The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042520	Klebsiella pneumoniae strain C2 chromosome, complete genome	5243002	646862	704048	5243002	holin,tail,lysis,integrase,tRNA,capsid,portal,plate,terminase,head	Salmonella_phage(60.0%)	76	656783:656798	679716:679731
WP_058229178.1|646862_647891_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	97.9	6.0e-192
WP_038807527.1|647890_648466_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	65.4	1.2e-67
WP_071703894.1|648598_648862_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	96.6	1.2e-43
WP_038807526.1|648892_649402_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	95.9	2.6e-87
WP_038807553.1|649409_649610_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	90.9	5.3e-28
WP_000963463.1|649573_649912_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	94.6	7.3e-54
WP_038807525.1|649979_650207_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	97.3	2.9e-30
WP_038807524.1|650206_650428_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	94.5	2.1e-33
WP_038807523.1|650429_652649_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	92.1	0.0e+00
WP_050573333.1|652763_653204_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	80.3	7.0e-57
WP_050573332.1|653302_654100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151641666.1|654162_654495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038808226.1|654467_655163_-	hypothetical protein	NA	M1SV64	Escherichia_phage	54.9	5.6e-93
WP_019725382.1|655617_655821_+|tail	tail protein	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
WP_019725381.1|655825_656116_+|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	79.6	5.0e-35
WP_038808228.1|656102_656600_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	85.8	4.8e-78
WP_038808229.1|656596_657016_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	63.3	9.7e-40
656783:656798	attL	GCGCAGGCCGCCATGC	NA	NA	NA	NA
WP_077263793.1|656909_657161_+|holin	holin	holin	S4TNY4	Salmonella_phage	70.0	4.9e-23
WP_038808231.1|657123_657591_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	72.9	4.5e-62
WP_038808232.1|657583_658033_+	phage virion morphogenesis protein	NA	A0A218M4K4	Erwinia_phage	62.6	2.0e-43
WP_124982846.1|658068_659316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038808233.1|659420_660062_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.0	4.9e-91
WP_038808234.1|660058_660406_+|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	76.5	2.4e-44
WP_058229078.1|660410_661319_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	70.5	2.4e-112
WP_058229077.1|661311_661908_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	53.1	2.5e-49
WP_023343301.1|663903_664122_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
WP_032439000.1|664365_665451_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	61.0	5.3e-122
WP_048300117.1|665454_666075_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	38.5	3.3e-36
WP_004144798.1|666175_666412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704952.1|666446_666956_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	84.6	4.1e-77
WP_019704179.1|666963_667164_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	84.6	1.3e-26
WP_004174279.1|667127_667469_+	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	86.7	1.1e-49
WP_032414758.1|667536_667770_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	93.5	1.6e-31
WP_151641667.1|667769_667997_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	86.7	3.6e-33
WP_151641668.1|667993_668881_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	70.4	6.5e-110
WP_151641669.1|668861_671267_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	89.2	0.0e+00
WP_004144689.1|671439_671628_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	7.9e-26
WP_024623050.1|671642_671876_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	84.4	7.8e-31
WP_004174290.1|671951_672209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038421825.1|672510_673578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032431240.1|673574_673895_+	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_024623047.1|673900_674389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151641670.1|674472_675498_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.2	1.9e-174
WP_004185719.1|675497_677261_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	93.0	0.0e+00
WP_109885916.1|677401_678235_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.5	1.0e-101
WP_019704960.1|678251_679316_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.3	4.3e-185
WP_151641671.1|679319_679970_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	86.1	2.1e-102
679716:679731	attR	GCGCAGGCCGCCATGC	NA	NA	NA	NA
WP_107357672.1|680066_680531_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	4.6e-75
WP_002896155.1|680530_680734_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_004144702.1|680737_680953_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
WP_019704195.1|680933_681443_+	lysozyme	NA	E5G6N1	Salmonella_phage	84.6	3.3e-82
WP_151641672.1|681447_681831_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	44.5	2.8e-17
WP_151641673.1|681827_682256_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	1.6e-50
WP_121936562.1|682351_682783_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	81.8	1.7e-63
WP_151641674.1|682775_683222_+	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	79.3	6.7e-55
WP_023305005.1|683290_683863_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	71.7	1.0e-76
WP_004174325.1|683859_684222_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	9.9e-49
WP_023305004.1|684208_685117_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	9.9e-106
WP_151641771.1|685109_685712_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	61.0	5.1e-58
WP_151641675.1|685805_688601_+	hypothetical protein	NA	A0A0S1S5D9	Klebsiella_phage	51.7	2.1e-239
WP_073511241.1|688608_689445_+	hypothetical protein	NA	A0A0S1S106	Klebsiella_phage	66.5	1.1e-103
WP_151641676.1|689460_690531_+|tail	phage tail protein	tail	A0A2H4J931	uncultured_Caudovirales_phage	45.1	1.2e-30
WP_109885823.1|690669_691842_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.1	2.8e-209
WP_064146903.1|691851_692367_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	7.4e-82
WP_004144716.1|692419_692719_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	80.0	1.6e-33
WP_002896220.1|692733_692853_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_151641677.1|692845_695473_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_004185683.1|695469_695955_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	4.1e-58
WP_032438995.1|695951_697049_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.4	1.8e-173
WP_072001509.1|697119_697338_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	8.3e-27
WP_032438994.1|697344_697731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002917636.1|698058_698565_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004174339.1|698664_700506_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_004149864.1|700724_702470_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|702581_702797_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_040237763.1|703034_704048_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	2.4e-108
>prophage 2
NZ_CP042520	Klebsiella pneumoniae strain C2 chromosome, complete genome	5243002	1657765	1664672	5243002		Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1657765_1658629_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_023301146.1|1658639_1659413_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.3e-26
WP_002912636.1|1659655_1660549_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1660794_1662156_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1662474_1663197_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1663193_1664672_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
NZ_CP042520	Klebsiella pneumoniae strain C2 chromosome, complete genome	5243002	1807582	1847279	5243002	holin,tail,integrase,protease,portal,terminase	Klebsiella_phage(29.55%)	49	1800902:1800915	1811687:1811700
1800902:1800915	attL	AATGGCTGGCGCGC	NA	NA	NA	NA
WP_151641685.1|1807582_1808617_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	64.0	1.2e-123
WP_071925326.1|1808616_1808847_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_040188683.1|1808913_1809105_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	88.9	7.3e-27
WP_151641686.1|1809101_1809887_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	49.8	1.4e-60
WP_004206651.1|1809886_1810186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151641687.1|1810548_1811244_-	helix-turn-helix domain-containing protein	NA	Q8HAA0	Salmonella_phage	72.0	2.1e-87
WP_001191665.1|1811341_1811584_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_004206654.1|1811618_1812080_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	6.4e-69
1811687:1811700	attR	AATGGCTGGCGCGC	NA	NA	NA	NA
WP_071994923.1|1812317_1812530_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.9e-16
WP_151641688.1|1812486_1813401_+	transcriptional regulator	NA	H2DE83	Erwinia_phage	58.7	5.2e-30
WP_151641689.1|1813397_1814207_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	70.0	3.1e-111
WP_151641690.1|1814216_1814594_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	1.5e-47
WP_151641691.1|1814606_1815587_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	6.4e-135
WP_064169098.1|1815605_1815968_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	88.5	2.2e-56
WP_064169099.1|1815957_1816536_-	hypothetical protein	NA	S5FXQ0	Shigella_phage	60.7	1.1e-57
WP_064169100.1|1816543_1817572_-	hypothetical protein	NA	S5FNT5	Shigella_phage	57.6	2.5e-113
WP_057182115.1|1818057_1818357_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	84.8	1.5e-39
WP_151641692.1|1818353_1818893_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	9.7e-101
WP_151641693.1|1818889_1819237_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.0	4.7e-40
WP_151641694.1|1819233_1819509_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	70.8	6.4e-24
WP_109139490.1|1819459_1819654_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	82.8	2.9e-23
WP_085840993.1|1819711_1820074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151641695.1|1820197_1820857_+	DUF2441 domain-containing protein	NA	I6PCV9	Cronobacter_phage	40.6	3.9e-43
WP_151641696.1|1820975_1821221_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	64.2	6.1e-18
WP_107334310.1|1821446_1821707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071556674.1|1821773_1821959_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	59.3	1.2e-10
WP_151641697.1|1822279_1822771_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	82.8	9.2e-66
WP_040225562.1|1822770_1824879_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.3	0.0e+00
WP_020317294.1|1824875_1825091_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	7.7e-25
WP_020317329.1|1825087_1826587_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
WP_151641772.1|1826531_1828547_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.5	0.0e+00
WP_151641698.1|1828627_1828954_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	68.2	6.2e-34
WP_020317349.1|1828946_1829240_+	sugar ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_020317346.1|1829229_1829781_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.9	5.3e-54
WP_020804325.1|1829777_1830176_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
WP_023304948.1|1830183_1830666_+	hypothetical protein	NA	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
WP_025714420.1|1830708_1831104_+|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	27.5	1.9e-08
WP_032420719.1|1831124_1831442_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
WP_151641699.1|1831422_1834119_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.1	9.2e-200
WP_071961347.1|1834118_1834592_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.9	1.7e-53
WP_151641700.1|1834578_1835061_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	96.9	1.1e-82
WP_151641701.1|1835070_1835451_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	94.4	3.1e-69
WP_151641702.1|1835447_1838516_+	kinase	NA	A0A286S259	Klebsiella_phage	96.1	0.0e+00
WP_151641703.1|1838592_1841319_+	hypothetical protein	NA	A0A0S1S5D9	Klebsiella_phage	54.0	3.7e-241
WP_151641704.1|1841327_1842164_+	hypothetical protein	NA	A0A0S1S106	Klebsiella_phage	64.7	8.3e-99
WP_151641705.1|1842233_1844690_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	61.5	5.7e-31
WP_151641706.1|1844781_1845330_+	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	95.6	2.7e-90
WP_004179627.1|1845592_1846012_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	8.5e-36
WP_151641707.1|1846013_1847279_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.6	7.9e-210
>prophage 4
NZ_CP042520	Klebsiella pneumoniae strain C2 chromosome, complete genome	5243002	2666359	2677246	5243002		Escherichia_phage(87.5%)	9	NA	NA
WP_071068227.1|2666359_2669467_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
WP_004176258.1|2669521_2670787_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2670817_2671906_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|2671992_2672253_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_063864695.1|2672550_2673411_+	class A broad-spectrum beta-lactamase SHV-61	NA	A0A077SL40	Escherichia_phage	99.0	6.4e-155
WP_002210513.1|2673431_2674193_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2674453_2675356_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|2675367_2676633_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_071068229.1|2676625_2677246_+	aldolase	NA	A0A077SK32	Escherichia_phage	99.5	1.8e-114
>prophage 5
NZ_CP042520	Klebsiella pneumoniae strain C2 chromosome, complete genome	5243002	3072343	3135160	5243002	holin,tail,lysis,integrase,tRNA,protease,capsid,portal,terminase,head	Enterobacteria_phage(16.39%)	79	3084770:3084785	3136829:3136844
WP_004892953.1|3072343_3072496_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_071592550.1|3073028_3073838_-	chaperonin	NA	A0A0F7L9X0	Escherichia_phage	82.9	7.9e-139
WP_110218392.1|3074084_3074762_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	4.8e-81
WP_080819783.1|3074954_3075845_-	HNH endonuclease	NA	K7PK19	Enterobacteria_phage	91.9	4.3e-162
WP_071195274.1|3075841_3077419_-	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	95.4	5.3e-288
WP_151641730.1|3077683_3078949_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.4	1.1e-208
WP_151641731.1|3078950_3079370_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	8.5e-36
WP_074188108.1|3079919_3080342_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_074188109.1|3080419_3080590_-	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	80.0	1.8e-16
WP_151641732.1|3080682_3082473_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_114507509.1|3082907_3083033_-	recombinase RecA	NA	F8SJ86	Pseudomonas_phage	41.5	3.9e-05
WP_151641733.1|3083094_3083922_-	hypothetical protein	NA	A0A0S1S106	Klebsiella_phage	49.6	4.0e-69
3084770:3084785	attL	GCAGTTTGCTGGCCAG	NA	NA	NA	NA
WP_151641734.1|3086718_3089796_-	kinase	NA	A0A286S259	Klebsiella_phage	61.9	0.0e+00
WP_038808159.1|3089792_3090173_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	79.4	1.3e-56
WP_004177130.1|3090185_3090662_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004884312.1|3090648_3091122_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.7	1.1e-55
WP_151641735.1|3091143_3094530_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.0	1.6e-297
WP_016530182.1|3094590_3094824_-	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_038808155.1|3094897_3095203_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	63.6	1.4e-27
WP_046879074.1|3095205_3095610_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	56.9	1.9e-32
WP_025713380.1|3095640_3096345_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	1.6e-79
WP_025713381.1|3096401_3096749_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.9	1.8e-31
WP_040241939.1|3096745_3097195_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	5.1e-63
WP_151641774.1|3097191_3097530_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	5.6e-38
WP_032734570.1|3097542_3097875_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
WP_101856656.1|3097880_3098135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080917171.1|3098180_3099401_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.0	8.3e-140
WP_040241930.1|3099410_3100118_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.5	2.9e-68
WP_042947687.1|3100093_3101413_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	58.6	1.9e-137
WP_151641736.1|3101419_3103156_-|terminase	phage terminase small subunit P27 family	terminase	A0A0U2C138	Paracoccus_phage	45.3	1.7e-138
WP_151641737.1|3103109_3103574_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.7	3.7e-48
WP_151641738.1|3103756_3104098_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	73.0	5.1e-47
WP_085803441.1|3104566_3104896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085803442.1|3104970_3105162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085803446.1|3105233_3105479_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	59.7	1.5e-16
WP_049026358.1|3105594_3105888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124034771.1|3106017_3106236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151641739.1|3106335_3106725_-	hypothetical protein	NA	Q71TL7	Escherichia_phage	48.4	1.9e-26
WP_085803443.1|3106809_3107298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114148246.1|3107368_3107500_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	82.1	6.5e-11
WP_085803444.1|3107481_3107772_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	51.2	3.5e-20
WP_040088892.1|3107856_3108045_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_087759902.1|3108068_3108536_-|lysis	lysis protein	lysis	A0A1V0E5Q6	Salmonella_phage	72.9	4.1e-55
WP_040088890.1|3108532_3109012_-	glycoside hydrolase family 104 protein	NA	A5VW81	Enterobacteria_phage	84.3	8.4e-72
WP_004899663.1|3109104_3109386_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	72.0	2.9e-32
WP_032421481.1|3109372_3109768_-	membrane protein	NA	G8C7V8	Escherichia_phage	72.3	5.5e-45
WP_035942517.1|3110011_3110227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151641775.1|3110532_3111300_-	hypothetical protein	NA	J7KHM1	Erwinia_phage	75.1	2.2e-106
WP_064279091.1|3111635_3111923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151641740.1|3111967_3113020_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	79.0	4.6e-171
WP_048290386.1|3113169_3113361_-	TrmB family transcriptional regulator	NA	Q8SBE3	Shigella_phage	82.5	4.1e-22
WP_060598778.1|3113570_3114401_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	46.9	2.2e-59
WP_108451513.1|3114419_3115406_-	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	48.9	3.4e-91
WP_117067446.1|3115487_3116309_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	65.8	1.8e-90
WP_151641741.1|3116398_3116797_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	69.7	3.1e-43
WP_117067445.1|3116793_3117270_-|protease	SOS-response repressor and protease LexA	protease	U5P451	Shigella_phage	61.8	1.4e-15
WP_151641742.1|3117266_3119117_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.5	1.6e-198
WP_151641743.1|3119109_3120492_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	48.8	1.4e-106
WP_151641744.1|3120479_3120938_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_135686824.1|3120934_3121846_-	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	74.5	3.4e-53
WP_023322342.1|3121835_3122015_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	5.6e-13
WP_064081445.1|3122187_3122739_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	69.4	3.8e-68
WP_023343174.1|3122783_3122984_-	hypothetical protein	NA	U5P445	Shigella_phage	80.0	4.3e-22
WP_032429029.1|3123071_3123731_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	87.2	1.2e-113
WP_060853925.1|3124046_3124505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041937773.1|3125407_3125779_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	88.6	7.7e-57
WP_048323715.1|3125825_3126653_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	71.3	9.3e-111
WP_041937772.1|3127129_3127657_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	69.1	1.0e-62
WP_032701051.1|3127656_3127857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008806037.1|3127849_3128635_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	3.8e-61
WP_032701050.1|3128762_3129227_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	39.1	1.0e-10
WP_008806035.1|3129223_3129493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086624261.1|3129595_3129871_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	40.4	1.5e-09
WP_008806034.1|3129899_3130136_+	excisionase	NA	NA	NA	NA	NA
WP_008806033.1|3130125_3131268_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	81.9	1.2e-172
WP_004150800.1|3131380_3132631_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3132871_3133522_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_021313538.1|3133538_3133997_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3134053_3135160_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3136829:3136844	attR	CTGGCCAGCAAACTGC	NA	NA	NA	NA
>prophage 6
NZ_CP042520	Klebsiella pneumoniae strain C2 chromosome, complete genome	5243002	3397682	3407145	5243002	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004224003.1|3397682_3399404_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3399448_3400150_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3400503_3400722_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_038808049.1|3400841_3403121_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	3.7e-165
WP_002896520.1|3403151_3403469_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3403794_3404016_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3404092_3406033_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_038808052.1|3406029_3407145_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP042521	Klebsiella pneumoniae strain C2 plasmid pC2_001, complete sequence	169226	45478	99468	169226	transposase,protease,integrase	Planktothrix_phage(14.29%)	45	65695:65715	106758:106778
WP_004152113.1|45478_46441_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_004152114.1|46427_46916_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_004152115.1|47413_47611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|47610_50406_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|50538_51108_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|51142_51424_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|51667_51931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|51945_52209_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_004181997.1|53359_54367_-	formamidase	NA	NA	NA	NA	NA
WP_004181996.1|54402_55092_-	urea ABC transporter ATP-binding subunit UrtE	NA	G9BWD6	Planktothrix_phage	29.6	8.5e-17
WP_004181995.1|55102_55852_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	2.4e-17
WP_004181994.1|55848_56964_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_004181993.1|56973_57900_-	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_004197507.1|57956_59147_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004181991.1|59451_62832_+	response regulator	NA	A0A1V0SGX0	Hokovirus	30.3	1.7e-41
WP_004181990.1|62794_63715_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.1	2.0e-13
WP_072143344.1|64711_65680_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.0e-173
65695:65715	attL	GATTTATTCAACAAAGCCGTT	NA	NA	NA	NA
WP_080925134.1|66493_66739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118832.1|67590_69324_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|69331_70279_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004152278.1|70323_71928_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|71940_72861_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118228.1|72860_73709_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|73705_74299_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|74295_75423_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|75707_75875_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_004197062.1|76977_77499_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004197067.1|77495_78449_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_029498502.1|78541_80866_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_023157913.1|80910_81813_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|81809_82808_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118246.1|82804_83761_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|83761_84529_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|84627_84921_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_071527925.1|85251_85494_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427614.1|85791_86796_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_040251959.1|88231_88447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016831235.1|88669_89752_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	96.1	4.4e-185
WP_004182121.1|89873_92948_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_004182120.1|92999_94253_+	lactose permease	NA	NA	NA	NA	NA
WP_071527922.1|94309_94480_+	galactoside O-acetyltransferase	NA	NA	NA	NA	NA
WP_023313931.1|95358_95619_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004182117.1|95675_97739_-	TonB-dependent copper receptor	NA	NA	NA	NA	NA
WP_015065566.1|97821_98241_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_000537151.1|99183_99468_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	47.1	4.7e-14
106758:106778	attR	AACGGCTTTGTTGAATAAATC	NA	NA	NA	NA
>prophage 1
NZ_CP042522	Klebsiella pneumoniae strain C2 plasmid pC2_002, complete sequence	87731	2110	36530	87731	transposase,integrase,protease	Escherichia_phage(37.5%)	39	1913:1972	22534:23488
1913:1972	attL	GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATC	NA	NA	NA	NA
WP_001067834.1|2110_2815_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_014344500.1|2848_3121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|3089_4103_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015060105.1|4255_4996_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_015063357.1|5227_5560_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_003159191.1|5686_6241_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|6335_6968_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000679427.1|7124_7472_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|7465_8305_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|8709_10251_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003833285.1|11557_12010_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_012695489.1|12051_12696_-	quinolone resistance pentapeptide repeat protein QnrB2	NA	NA	NA	NA	NA
WP_000259031.1|13186_14026_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|13955_14135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883563.1|14153_14426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|14607_15612_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|15839_17045_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|17055_17361_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|17376_17559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|17587_18352_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|18542_18899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|18844_19429_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|19428_20667_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|20663_21569_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067834.1|21690_22395_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000557454.1|22627_23488_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
22534:23488	attR	GATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTATAGTGTTTTGCAGTTTAGAGGAGATATCGCGATGCATACGCGGAAGGCAATAACGGAGGCGCTTCAAAAACTCGGAGTCCAAACCGGTGACCTCTTGATGGTGCATGCCTCACTTAAAGCGATTGGTCCGGTCGAAGGAGGAGCGGAGACGGTCGTTGCCGCGTTACGCTCCGCGGTTGGGCCGACTGGCACTGTGATGGGATACGCGTCGTGGGACCGATCACCCTACGAGGAGACTCTGAATGGCGCTCGGCTGGATGACGAAGCCCGCCGTACCTGGCTGCCGTTCGATCCCGCAACAGCCGGGACTTACCGTGGGTTCGGCCTGCTGAATCAATTTCTGGTTCAAGCCCCCGGCGCGCGGCGCAGCGCGCACCCCGATGCATCGATGGTCGCGGTTGGTCCGCTGGCTGAAACGCTGACGGAGCCTCACGAACTCGGTCACGCCTTGGGGGAAGGATCGCCCGTCGAGCGGTTCGTTCGCCTTGGCGGGAAGGCCCTGCTGTTGGGTGCGCCGCTAAACTCCGTTACCGCATTGCACTACGCCGAGGCGGTTGCCGATATCCCCAACAAACGGTGGGTGACGTATGAGATGCCGATGCTTGGAAGAGACGGTGAAGTCGCCTGGAAAACGGCATCGGATTACGATTCAAACGGCATTCTCGATTGCTTTGCTATCGAAGGAAAGCCGGATGCGGTTGAAACTATAGCAAATGCTTACGTGAAGCTCGGTCGCCATCGAGAAGGTGTCGTGGGCTTTGCTCAGTGCTACCTGTTCGACGCGCAGGACATCGTGACGTTCGGCGTCACCTATCTTGAGAAGCATTTCGGAACCACTCCGATCGTGCCTCCGCACGAGGCCGTCGAGCGCTCTTGCGAGCCTTCAGGTTAG	NA	NA	NA	NA
WP_000587837.1|23500_24043_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|24524_24716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|24721_24967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|25017_26154_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000971921.1|26268_27639_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|28459_29320_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_011091091.1|29988_30498_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011091092.1|30545_32633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012579091.1|32645_33596_-	DsbC family protein	NA	NA	NA	NA	NA
WP_045626305.1|33606_34869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077256341.1|34913_35189_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_045626302.1|35413_35797_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_011091025.1|35876_36530_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
