The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042571	Enterobacter hormaechei strain E5 chromosome, complete genome	4841070	879291	938375	4841070	protease,transposase,tRNA	Escherichia_phage(33.33%)	46	NA	NA
WP_023305458.1|879291_880182_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155232.1|880241_880697_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_023299353.1|880873_881578_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_003856249.1|881567_882122_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_023305459.1|882195_884625_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	9.0e-37
WP_023305460.1|884822_887348_+	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_063160191.1|887585_889796_+	ferrichrome porin FhuA	NA	NA	NA	NA	NA
WP_022647093.1|889846_890644_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	4.6e-14
WP_023299359.1|890643_891534_+	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
WP_032676695.1|891530_893513_+	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_015572714.1|893606_894887_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_022647097.1|895064_896465_+	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_003856230.1|896550_896895_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
WP_003856227.1|896952_897576_-	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_023305464.1|897599_898409_-	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
WP_003856223.1|898401_899100_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_023299363.1|899182_900697_+	dGTPase	NA	NA	NA	NA	NA
WP_022647101.1|900829_902263_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	2.5e-26
WP_024551180.1|903564_904407_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_024551181.1|904393_906517_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001049182.1|906516_907965_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000780222.1|910508_910790_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|910770_911100_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	43.1	3.1e-17
WP_001572362.1|912145_913168_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001572363.1|913321_914026_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_129541466.1|913971_914157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077909719.1|914918_915944_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001572368.1|916137_916806_+	response regulator	NA	NA	NA	NA	NA
WP_001572371.1|916781_918131_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_001572372.1|918343_918820_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_151884334.1|920962_922309_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	1.4e-18
WP_000723070.1|922526_922961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572377.1|923218_924334_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019951.1|924456_924729_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_022647102.1|925398_925788_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_023299365.1|925899_926724_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_151884335.1|926756_929432_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_022647104.1|929494_930289_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_022647105.1|930610_931336_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_015572722.1|931453_932305_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_008501910.1|932454_933180_+	UMP kinase	NA	NA	NA	NA	NA
WP_003856180.1|933347_933905_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_023305466.1|933997_935197_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003856176.1|935382_936141_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	43.0	1.4e-25
WP_003856175.1|936153_937011_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_022647108.1|937022_938375_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 2
NZ_CP042571	Enterobacter hormaechei strain E5 chromosome, complete genome	4841070	1003446	1059846	4841070	terminase,lysis,head,transposase,integrase,holin	Erwinia_phage(33.85%)	78	1001672:1001687	1014226:1014241
1001672:1001687	attL	CTCGACGCTGGTGCGT	NA	NA	NA	NA
WP_022647150.1|1003446_1004499_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.8	6.5e-117
WP_015571369.1|1004804_1005908_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.0e-59
WP_023305491.1|1005919_1007173_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	5.2e-97
WP_151884337.1|1007374_1008535_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P7R5	Enterobacteria_phage	93.0	4.4e-215
WP_121909785.1|1008871_1009057_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	54.2	3.1e-06
WP_121909787.1|1009066_1009306_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	51.3	1.3e-12
WP_151884338.1|1009268_1009961_-	AP2 domain-containing protein	NA	A0A2I7R856	Vibrio_phage	47.3	8.5e-33
WP_058677899.1|1010180_1010690_-	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	49.4	1.7e-38
WP_121909545.1|1010795_1011296_-	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	51.4	1.2e-33
WP_121909543.1|1011292_1011484_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	67.8	1.9e-14
WP_121909541.1|1011480_1012092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121909539.1|1012088_1012307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121909537.1|1012303_1012963_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	92.2	7.9e-121
WP_121909535.1|1012959_1013112_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	1.3e-05
WP_121909533.1|1013111_1013333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121909531.1|1013358_1013802_-	single-stranded DNA-binding protein	NA	A0A2H4JHK3	uncultured_Caudovirales_phage	66.0	8.1e-45
WP_045281528.1|1013802_1014429_-	single-stranded DNA-binding protein	NA	A0A1W6JP21	Morganella_phage	61.3	1.1e-63
1014226:1014241	attR	CTCGACGCTGGTGCGT	NA	NA	NA	NA
WP_032667076.1|1014580_1014778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121909529.1|1014786_1015758_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	83.7	2.1e-69
WP_048982909.1|1015828_1016038_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	94.2	8.8e-34
WP_121909082.1|1016189_1016405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121909527.1|1016554_1016839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101731567.1|1017595_1017799_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	97.0	1.6e-27
WP_006809782.1|1018001_1018481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006809781.1|1018477_1019095_-	type II toxin-antitoxin system MqsA family antitoxin	NA	NA	NA	NA	NA
WP_121909526.1|1019652_1020294_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	77.3	3.6e-94
WP_032676295.1|1020397_1020613_+	helix-turn-helix transcriptional regulator	NA	K7PMD5	Enterobacterial_phage	81.7	1.7e-27
WP_121909524.1|1020643_1021189_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	96.7	3.1e-94
WP_048982990.1|1021417_1022314_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	59.8	9.8e-98
WP_121909522.1|1022303_1023737_+	AAA family ATPase	NA	Q716D2	Shigella_phage	85.8	1.5e-228
WP_121909520.1|1023736_1024081_+	helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	95.6	3.6e-56
WP_032668708.1|1024077_1024374_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	63.0	5.4e-29
WP_121909518.1|1024370_1024766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058647156.1|1025464_1025719_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	43.9	6.5e-07
WP_121909516.1|1025945_1026383_+	recombination protein NinB	NA	G8C7V3	Escherichia_phage	69.0	1.6e-53
WP_121909514.1|1026379_1026550_+	NinE family protein	NA	G8C7V4	Escherichia_phage	81.8	2.9e-19
WP_058655838.1|1026542_1026833_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	8.2e-46
WP_121909512.1|1026829_1027192_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	81.5	6.2e-51
WP_096216938.1|1027188_1027305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121909510.1|1027301_1027979_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.9	2.0e-55
WP_121909509.1|1027975_1028461_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	55.1	2.3e-40
WP_121909507.1|1028650_1028893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122008274.1|1029197_1029503_+|holin	holin	holin	E7C9S8	Salmonella_phage	86.1	1.1e-43
WP_121909505.1|1029489_1029933_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	69.6	3.2e-49
WP_048962428.1|1029929_1030418_+	HNH endonuclease	NA	A0A0K1YA40	Cronobacter_phage	41.5	2.5e-23
WP_121909503.1|1030414_1030888_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	61.1	1.1e-39
WP_121909501.1|1031092_1031638_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	66.1	3.0e-57
WP_063867260.1|1031745_1032321_+|terminase	terminase small subunit	terminase	A0A2R3UAN5	Myoviridae_environmental_samples	45.1	1.5e-38
WP_151884339.1|1032307_1033648_+|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	57.2	8.8e-143
WP_072058795.1|1034343_1035867_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	3.0e-46
WP_151884340.1|1036160_1036571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115168460.1|1038408_1039215_+|head	phage head morphogenesis protein	head	E5AGA5	Erwinia_phage	63.9	1.7e-96
WP_121909608.1|1039227_1040328_+	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	62.5	2.3e-125
WP_121909606.1|1040327_1040837_+	hypothetical protein	NA	E5AGA7	Erwinia_phage	72.6	9.6e-58
WP_111962745.1|1040846_1041785_+	DUF2184 domain-containing protein	NA	E5AGA8	Erwinia_phage	76.0	9.8e-133
WP_115168463.1|1041817_1042021_+	hypothetical protein	NA	E5AGA9	Erwinia_phage	71.6	5.0e-18
WP_121909604.1|1042020_1042428_+	DUF4054 domain-containing protein	NA	E5AGB0	Erwinia_phage	73.9	1.8e-51
WP_115168531.1|1042418_1042880_+	hypothetical protein	NA	E5AGB1	Erwinia_phage	64.7	1.8e-50
WP_121909602.1|1042876_1043224_+	hypothetical protein	NA	E5AGB2	Erwinia_phage	82.3	5.5e-49
WP_121909600.1|1043216_1043756_+	hypothetical protein	NA	E5AGB3	Erwinia_phage	67.6	1.2e-66
WP_151884341.1|1043775_1045116_+	DUF3383 family protein	NA	E5AGB4	Erwinia_phage	76.2	1.0e-191
WP_121909596.1|1045118_1045565_+	DUF3277 family protein	NA	E5AGB5	Erwinia_phage	74.3	2.9e-58
WP_121909594.1|1045601_1046039_+	hypothetical protein	NA	E5AGB6	Erwinia_phage	69.1	1.0e-47
WP_151884342.1|1046200_1047772_+	tape measure protein	NA	E5AGB7	Erwinia_phage	52.2	8.7e-142
WP_063948569.1|1047773_1048490_+	hypothetical protein	NA	E5AGB8	Erwinia_phage	73.0	1.1e-91
WP_047722018.1|1048486_1048828_+	hypothetical protein	NA	E5AGB9	Erwinia_phage	79.6	9.0e-52
WP_006809746.1|1048802_1049738_+	hypothetical protein	NA	E5AGC0	Erwinia_phage	89.7	1.8e-155
WP_063867301.1|1049737_1050412_+	hypothetical protein	NA	E5AGC1	Erwinia_phage	83.5	3.9e-107
WP_063867303.1|1050411_1050753_+	hypothetical protein	NA	E5AGC2	Erwinia_phage	76.1	1.1e-46
WP_063867305.1|1050818_1052237_+	hypothetical protein	NA	E5AGC3	Erwinia_phage	78.0	3.1e-207
WP_115168469.1|1052214_1052985_+	hypothetical protein	NA	E5AGC4	Erwinia_phage	76.6	5.4e-105
WP_115168470.1|1052993_1053230_+	phosphoglycolate phosphatase	NA	E5AGC5	Erwinia_phage	81.6	2.5e-29
WP_074173857.1|1053229_1053871_+	hypothetical protein	NA	E5AGC6	Erwinia_phage	42.5	1.6e-41
WP_089617520.1|1054567_1055774_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
WP_151884343.1|1055795_1057007_+	hypothetical protein	NA	A0A0A6Z575	Enterobacter_phage	91.7	2.8e-225
WP_032621356.1|1057094_1058573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115168471.1|1058569_1059487_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	89.5	3.9e-158
WP_063867320.1|1059483_1059846_-	GtrA family protein	NA	U5P0S6	Shigella_phage	55.1	1.9e-28
>prophage 3
NZ_CP042571	Enterobacter hormaechei strain E5 chromosome, complete genome	4841070	2154389	2167854	4841070	transposase	Morganella_phage(33.33%)	13	NA	NA
WP_063160311.1|2154389_2155853_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.1	1.6e-44
WP_003857405.1|2155897_2156101_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	56.7	4.4e-14
WP_023300013.1|2156388_2156820_+	hypothetical protein	NA	A0A1W6JNV4	Morganella_phage	35.2	1.5e-16
WP_003857403.1|2156854_2157541_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023306120.1|2157631_2158378_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_023306121.1|2158521_2160555_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	22.4	3.8e-20
WP_071788017.1|2161945_2162173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022647994.1|2162735_2162954_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	62.7	8.3e-19
WP_023306122.1|2163321_2164011_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.5	1.7e-81
WP_006808847.1|2164274_2164514_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	91.1	1.5e-32
WP_121909833.1|2164648_2165869_+|transposase	ISL3-like element ISCfr12 family transposase	transposase	NA	NA	NA	NA
WP_022647996.1|2166164_2166584_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	7.2e-35
WP_032671166.1|2166585_2167854_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	90.8	1.6e-226
>prophage 4
NZ_CP042571	Enterobacter hormaechei strain E5 chromosome, complete genome	4841070	2325975	2375743	4841070	protease,plate,transposase,head,integrase,tail	Vibrio_phage(63.89%)	58	2345636:2345650	2380255:2380269
WP_023300106.1|2325975_2326620_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_032671190.1|2326634_2327888_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_064365549.1|2329862_2330426_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_049090873.1|2330607_2330832_+	transcriptional regulator	NA	M1PVU4	Vibrio_phage	57.1	1.5e-15
WP_064365548.1|2330834_2332928_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2D1GNK9	Pseudomonas_phage	51.0	1.7e-185
WP_049123489.1|2332964_2333912_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	79.7	9.9e-141
WP_049123491.1|2333916_2334156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004114541.1|2334158_2334446_+	HTH domain-containing protein	NA	C9DGL7	Escherichia_phage	48.3	3.5e-17
WP_049128787.1|2334461_2335079_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	60.4	3.4e-65
WP_064365547.1|2335159_2335657_+	hypothetical protein	NA	A0A0A7RUP4	Clostridium_phage	36.0	1.9e-05
WP_049128789.1|2335649_2335955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064365546.1|2336072_2336627_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	47.2	6.4e-39
WP_004114552.1|2336623_2337022_+	hypothetical protein	NA	A0A0C4UR27	Shigella_phage	63.3	3.9e-38
WP_004114554.1|2337027_2337351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064355297.1|2337454_2338033_+	peptidoglycan-binding protein	NA	A0A2I7S9B9	Vibrio_phage	47.1	3.5e-40
WP_004114558.1|2338035_2338254_+	hypothetical protein	NA	A0A0C4UQR6	Shigella_phage	69.4	5.0e-24
WP_004114560.1|2338246_2338654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064365545.1|2338641_2339247_+	hypothetical protein	NA	M4MB79	Vibrio_phage	39.8	1.2e-22
WP_023301739.1|2339243_2339474_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_023301738.1|2339454_2339757_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	41.5	5.6e-13
WP_064365544.1|2339766_2340054_+	ArsR family transcriptional regulator	NA	A0A2I7S9D8	Vibrio_phage	64.5	8.4e-27
WP_077266338.1|2340053_2340341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064365542.1|2340330_2340906_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	59.4	9.8e-51
WP_064365541.1|2340902_2342492_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	68.5	2.1e-199
WP_098140143.1|2342491_2344063_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	56.0	1.0e-158
WP_064365539.1|2344055_2344898_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	57.5	1.6e-89
WP_098140142.1|2345086_2346103_+	peptidase	NA	M1Q578	Vibrio_phage	49.7	8.6e-74
2345636:2345650	attL	CTGGGGCTGGCTGAG	NA	NA	NA	NA
WP_019704461.1|2346105_2347008_+|head	head protein	head	M4MB71	Vibrio_phage	61.2	1.0e-102
WP_064365552.1|2347230_2347704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064365538.1|2347703_2348144_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.3	5.4e-33
WP_064365537.1|2348143_2348686_+	phage morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	64.2	3.8e-60
WP_064365536.1|2348682_2349294_+	hypothetical protein	NA	M1PJ94	Vibrio_phage	40.3	2.7e-38
WP_064365535.1|2349296_2349506_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_064365534.1|2349507_2350989_+|tail	phage tail protein	tail	M1Q565	Vibrio_phage	59.8	1.2e-164
WP_049138388.1|2350998_2351352_+|tail	Mu phage tail tube protein GpM	tail	NA	NA	NA	NA
WP_064365533.1|2351355_2351739_+	hypothetical protein	NA	A0A0C4UR03	Shigella_phage	46.2	1.2e-12
WP_064365532.1|2351837_2353634_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	32.1	7.3e-68
WP_064365531.1|2353633_2354890_+	multidrug DMT transporter	NA	A0A2I7S9E8	Vibrio_phage	42.0	7.6e-88
WP_064365530.1|2354882_2355968_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	48.1	1.3e-91
WP_064365529.1|2355958_2356498_+|plate	phage baseplate assembly protein V	plate	A0A2I7S9F6	Vibrio_phage	45.5	3.3e-32
WP_049128811.1|2356494_2356947_+	hypothetical protein	NA	A0A2I7S9F0	Vibrio_phage	42.8	1.5e-25
WP_151884363.1|2356933_2358010_+|plate	phage baseplate protein	plate	A0A2I7S9E5	Vibrio_phage	52.8	1.4e-103
WP_016807443.1|2357994_2358579_+	YmfQ family protein	NA	M4M9M8	Vibrio_phage	48.2	2.2e-45
WP_151884364.1|2358581_2359337_+|tail	tail fiber protein	tail	A9DEM1	Yersinia_phage	46.8	9.6e-30
WP_151884365.1|2359336_2360212_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	37.9	2.9e-22
WP_151884425.1|2360551_2362033_+	hypothetical protein	NA	A0A0C5Q3X6	Klebsiella_phage	37.4	8.1e-57
WP_023306202.1|2363124_2364120_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023300109.1|2364164_2364905_+	response regulator	NA	NA	NA	NA	NA
WP_023306204.1|2364901_2366197_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.2	1.2e-14
WP_023306205.1|2366332_2367523_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_023306206.1|2367529_2368288_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_023306207.1|2368372_2368957_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_063160026.1|2369043_2369802_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_023306209.1|2369906_2371199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151884426.1|2371343_2371427_-	helicase subunit	NA	NA	NA	NA	NA
WP_089617520.1|2371730_2372937_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
WP_039273870.1|2373333_2374200_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_151884366.1|2374192_2375743_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2380255:2380269	attR	CTCAGCCAGCCCCAG	NA	NA	NA	NA
>prophage 5
NZ_CP042571	Enterobacter hormaechei strain E5 chromosome, complete genome	4841070	2538361	2572206	4841070	transposase,tRNA,plate	Escherichia_phage(45.45%)	32	NA	NA
WP_001186974.1|2538361_2539297_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.9	2.2e-140
WP_023306362.1|2539340_2540714_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.1	1.2e-51
WP_023306364.1|2541199_2542183_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_022648264.1|2542273_2543404_-	methyl-accepting chemotaxis sensory transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.6	5.7e-10
WP_023306365.1|2543716_2544205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023306366.1|2544230_2545562_-	type VI secretion system protein VasL	NA	NA	NA	NA	NA
WP_022648267.1|2545585_2546041_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001067855.1|2546793_2547498_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_151884372.1|2547443_2547656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019951.1|2547778_2548051_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001067855.1|2549491_2550196_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001277461.1|2550207_2550516_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000281124.1|2550533_2552216_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.0	7.4e-38
WP_000523860.1|2552254_2552662_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732277.1|2552689_2552971_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294665.1|2552986_2553337_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000429724.1|2553408_2553864_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001288432.1|2554301_2555735_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_005012528.1|2555768_2556983_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_087878614.1|2557023_2557242_-	resolvase	NA	NA	NA	NA	NA
WP_001389365.1|2557283_2558048_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_151884373.1|2558135_2558249_+	NTP-binding protein	NA	NA	NA	NA	NA
WP_000376623.1|2558554_2559055_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001993321.1|2559073_2559253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|2559182_2560022_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2560015_2560363_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001209508.1|2560526_2561318_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_001067855.1|2562197_2562902_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_010129448.1|2567317_2567902_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_006788198.1|2567898_2568498_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_010129663.1|2568507_2569395_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_151884374.1|2571234_2572206_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	92.9	1.6e-173
>prophage 6
NZ_CP042571	Enterobacter hormaechei strain E5 chromosome, complete genome	4841070	2583104	2644111	4841070	transposase	uncultured_Caudovirales_phage(50.0%)	49	NA	NA
WP_004182106.1|2583104_2584028_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	7.3e-173
WP_004182108.1|2584557_2586732_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_004182109.1|2586734_2589311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151884375.1|2590011_2590344_+	metalloregulator ArsR/SmtB family transcription factor	NA	NA	NA	NA	NA
WP_004118521.1|2590340_2591063_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.0	1.5e-96
WP_001549888.1|2591120_2591549_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_001549887.1|2591598_2592882_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549886.1|2592977_2593331_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549885.1|2593814_2595293_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_004118529.1|2595311_2596139_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.3	4.9e-51
WP_001549953.1|2596210_2597407_-	MFS transporter	NA	NA	NA	NA	NA
WP_004118534.1|2597935_2598310_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_011977829.1|2598584_2599733_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_004118538.1|2600086_2600419_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_001067855.1|2601075_2601780_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_073545150.1|2601947_2602478_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_151884429.1|2602474_2602792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081374866.1|2602822_2605267_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_073545156.1|2605263_2605977_-	DsbC family protein	NA	NA	NA	NA	NA
WP_151884376.1|2606144_2611592_-	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_151884377.1|2611780_2617267_-	DUF4165 domain-containing protein	NA	NA	NA	NA	NA
WP_011899402.1|2617448_2617847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011899401.1|2617865_2618432_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_139027009.1|2618428_2619748_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_059119365.1|2619750_2620656_-	conjugal transfer protein TraK	NA	NA	NA	NA	NA
WP_011899399.1|2620639_2621275_-	sex pilus assembly	NA	NA	NA	NA	NA
WP_011899398.1|2621271_2621553_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_011899397.1|2622094_2622340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151884378.1|2622388_2622985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011899395.1|2623018_2623246_-	hypothetical protein	NA	A0A1I9KF72	Aeromonas_phage	67.2	2.1e-20
WP_024126910.1|2623436_2623844_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_024126909.1|2623939_2624836_+	cation transporter	NA	NA	NA	NA	NA
WP_004863699.1|2624839_2625352_+	signal peptidase II	NA	NA	NA	NA	NA
WP_123072386.1|2625373_2626705_+|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.2	8.3e-85
WP_123072385.1|2626692_2627640_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	2.3e-41
WP_151884379.1|2627730_2628153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089617520.1|2628670_2629878_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
WP_151884380.1|2629966_2630551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043774535.1|2630647_2631040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011899405.1|2631185_2631815_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_011899406.1|2631771_2632356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011899407.1|2632366_2634232_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_151884430.1|2634234_2637255_-	conjugal transfer protein TraI	NA	NA	NA	NA	NA
WP_011899409.1|2637438_2638053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043774467.1|2638034_2638250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011899410.1|2638249_2640445_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.0	6.9e-44
WP_050804917.1|2640459_2640783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103244595.1|2641155_2642585_-|transposase	IS66-like element ISAeme23 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|2643406_2644111_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 7
NZ_CP042571	Enterobacter hormaechei strain E5 chromosome, complete genome	4841070	3087076	3098676	4841070	transposase	Escherichia_phage(25.0%)	11	NA	NA
WP_023306572.1|3087076_3088513_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	31.4	3.7e-54
WP_022651482.1|3088516_3089740_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_072201098.1|3089736_3090216_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_015572377.1|3090218_3091184_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.6	1.4e-86
WP_003863514.1|3091186_3092308_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	66.3	2.4e-133
WP_151884387.1|3092773_3092962_+	hypothetical protein	NA	Q71TE9	Escherichia_phage	96.5	2.7e-26
WP_151884388.1|3092995_3093692_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	97.0	1.7e-129
WP_023306574.1|3093813_3095397_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.9	8.2e-39
WP_023306575.1|3095487_3097338_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_006811250.1|3097361_3097943_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	43.2	1.9e-33
WP_000130320.1|3098034_3098676_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	1.7e-35
>prophage 8
NZ_CP042571	Enterobacter hormaechei strain E5 chromosome, complete genome	4841070	3575171	3600184	4841070	holin,capsid,terminase,portal	Enterobacteria_phage(26.67%)	36	NA	NA
WP_032671401.1|3575171_3576140_-	hypothetical protein	NA	G1CSU0	Cronobacter_virus	41.1	1.3e-55
WP_023306746.1|3576143_3577751_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	68.9	3.7e-212
WP_023306747.1|3577797_3579024_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	87.2	2.3e-129
WP_023306748.1|3579037_3580342_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	93.8	8.1e-234
WP_105322832.1|3580341_3582078_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.7	0.0e+00
WP_022650844.1|3582077_3582551_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	98.7	2.3e-85
WP_047353046.1|3582708_3583059_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	82.8	2.4e-52
WP_032671403.1|3583058_3583649_-	hypothetical protein	NA	S4TR53	Salmonella_phage	84.1	1.0e-95
WP_023305918.1|3583814_3584072_+	hypothetical protein	NA	K7P7V5	Enterobacteria_phage	95.1	2.7e-32
WP_023306752.1|3584372_3585830_-	hypothetical protein	NA	K7PKP3	Enterobacterial_phage	92.8	1.2e-273
WP_032671404.1|3586020_3586311_+	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	62.9	6.3e-30
WP_032671652.1|3586421_3586706_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	67.0	1.1e-26
WP_096216658.1|3586772_3586955_-	hypothetical protein	NA	K7PM01	Enterobacterial_phage	83.7	2.1e-15
WP_023306755.1|3586992_3587613_-	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	42.7	9.6e-44
WP_023306756.1|3587622_3587892_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	90.8	4.8e-32
WP_023306757.1|3587899_3588529_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	97.6	1.4e-114
WP_023306758.1|3588528_3588807_-|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	87.4	9.6e-36
WP_023306759.1|3588796_3589186_-	phage membrane protein	NA	G8C7V8	Escherichia_phage	94.5	2.3e-59
WP_105322835.1|3589266_3589494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015570940.1|3589540_3590026_-	HNH endonuclease	NA	C4ML56	Xanthomonas_virus	42.7	1.5e-23
WP_023306760.1|3590320_3591103_-	antitermination protein	NA	F1C595	Cronobacter_phage	79.1	9.4e-113
WP_023306761.1|3591099_3591411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000186531.1|3591412_3593284_-	AAA family ATPase	NA	K7PK08	Enterobacteria_phage	61.3	4.5e-230
WP_023306764.1|3593387_3594410_-	hypothetical protein	NA	V5URT9	Shigella_phage	55.6	4.0e-47
WP_023306765.1|3594402_3594612_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_024176468.1|3594613_3594838_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	59.7	1.3e-19
WP_023150198.1|3594950_3595649_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	62.5	3.0e-78
WP_006811077.1|3595850_3596282_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023306766.1|3596348_3596735_+	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	60.5	2.2e-38
WP_006811079.1|3596841_3597066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023296234.1|3597058_3597466_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	87.5	2.1e-47
WP_080346848.1|3597419_3598031_+	HNH endonuclease	NA	A0A2I7S010	Vibrio_phage	47.2	5.0e-37
WP_023306768.1|3598020_3598443_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	66.4	1.6e-45
WP_023306770.1|3598546_3598858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000050710.1|3598847_3599057_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	97.1	4.4e-33
WP_023306771.1|3599011_3600184_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	91.0	8.3e-206
>prophage 9
NZ_CP042571	Enterobacter hormaechei strain E5 chromosome, complete genome	4841070	4515739	4542087	4841070	transposase,integrase	Indivirus(33.33%)	22	4507920:4507934	4533520:4533534
4507920:4507934	attL	CCTGATAGCTGTTTA	NA	NA	NA	NA
WP_001324699.1|4515739_4517296_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001049180.1|4517336_4518785_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000351437.1|4518784_4520908_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000090707.1|4520894_4521737_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_057059999.1|4521879_4523082_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_022649706.1|4523310_4524810_+	inorganic phosphate transporter PitA	NA	NA	NA	NA	NA
WP_003861224.1|4524864_4525200_-	universal stress protein UspB	NA	NA	NA	NA	NA
WP_003861223.1|4525483_4525921_+	universal stress protein UspA	NA	NA	NA	NA	NA
WP_023307149.1|4526013_4526808_-	16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ	NA	NA	NA	NA	NA
WP_022649708.1|4526773_4528816_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	1.1e-46
WP_022649709.1|4529024_4529867_+	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_121909026.1|4529938_4531294_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_077944297.1|4531686_4533003_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_139152476.1|4533163_4534690_+	hypothetical protein	NA	NA	NA	NA	NA
4533520:4533534	attR	TAAACAGCTATCAGG	NA	NA	NA	NA
WP_053507538.1|4534714_4536838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053507539.1|4536834_4537269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089617520.1|4538082_4539290_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
WP_151884412.1|4539408_4539819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151884413.1|4539842_4540175_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151884414.1|4540273_4540825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151884415.1|4540821_4541049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|4541106_4542087_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
NZ_CP042572	Enterobacter hormaechei strain E5 plasmid pE5_001, complete sequence	167131	0	4498	167131	transposase	Mollivirus(50.0%)	5	NA	NA
WP_151884434.1|416_899_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_151884435.1|974_1721_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.5	5.4e-09
WP_151884436.1|1857_2460_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151884437.1|2471_2867_+	VOC family protein	NA	NA	NA	NA	NA
WP_151884438.1|3128_4498_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	68.7	3.8e-77
>prophage 2
NZ_CP042572	Enterobacter hormaechei strain E5 plasmid pE5_001, complete sequence	167131	16423	17179	167131		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_048280186.1|16423_17179_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.4	8.8e-07
>prophage 3
NZ_CP042572	Enterobacter hormaechei strain E5 plasmid pE5_001, complete sequence	167131	23494	30465	167131		Escherichia_phage(33.33%)	6	NA	NA
WP_046887047.1|23494_24469_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	45.2	6.1e-69
WP_151884455.1|24697_25129_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.0	2.5e-27
WP_151884456.1|25128_26400_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	62.1	2.2e-151
WP_151884457.1|26868_27837_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	63.8	1.5e-112
WP_080182917.1|27836_29003_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	93.8	2.7e-217
WP_082035750.1|29613_30465_-	protein RepA	NA	Q71TL8	Escherichia_phage	53.8	1.4e-77
>prophage 4
NZ_CP042572	Enterobacter hormaechei strain E5 plasmid pE5_001, complete sequence	167131	35164	42828	167131		Bacillus_phage(40.0%)	8	NA	NA
WP_019843161.1|35164_35887_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	26.3	7.1e-06
WP_151884461.1|36049_36334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141227298.1|36443_36689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151884462.1|37511_39338_+	AAA family ATPase	NA	E5E3R2	Burkholderia_phage	23.2	1.5e-12
WP_151884463.1|39509_39860_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	55.2	1.4e-20
WP_151884464.1|40008_40440_-	copper-binding protein	NA	NA	NA	NA	NA
WP_151884465.1|40676_42155_-	heavy metal sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.5	1.6e-28
WP_084884211.1|42147_42828_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.5	3.2e-32
>prophage 5
NZ_CP042572	Enterobacter hormaechei strain E5 plasmid pE5_001, complete sequence	167131	46179	53424	167131		Leptospira_phage(33.33%)	5	NA	NA
WP_151884467.1|46179_49326_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.6	1.0e-61
WP_000758233.1|49412_49853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151884468.1|49971_52425_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	34.6	6.0e-81
WP_000843500.1|52455_52653_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_151884469.1|52683_53424_-	peptidoglycan DD-metalloendopeptidase family protein	NA	E5G070	Clostridium_phage	33.3	8.0e-13
>prophage 6
NZ_CP042572	Enterobacter hormaechei strain E5 plasmid pE5_001, complete sequence	167131	58505	60583	167131		Bacillus_phage(100.0%)	2	NA	NA
WP_019843138.1|58505_59186_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.5	3.9e-30
WP_019843137.1|59182_60583_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.7	1.9e-18
>prophage 7
NZ_CP042572	Enterobacter hormaechei strain E5 plasmid pE5_001, complete sequence	167131	67241	67997	167131		Salmonella_phage(100.0%)	1	NA	NA
WP_141227277.1|67241_67997_-	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	40.7	3.9e-39
>prophage 8
NZ_CP042572	Enterobacter hormaechei strain E5 plasmid pE5_001, complete sequence	167131	84810	93738	167131	protease	Acinetobacter_phage(33.33%)	10	NA	NA
WP_112823618.1|84810_85890_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.1e-38
WP_141227268.1|85891_86665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141227267.1|86657_87800_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	35.8	4.5e-31
WP_151884482.1|87809_88868_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
WP_141227265.1|89187_89769_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	1.8e-12
WP_151884483.1|89768_90926_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_141227263.1|90948_91404_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|91426_92467_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_015062976.1|92515_93094_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	1.5e-06
WP_151884484.1|93162_93738_+	chemical-damaging agent resistance protein C	NA	K4JRX3	Caulobacter_phage	40.6	5.6e-30
>prophage 9
NZ_CP042572	Enterobacter hormaechei strain E5 plasmid pE5_001, complete sequence	167131	96740	97721	167131	integrase	Virus_Rctr85(100.0%)	1	86822:86835	109346:109359
86822:86835	attL	CCGTAAAGGAAATG	NA	NA	NA	NA
WP_151884486.1|96740_97721_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	39.6	7.1e-49
WP_151884486.1|96740_97721_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	39.6	7.1e-49
109346:109359	attR	CATTTCCTTTACGG	NA	NA	NA	NA
>prophage 10
NZ_CP042572	Enterobacter hormaechei strain E5 plasmid pE5_001, complete sequence	167131	127484	127808	167131		Yersinia_phage(100.0%)	1	NA	NA
WP_151884505.1|127484_127808_-	hypothetical protein	NA	Q7Y3W7	Yersinia_phage	46.5	7.8e-21
>prophage 11
NZ_CP042572	Enterobacter hormaechei strain E5 plasmid pE5_001, complete sequence	167131	142292	145420	167131		Serratia_phage(50.0%)	4	NA	NA
WP_151884517.1|142292_143114_-	DUF932 domain-containing protein	NA	A0A1S6UA20	Serratia_phage	40.0	5.5e-47
WP_151884518.1|143125_143419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151884519.1|144239_144575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151884520.1|144619_145420_-	N-6 DNA methylase	NA	H7BVT3	unidentified_phage	34.3	9.6e-12
>prophage 12
NZ_CP042572	Enterobacter hormaechei strain E5 plasmid pE5_001, complete sequence	167131	150687	153015	167131		Mycobacterium_phage(50.0%)	3	NA	NA
WP_151884527.1|150687_151851_+	alpha/beta fold hydrolase	NA	A0A1J0GNR5	Mycobacterium_phage	30.6	5.0e-09
WP_004187025.1|152492_152741_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_004187019.1|152730_153015_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	55.9	6.4e-19
>prophage 13
NZ_CP042572	Enterobacter hormaechei strain E5 plasmid pE5_001, complete sequence	167131	164507	165251	167131		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_151884537.1|164507_165251_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	1.5e-14
>prophage 1
NZ_CP042573	Enterobacter hormaechei strain E5 plasmid pE5_002, complete sequence	114054	0	113310	114054	terminase,integrase,tail,transposase	Salmonella_phage(93.04%)	133	1058:1080	113933:113955
WP_001293470.1|0_1056_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
1058:1080	attL	CCAACCACTGTAGAGAGTAGAAA	NA	NA	NA	NA
WP_006812558.1|1624_1837_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	98.6	3.1e-34
WP_004110033.1|1836_2172_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	99.1	1.6e-56
WP_004110036.1|2168_2348_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	98.3	7.3e-21
WP_032666376.1|2388_2664_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	1.2e-46
WP_006812560.1|2732_3143_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	7.0e-75
WP_004110046.1|3126_3498_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	99.2	1.0e-69
WP_004110049.1|3660_4491_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	99.3	1.1e-127
WP_000589750.1|4494_4695_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	93.9	9.3e-25
WP_121909553.1|4785_5862_-	recombinase	NA	J9Q736	Salmonella_phage	99.4	2.1e-203
WP_000920226.1|5864_6131_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_032666374.1|6130_7075_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	3.4e-181
WP_004110098.1|7135_8164_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	99.7	1.3e-165
WP_000102109.1|8283_8715_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
WP_006812563.1|8969_9194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006812564.1|9273_9837_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	67.7	1.8e-65
WP_002213143.1|9866_10310_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.8e-72
WP_006812565.1|10306_13825_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.5	0.0e+00
WP_016051657.1|13799_14003_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	100.0	5.5e-33
WP_004110112.1|14005_15241_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.3	2.3e-238
WP_006812566.1|15337_17704_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.5	0.0e+00
WP_004110118.1|17813_18026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004110129.1|18289_18676_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_023315967.1|18667_19774_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.6	5.6e-26
WP_006812568.1|19947_20364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006812569.1|20354_20879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006812570.1|20975_21221_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	1.0e-12
WP_006812571.1|21220_21586_-	hypothetical protein	NA	K7PH35	Enterobacteria_phage	66.4	5.1e-37
WP_022649890.1|21601_21805_-	hypothetical protein	NA	A0A2P1CDD4	Klebsiella_phage	50.7	5.6e-09
WP_006812573.1|21815_22649_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	63.6	2.3e-88
WP_000067984.1|23830_24136_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
WP_000427623.1|24499_25504_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_003100847.1|25582_26140_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|26133_26505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|26501_27002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006812576.1|26998_27325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003465043.1|27579_27936_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|27925_28327_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|28323_28614_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000427623.1|31735_32740_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_086623619.1|33084_33291_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	4.0e-31
WP_000901956.1|33280_33457_-	hypothetical protein	NA	J9Q729	Salmonella_phage	96.6	2.6e-23
WP_006812578.1|33456_34779_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.9	1.8e-257
WP_032666393.1|34813_35071_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	96.5	4.4e-35
WP_071850084.1|34990_35323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006812580.1|35371_36166_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	2.9e-141
WP_080112989.1|36246_37458_-	DNA primase	NA	J9Q720	Salmonella_phage	97.3	4.6e-215
WP_121909366.1|37520_38861_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.6	1.7e-247
WP_151884546.1|38921_39647_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.8	1.9e-139
WP_006812584.1|39910_40708_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	26.4	5.6e-12
WP_006812585.1|40749_41109_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
WP_023315962.1|41108_41774_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	95.0	4.7e-113
WP_006812497.1|42140_42410_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_006812498.1|42413_42938_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077929498.1|42964_43306_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	80.6	6.9e-28
WP_006812500.1|43374_44067_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	96.1	3.9e-126
WP_000064173.1|44080_44404_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	92.5	1.4e-46
WP_032655902.1|44478_45267_-	receptor-recognizing protein	NA	E5DHZ0	Enterobacter_phage	63.5	6.7e-58
WP_023316019.1|49595_50213_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.0e-29
WP_077929497.1|50230_54868_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.8	0.0e+00
WP_032655906.1|54883_55471_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	91.8	3.3e-102
WP_006812507.1|55467_56256_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	96.2	2.5e-153
WP_006812508.1|56248_56980_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	100.0	3.9e-137
WP_000440566.1|57036_57372_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
WP_032674184.1|57413_61985_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.3	0.0e+00
WP_002228782.1|61992_62262_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
WP_000163862.1|62342_62660_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_006812510.1|62719_63466_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.4	6.8e-129
WP_000469441.1|63540_63924_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
WP_006812511.1|63925_64399_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	3.4e-81
WP_001027662.1|64389_64734_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_000057119.1|64831_65665_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
WP_006812512.1|65664_66099_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	6.2e-74
WP_006812513.1|66142_67066_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	99.7	7.4e-157
WP_006812514.1|67140_68016_-	hypothetical protein	NA	J9Q710	Salmonella_phage	99.3	4.2e-162
WP_006812515.1|68042_68939_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	98.7	1.2e-148
WP_006812516.1|68954_70535_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	6.2e-297
WP_002211787.1|70568_71825_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_006812517.1|71827_72469_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	98.1	3.4e-108
WP_006812518.1|72664_72931_-	hypothetical protein	NA	J9Q757	Salmonella_phage	98.9	5.0e-42
WP_002228789.1|72940_73840_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	8.2e-169
WP_001113021.1|73836_74091_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
WP_006812519.1|74083_74722_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	99.5	1.1e-111
WP_006812520.1|74718_75387_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	98.6	9.5e-114
WP_006812521.1|75386_76085_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	98.7	5.6e-125
WP_006812522.1|76149_77709_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.6	4.4e-295
WP_001291547.1|77711_77990_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
WP_000683475.1|78049_78472_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
WP_006812523.1|78476_79004_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	99.3	2.6e-82
WP_006812524.1|79326_79977_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	9.2e-114
WP_006812525.1|80027_80231_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	98.5	4.8e-29
WP_006812526.1|80875_81358_-	hypothetical protein	NA	J9Q805	Salmonella_phage	97.5	2.5e-87
WP_086623617.1|81370_81604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006812528.1|81563_81851_-	hypothetical protein	NA	J9Q753	Salmonella_phage	98.9	1.6e-49
WP_006812529.1|81971_82367_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	66.2	2.0e-42
WP_006812530.1|82495_82807_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	97.1	1.2e-47
WP_000594283.1|82947_83166_-	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
WP_032655918.1|83170_83392_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	1.2e-33
WP_072643030.1|83534_83780_+	hypothetical protein	NA	J9Q751	Salmonella_phage	93.8	9.0e-38
WP_006812533.1|85214_86405_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.8	2.4e-120
WP_006812534.1|86543_87380_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_006812535.1|87463_87781_-	hypothetical protein	NA	J9Q750	Salmonella_phage	81.9	3.3e-48
WP_006812536.1|87865_88132_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	70.5	3.4e-30
WP_006812537.1|88318_88522_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	97.0	6.8e-31
WP_045328249.1|88577_89276_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	89.7	4.2e-112
WP_006812540.1|89821_90193_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	97.6	1.4e-61
WP_006812541.1|90195_90477_-	hypothetical protein	NA	J9Q801	Salmonella_phage	100.0	6.5e-48
WP_006812542.1|90473_91163_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	97.8	8.8e-123
WP_086623618.1|91221_92925_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	99.3	0.0e+00
WP_006812544.1|93048_93621_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	1.1e-97
WP_000462606.1|93729_94572_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
WP_000872126.1|94680_94869_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
WP_032666383.1|94878_95373_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	95.7	3.9e-80
WP_151884547.1|95515_96124_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	99.5	8.4e-117
WP_000262979.1|96718_96949_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
WP_004109976.1|97151_97745_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	100.0	2.1e-112
WP_006812547.1|97930_98857_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	92.9	6.3e-108
WP_000208226.1|98901_99459_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
WP_004109992.1|99468_99888_-	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	6.4e-68
WP_000386471.1|99951_100596_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
WP_000781812.1|100595_101072_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
WP_006812548.1|101068_101482_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
WP_006812549.1|101483_102599_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.6	6.9e-218
WP_032666380.1|102776_103646_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	98.6	1.0e-160
WP_002231164.1|103728_104871_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_006812551.1|104978_107294_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.9	0.0e+00
WP_002214145.1|107371_107941_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
WP_006812552.1|107952_108699_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.4	3.4e-136
WP_006812553.1|108688_110605_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.7	0.0e+00
WP_000107766.1|110601_110838_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
WP_006812554.1|110834_111920_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	98.6	5.9e-206
WP_004110023.1|112095_112590_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	98.2	7.8e-89
WP_006812555.1|112665_113310_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.6	6.3e-123
113933:113955	attR	CCAACCACTGTAGAGAGTAGAAA	NA	NA	NA	NA
>prophage 1
NZ_CP042574	Enterobacter hormaechei strain E5 plasmid pE5_003, complete sequence	86404	2110	35203	86404	protease,transposase,integrase	Escherichia_phage(37.5%)	38	1913:1972	21207:22161
1913:1972	attL	GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATC	NA	NA	NA	NA
WP_001067834.1|2110_2815_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_014344500.1|2848_3121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|3089_4103_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015060105.1|4255_4996_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_015063357.1|5227_5560_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_003159191.1|5686_6241_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|6335_6968_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000679427.1|7124_7472_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|7465_8305_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|8709_10251_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003833285.1|11557_12010_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_012695489.1|12051_12696_-	quinolone resistance pentapeptide repeat protein QnrB2	NA	NA	NA	NA	NA
WP_000259031.1|13186_14026_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|13955_14135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376616.1|14153_14357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|14512_15718_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|15728_16034_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|16049_16232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|16260_17025_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|17215_17572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|17517_18102_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|18101_19340_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|19336_20242_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067834.1|20363_21068_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000557454.1|21300_22161_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
21207:22161	attR	GATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTATAGTGTTTTGCAGTTTAGAGGAGATATCGCGATGCATACGCGGAAGGCAATAACGGAGGCGCTTCAAAAACTCGGAGTCCAAACCGGTGACCTCTTGATGGTGCATGCCTCACTTAAAGCGATTGGTCCGGTCGAAGGAGGAGCGGAGACGGTCGTTGCCGCGTTACGCTCCGCGGTTGGGCCGACTGGCACTGTGATGGGATACGCGTCGTGGGACCGATCACCCTACGAGGAGACTCTGAATGGCGCTCGGCTGGATGACGAAGCCCGCCGTACCTGGCTGCCGTTCGATCCCGCAACAGCCGGGACTTACCGTGGGTTCGGCCTGCTGAATCAATTTCTGGTTCAAGCCCCCGGCGCGCGGCGCAGCGCGCACCCCGATGCATCGATGGTCGCGGTTGGTCCGCTGGCTGAAACGCTGACGGAGCCTCACGAACTCGGTCACGCCTTGGGGGAAGGATCGCCCGTCGAGCGGTTCGTTCGCCTTGGCGGGAAGGCCCTGCTGTTGGGTGCGCCGCTAAACTCCGTTACCGCATTGCACTACGCCGAGGCGGTTGCCGATATCCCCAACAAACGGTGGGTGACGTATGAGATGCCGATGCTTGGAAGAGACGGTGAAGTCGCCTGGAAAACGGCATCGGATTACGATTCAAACGGCATTCTCGATTGCTTTGCTATCGAAGGAAAGCCGGATGCGGTTGAAACTATAGCAAATGCTTACGTGAAGCTCGGTCGCCATCGAGAAGGTGTCGTGGGCTTTGCTCAGTGCTACCTGTTCGACGCGCAGGACATCGTGACGTTCGGCGTCACCTATCTTGAGAAGCATTTCGGAACCACTCCGATCGTGCCTCCGCACGAGGCCGTCGAGCGCTCTTGCGAGCCTTCAGGTTAG	NA	NA	NA	NA
WP_000587837.1|22173_22716_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|23197_23389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|23394_23640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|23690_24827_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000971921.1|24941_26312_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|27132_27993_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_011091091.1|28661_29171_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011091092.1|29218_31306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012579091.1|31318_32269_-	DsbC family protein	NA	NA	NA	NA	NA
WP_045626305.1|32279_33542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077256341.1|33586_33862_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_045626302.1|34086_34470_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_011091025.1|34549_35203_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
