NA	NA
WP_000259031.1|13186_14026_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|13955_14135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883563.1|14153_14426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|14607_15612_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|15839_17045_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|17055_17361_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|17376_17559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|17587_18352_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|18542_18899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|18844_19429_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|19428_20667_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|20663_21569_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067834.1|21690_22395_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000557454.1|22627_23488_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
22534:23488	attR	GATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTATAGTGTTTTGCAGTTTAGAGGAGATATCGCGATGCATACGCGGAAGGCAATAACGGAGGCGCTTCAAAAACTCGGAGTCCAAACCGGTGACCTCTTGATGGTGCATGCCTCACTTAAAGCGATTGGTCCGGTCGAAGGAGGAGCGGAGACGGTCGTTGCCGCGTTACGCTCCGCGGTTGGGCCGACTGGCACTGTGATGGGATACGCGTCGTGGGACCGATCACCCTACGAGGAGACTCTGAATGGCGCTCGGCTGGATGACGAAGCCCGCCGTACCTGGCTGCCGTTCGATCCCGCAACAGCCGGGACTTACCGTGGGTTCGGCCTGCTGAATCAATTTCTGGTTCAAGCCCCCGGCGCGCGGCGCAGCGCGCACCCCGATGCATCGATGGTCGCGGTTGGTCCGCTGGCTGAAACGCTGACGGAGCCTCACGAACTCGGTCACGCCTTGGGGGAAGGATCGCCCGTCGAGCGGTTCGTTCGCCTTGGCGGGAAGGCCCTGCTGTTGGGTGCGCCGCTAAACTCCGTTACCGCATTGCACTACGCCGAGGCGGTTGCCGATATCCCCAACAAACGGTGGGTGACGTATGAGATGCCGATGCTTGGAAGAGACGGTGAAGTCGCCTGGAAAACGGCATCGGATTACGATTCAAACGGCATTCTCGATTGCTTTGCTATCGAAGGAAAGCCGGATGCGGTTGAAACTATAGCAAATGCTTACGTGAAGCTCGGTCGCCATCGAGAAGGTGTCGTGGGCTTTGCTCAGTGCTACCTGTTCGACGCGCAGGACATCGTGACGTTCGGCGTCACCTATCTTGAGAAGCATTTCGGAACCACTCCGATCGTGCCTCCGCACGAGGCCGTCGAGCGCTCTTGCGAGCCTTCAGGTTAG	NA	NA	NA	NA
WP_000587837.1|23500_24043_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|24524_24716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|24721_24967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|25017_26154_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000971921.1|26268_27639_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|28459_29320_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_011091091.1|29988_30498_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011091092.1|30545_32633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012579091.1|32645_33596_-	DsbC family protein	NA	NA	NA	NA	NA
WP_045626305.1|33606_34869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077256341.1|34913_35189_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_045626302.1|35413_35797_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_011091025.1|35876_36530_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
