The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042517	Citrobacter freundii strain E33 chromosome, complete genome	5022915	956710	965129	5022915	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_119174400.1|956710_957658_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	5.4e-22
WP_119174399.1|957641_958373_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|958353_958461_-	protein YohO	NA	NA	NA	NA	NA
WP_003027351.1|958512_959244_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.0e-105
WP_003027348.1|959469_961155_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_003840155.1|961151_961871_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003027346.1|961917_962388_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
WP_003840158.1|962430_962889_-	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.1e-50
WP_003027344.1|963095_965129_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
>prophage 2
NZ_CP042517	Citrobacter freundii strain E33 chromosome, complete genome	5022915	1003375	1012953	5022915	protease	Bacillus_phage(28.57%)	8	NA	NA
WP_003840216.1|1003375_1005322_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.8	2.4e-40
WP_003036813.1|1005396_1005621_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|1005944_1006265_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036804.1|1006295_1008572_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_003844346.1|1008841_1010203_-	U32 family peptidase	NA	Q6DW11	Phage_TP	92.9	4.1e-204
WP_003036800.1|1010362_1010695_-	YegP family protein	NA	NA	NA	NA	NA
WP_128295744.1|1010830_1011553_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.4	6.0e-29
WP_003841761.1|1011549_1012953_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.6	3.9e-32
>prophage 3
NZ_CP042517	Citrobacter freundii strain E33 chromosome, complete genome	5022915	1054803	1061101	5022915		Enterobacteria_phage(66.67%)	6	NA	NA
WP_119174378.1|1054803_1056198_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	35.0	4.7e-22
WP_049002535.1|1056363_1057257_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.1	7.4e-45
WP_119174377.1|1057630_1058716_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	1.5e-100
WP_048218080.1|1058715_1059615_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.3	3.6e-31
WP_049002538.1|1059666_1060545_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	3.9e-107
WP_119174376.1|1060546_1061101_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	59.1	7.8e-53
>prophage 4
NZ_CP042517	Citrobacter freundii strain E33 chromosome, complete genome	5022915	1223526	1355955	5022915	holin,integrase,head,protease,terminase,tail,portal,capsid,tRNA	Salmonella_phage(28.7%)	167	1304822:1304849	1355135:1355162
WP_003034673.1|1223526_1225260_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	1.7e-85
WP_003034677.1|1225498_1226065_+	VOC family protein	NA	NA	NA	NA	NA
WP_032936856.1|1226067_1226814_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_003839177.1|1227057_1228026_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003034686.1|1228022_1228766_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	31.3	3.2e-25
WP_003034689.1|1228806_1229202_-	membrane protein	NA	NA	NA	NA	NA
WP_128295824.1|1229254_1230019_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	79.5	1.2e-56
WP_151532582.1|1230006_1231320_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	89.7	2.5e-235
WP_047500088.1|1231375_1231612_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	96.2	1.9e-40
WP_151532583.1|1231767_1232217_-	ATPase	NA	A0A1B5FPC7	Escherichia_phage	79.2	2.5e-25
WP_151532584.1|1232213_1232426_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	70.0	6.6e-21
WP_032652477.1|1232422_1232647_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	55.4	6.1e-17
WP_151532585.1|1232765_1233344_-	hypothetical protein	NA	A0A2I7QNC9	Vibrio_phage	28.5	1.4e-07
WP_151532586.1|1233354_1233933_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	58.3	4.7e-61
WP_151532587.1|1233929_1234337_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	47.8	5.5e-24
WP_151532588.1|1234506_1234701_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	79.7	1.7e-23
WP_088902161.1|1234758_1235115_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	48.7	1.6e-22
WP_088902162.1|1235214_1235505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050484865.1|1235566_1235812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088902163.1|1236140_1236818_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	76.3	4.3e-98
WP_088902164.1|1236961_1237222_+	Cro/Cl family transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	56.4	2.9e-18
WP_151532589.1|1238988_1239870_+	cell division protein ZapE	NA	Q8W641	Enterobacteria_phage	62.0	2.0e-79
WP_151532590.1|1239866_1241225_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	68.7	2.0e-174
WP_151532591.1|1241235_1241547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532592.1|1241628_1241976_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	86.7	8.8e-55
WP_151532593.1|1241988_1242375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532594.1|1242375_1242621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151641788.1|1242624_1243503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008323296.1|1244320_1244716_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	81.7	2.6e-50
WP_008323297.1|1244702_1244984_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	88.2	4.2e-39
WP_151532595.1|1244983_1245601_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	79.9	4.2e-92
WP_151532596.1|1245597_1246137_+	DUF2514 family protein	NA	A0A0A0P0G7	Enterobacteria_phage	52.9	8.7e-09
WP_151532597.1|1246261_1246990_+	Fur-regulated protein	NA	M9NZE9	Enterobacteria_phage	86.8	3.3e-112
WP_151532598.1|1247004_1247238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532599.1|1247225_1247576_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	79.3	7.8e-51
WP_151532600.1|1247732_1248206_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	89.2	1.7e-77
WP_151532601.1|1248205_1249963_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	90.8	0.0e+00
WP_038642109.1|1250110_1251337_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	86.5	9.0e-211
WP_085048946.1|1251329_1251929_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	83.0	7.8e-91
WP_151532602.1|1251938_1253156_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	75.1	1.7e-169
WP_038642103.1|1253233_1253554_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	53.9	2.8e-23
WP_038642100.1|1253563_1253902_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	69.6	2.3e-39
WP_149692066.1|1253898_1254348_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	85.2	1.4e-65
WP_065944737.1|1254344_1254692_+	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	76.5	1.7e-45
WP_151532603.1|1254749_1255454_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	73.5	3.7e-92
WP_151532604.1|1255481_1255871_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	84.5	1.2e-57
WP_016150477.1|1255879_1256158_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	93.5	2.6e-41
WP_151532605.1|1256161_1256503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532606.1|1256561_1260059_+|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	83.7	0.0e+00
WP_016150474.1|1260100_1260460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003841703.1|1260448_1260673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532607.1|1260838_1261432_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	95.4	5.3e-108
WP_151532608.1|1261431_1262016_+	hypothetical protein	NA	S4TND4	Salmonella_phage	96.9	2.7e-104
WP_151532609.1|1262022_1262421_+	hypothetical protein	NA	S4TR39	Salmonella_phage	90.9	8.0e-68
WP_151532610.1|1262420_1265132_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	90.5	0.0e+00
WP_151532611.1|1265131_1266076_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	67.1	3.7e-119
WP_151532612.1|1266085_1267411_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	52.4	1.5e-115
WP_151532613.1|1267546_1267789_-	DinI-like family protein	NA	Q6UAW0	Klebsiella_phage	75.3	2.9e-28
WP_151532614.1|1268109_1268499_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	70.5	3.3e-50
WP_151532615.1|1268499_1269168_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	2.6e-79
WP_101700564.1|1269292_1269409_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_003841685.1|1269490_1270057_-	hydrolase	NA	NA	NA	NA	NA
WP_100038939.1|1270013_1270250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003034862.1|1270323_1272096_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003844155.1|1272097_1272541_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_003034865.1|1272569_1273313_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003034867.1|1273347_1273869_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_003034869.1|1273949_1274561_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003034872.1|1274569_1275580_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.4	1.6e-08
WP_003034874.1|1275658_1276444_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_046671223.1|1276440_1277196_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	5.0e-18
WP_003844151.1|1277274_1278219_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_003034883.1|1278234_1279554_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_003841672.1|1279673_1280645_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_003034890.1|1280688_1282131_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_003034893.1|1282249_1283119_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003034896.1|1283486_1284962_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	8.3e-78
WP_119174331.1|1285195_1287007_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_003034901.1|1287041_1287683_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_071684720.1|1287750_1288929_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_003034906.1|1289060_1289351_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_003034909.1|1289472_1289826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049016040.1|1289920_1290580_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_119174330.1|1290642_1292721_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_003833802.1|1292711_1293374_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	31.1	9.1e-08
WP_003841657.1|1293397_1294054_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_003034925.1|1294160_1294391_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
WP_151532617.1|1294539_1296291_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	33.3	5.5e-44
WP_151532618.1|1296711_1297431_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_016151033.1|1297745_1298324_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	37.7	3.2e-17
WP_151532619.1|1298568_1300320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532620.1|1300880_1301267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137397182.1|1301429_1301783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115454751.1|1302076_1302322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115454752.1|1302512_1302722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003034928.1|1302978_1303353_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_032935389.1|1303356_1304229_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_003034934.1|1304249_1304588_+	YebY family protein	NA	NA	NA	NA	NA
1304822:1304849	attL	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
WP_001129310.1|1304924_1306010_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	69.0	1.1e-148
WP_151532621.1|1305978_1306251_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	64.4	3.2e-28
WP_001237028.1|1306314_1306557_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	91.1	1.0e-33
WP_151532622.1|1306543_1307251_-	hypothetical protein	NA	R9VWB9	Serratia_phage	60.7	1.9e-72
WP_151532623.1|1307243_1307588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532624.1|1307622_1308708_-	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	63.7	3.9e-125
WP_151532625.1|1308719_1311572_-	exodeoxyribonuclease VIII	NA	K7P6V4	Enterobacteria_phage	61.6	6.8e-302
WP_151532626.1|1311880_1312078_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_097728169.1|1312077_1312278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137398754.1|1312702_1312927_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	6.1e-17
WP_151532627.1|1312958_1313339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532686.1|1313422_1313695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532628.1|1313816_1314227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532687.1|1314357_1315080_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	55.1	1.7e-71
WP_016156713.1|1315148_1315376_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	53.5	1.2e-15
WP_151532629.1|1315406_1315946_+	regulator	NA	K7PJT7	Enterobacteria_phage	87.2	7.7e-82
WP_151532630.1|1316075_1317077_+	replication protein	NA	A5VW95	Enterobacteria_phage	71.7	1.7e-53
WP_151532631.1|1317073_1317769_+	phage replication protein	NA	G8C7U6	Escherichia_phage	47.0	2.5e-56
WP_151532632.1|1317783_1318095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054528489.1|1318705_1318918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054528488.1|1318914_1319238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054528487.1|1319241_1319517_+	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	87.1	1.8e-34
WP_151532633.1|1319513_1320170_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	44.7	9.9e-23
WP_019076919.1|1320604_1321204_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	96.5	8.5e-106
WP_071684428.1|1321203_1321410_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	70.6	8.1e-24
WP_119174318.1|1321412_1322000_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	63.4	9.1e-60
WP_000142505.1|1321996_1322134_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	86.0	2.7e-15
WP_119174317.1|1322130_1322820_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.1	9.9e-66
WP_119174316.1|1323458_1323899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119174315.1|1324107_1324296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568784.1|1324450_1324729_+|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
WP_151532634.1|1324700_1325249_+	glycoside hydrolase family protein	NA	K7PM52	Enterobacteria_phage	92.9	3.0e-97
WP_151532635.1|1325245_1325782_+	DUF2514 family protein	NA	A0A291LBG9	Klebsiella_phage	59.1	1.4e-11
WP_071684699.1|1325782_1325995_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_151532636.1|1326570_1327209_+	hypothetical protein	NA	I6S676	Salmonella_phage	91.0	1.5e-113
WP_023300389.1|1327240_1327696_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	82.0	1.4e-63
WP_125363636.1|1327692_1328946_+|terminase	PBSX family phage terminase large subunit	terminase	I6RSK1	Salmonella_phage	96.7	3.4e-213
WP_125363635.1|1329078_1330431_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	92.4	3.4e-243
WP_125363634.1|1330384_1331314_+|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	82.5	5.9e-138
WP_151532637.1|1331317_1332583_+	hypothetical protein	NA	A0A1V0E5Q9	Salmonella_phage	86.0	1.8e-206
WP_063933408.1|1332595_1333051_+	hypothetical protein	NA	G0ZND8	Cronobacter_phage	82.8	2.3e-63
WP_151532638.1|1333065_1334163_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	83.3	1.4e-178
WP_151532639.1|1334172_1334469_+	hypothetical protein	NA	G0ZNE0	Cronobacter_phage	70.4	9.6e-34
WP_054829867.1|1334528_1334930_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	92.5	4.0e-67
WP_151532640.1|1335103_1335340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125363628.1|1335343_1335706_+	hypothetical protein	NA	I6S1Q5	Salmonella_phage	90.8	2.7e-62
WP_151532641.1|1335793_1336231_+	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	95.9	6.3e-74
WP_151532642.1|1336227_1336614_+	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	91.4	2.0e-63
WP_151532643.1|1336631_1337369_+	hypothetical protein	NA	H6WRU1	Salmonella_phage	87.8	1.8e-118
WP_151532644.1|1337408_1338062_+	hypothetical protein	NA	A0A1V0E5Q0	Salmonella_phage	93.1	3.5e-113
WP_151532645.1|1338245_1338776_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	95.5	6.4e-89
WP_042889549.1|1338889_1339264_+	hypothetical protein	NA	H6WRV1	Salmonella_phage	98.4	9.2e-66
WP_045332252.1|1339256_1339559_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	98.0	1.1e-40
WP_151532646.1|1339629_1340271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532688.1|1340330_1343654_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	74.6	0.0e+00
WP_042889552.1|1343656_1344004_+|tail	phage tail protein	tail	I6RSL7	Salmonella_phage	91.3	1.5e-57
WP_125363623.1|1344013_1344304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532647.1|1344257_1344494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125363622.1|1344661_1345366_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	97.0	2.3e-134
WP_151532648.1|1345365_1346085_+|tail	phage tail protein	tail	Q5G8W2	Enterobacteria_phage	85.4	2.1e-127
WP_071697834.1|1346027_1346555_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	68.4	6.4e-57
WP_151532649.1|1346564_1349741_+	DUF1983 domain-containing protein	NA	H6WRW4	Salmonella_phage	91.0	0.0e+00
WP_151532650.1|1349740_1350685_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	67.4	2.5e-120
WP_151532651.1|1350694_1352020_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	52.4	5.9e-115
WP_000497432.1|1352155_1352398_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	3.4e-29
WP_008784491.1|1352475_1352895_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.1	6.1e-34
WP_054528461.1|1352896_1354165_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	81.0	2.1e-202
WP_151532652.1|1354157_1354829_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.5e-79
WP_128295755.1|1355313_1355955_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	3.9e-56
1355135:1355162	attR	ACAGGAATCGTATTCGGTCTCTTTTTAT	NA	NA	NA	NA
>prophage 5
NZ_CP042517	Citrobacter freundii strain E33 chromosome, complete genome	5022915	1999803	2009841	5022915	tRNA	Cedratvirus(14.29%)	10	NA	NA
WP_003836641.1|1999803_2000583_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	7.9e-11
WP_032935936.1|2000579_2002022_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
WP_003836643.1|2002083_2002797_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003836644.1|2003113_2003578_-	lipoprotein nlpC	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_003836645.1|2003655_2004405_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	7.1e-09
WP_003030569.1|2004404_2004956_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_119174168.1|2005016_2005997_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	5.1e-15
WP_003030571.1|2006150_2006450_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_003030574.1|2006454_2008842_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003832580.1|2008857_2009841_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
>prophage 6
NZ_CP042517	Citrobacter freundii strain E33 chromosome, complete genome	5022915	2108027	2113975	5022915		uncultured_Caudovirales_phage(57.14%)	8	NA	NA
WP_119174150.1|2108027_2108240_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	6.0e-22
WP_003030760.1|2108483_2108909_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
WP_119174149.1|2108921_2110211_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	69.7	4.6e-165
WP_003030762.1|2110255_2110576_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	3.2e-19
WP_008320415.1|2110661_2111360_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	3.8e-89
WP_003840850.1|2111747_2111990_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_003030767.1|2112079_2112589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003030769.1|2112724_2113975_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.4e-22
>prophage 7
NZ_CP042517	Citrobacter freundii strain E33 chromosome, complete genome	5022915	2549052	2574459	5022915	transposase,terminase,tail,capsid,portal	Vibrio_phage(42.86%)	27	NA	NA
WP_087893729.1|2549052_2550325_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
WP_128295738.1|2550801_2551449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119174076.1|2551756_2552437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119174703.1|2552526_2552724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119174075.1|2552828_2553080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119174074.1|2553093_2553753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119174073.1|2554015_2554309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128295839.1|2554305_2554632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001395480.1|2554985_2556017_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_151641790.1|2556032_2556347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119174070.1|2556328_2556763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119174069.1|2556804_2557257_+	glycoside hydrolase family protein	NA	H6X3N0	Enterobacteria_phage	47.9	1.7e-26
WP_119174068.1|2557286_2560310_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_119174067.1|2560309_2560690_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_119174066.1|2560689_2561313_-	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_119174065.1|2561312_2561876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119174064.1|2561923_2564089_-	hypothetical protein	NA	M4MA23	Vibrio_phage	25.0	2.6e-11
WP_051129226.1|2564075_2564438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119174063.1|2564470_2564752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119174062.1|2564807_2565272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119174061.1|2565328_2568082_-|tail	tail fiber domain-containing protein	tail	A0A2K8HQF3	Bacteriophage	42.7	4.8e-79
WP_119174060.1|2568091_2568490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119174059.1|2568486_2568798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119174058.1|2568807_2570634_-|capsid	phage major capsid protein	capsid	R9TPU0	Vibrio_phage	28.6	1.8e-29
WP_119174057.1|2570578_2572084_-|portal	phage portal protein	portal	Q75QM9	Wolbachia_phage	27.5	1.2e-36
WP_119174056.1|2572083_2572575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119174702.1|2572587_2574459_-|terminase	terminase	terminase	A0A067ZJA1	Vibrio_phage	25.5	2.2e-35
>prophage 8
NZ_CP042517	Citrobacter freundii strain E33 chromosome, complete genome	5022915	3828949	3841958	5022915	protease,tail,integrase	uncultured_Caudovirales_phage(33.33%)	16	3831640:3831687	3842138:3842185
WP_016151004.1|3828949_3830947_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	27.2	1.9e-08
WP_048218614.1|3830977_3831484_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
3831640:3831687	attL	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAA	NA	NA	NA	NA
WP_128295660.1|3831809_3832142_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_128295659.1|3832257_3832851_-|tail	tail assembly protein	tail	K7P6V1	Enterobacteria_phage	68.4	5.5e-65
WP_128295658.1|3832837_3833095_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	44.8	5.6e-06
WP_128295657.1|3833241_3835155_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	57.9	1.5e-215
WP_128295656.1|3835151_3835346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128295655.1|3836031_3837852_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	50.8	2.3e-130
WP_003846262.1|3837848_3838217_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	83.6	8.8e-53
WP_128295654.1|3838213_3838528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128295653.1|3838520_3838709_-	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	74.5	8.5e-12
WP_003846255.1|3838701_3838971_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	84.3	9.0e-39
WP_003846253.1|3839104_3839296_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_094137785.1|3839613_3839835_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_128295652.1|3839944_3840544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128295651.1|3840533_3841958_-|integrase	integrase family protein	integrase	H7BV31	unidentified_phage	25.9	1.5e-07
3842138:3842185	attR	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCAAA	NA	NA	NA	NA
>prophage 9
NZ_CP042517	Citrobacter freundii strain E33 chromosome, complete genome	5022915	4409369	4431080	5022915	holin,integrase	Morganella_phage(28.57%)	30	4416617:4416632	4425833:4425848
WP_128295809.1|4409369_4410644_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	78.6	5.5e-195
WP_128295792.1|4410640_4411579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049014569.1|4411670_4411889_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_128295793.1|4411888_4412323_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	52.9	6.1e-29
WP_128295794.1|4412336_4413167_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	49.6	1.9e-23
WP_079938916.1|4413159_4413339_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_128295810.1|4413766_4413949_-	DUF3950 domain-containing protein	NA	NA	NA	NA	NA
WP_128295811.1|4414100_4414331_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_079938915.1|4414312_4414507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128295795.1|4414503_4414704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128295796.1|4414700_4414964_+|holin	nicotinic acetylcholine receptor subunit beta	holin	NA	NA	NA	NA
WP_128295797.1|4414960_4415182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128295798.1|4415178_4415742_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	29.4	9.4e-14
WP_128295799.1|4415753_4416098_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	60.7	4.7e-32
WP_128295800.1|4416090_4418904_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.7	2.3e-294
4416617:4416632	attL	TGCTGGCGCTGGTGGA	NA	NA	NA	NA
WP_128295801.1|4419243_4419543_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_128295812.1|4419672_4419888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128295802.1|4420205_4420388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128295803.1|4420384_4422178_+	lytic transglycosylase domain-containing protein	NA	A0A077KC92	Edwardsiella_phage	29.0	1.6e-46
WP_128295804.1|4422234_4422696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128295813.1|4423254_4423422_+	helix-turn-helix domain-containing protein	NA	A0A1P8DTG1	Proteus_phage	63.0	6.2e-14
WP_061066853.1|4423500_4423752_+	excisionase family protein	NA	S4TND0	Salmonella_phage	55.1	9.0e-17
WP_128295814.1|4424091_4425213_+|integrase	site-specific integrase	integrase	F1C5B2	Cronobacter_phage	61.9	6.2e-134
WP_128295805.1|4425378_4425564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128295806.1|4425569_4425761_-	hypothetical protein	NA	I6RSG8	Salmonella_phage	62.1	3.4e-16
WP_128295807.1|4426193_4426553_-	hypothetical protein	NA	NA	NA	NA	NA
4425833:4425848	attR	TCCACCAGCGCCAGCA	NA	NA	NA	NA
WP_128295808.1|4426687_4427512_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	86.2	2.2e-104
WP_003024049.1|4427901_4428519_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_119174739.1|4428515_4430195_-	NAD-dependent DNA ligase LigB	NA	G3M9X7	Bacillus_virus	22.9	3.7e-21
WP_003024042.1|4430456_4431080_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.2e-19
>prophage 1
NZ_CP042519	Citrobacter freundii strain E33 plasmid pE33_002, complete sequence	176400	5791	58098	176400	transposase,integrase	Escherichia_phage(43.75%)	48	23500:23559	39015:39215
WP_012817690.1|5791_8800_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_071787999.1|8905_9184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493286.1|9404_9734_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|9714_9996_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_016947617.1|10273_11254_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_022652299.1|11576_12185_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022652298.1|12561_14373_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	79.8	1.1e-302
WP_022652297.1|14369_15743_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_022652296.1|15791_17057_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_022652295.1|17358_18543_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_022652294.1|18649_20119_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	6.9e-48
WP_022652293.1|20138_21569_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_032430963.1|21786_22575_+	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_001067834.1|22722_23427_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_014344500.1|23460_23733_-	hypothetical protein	NA	NA	NA	NA	NA
23500:23559	attL	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGA	NA	NA	NA	NA
WP_000845039.1|23701_24715_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015060105.1|24867_25608_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_015063357.1|25839_26172_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_003159191.1|26298_26853_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|26947_27580_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000846390.1|27648_28449_+	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_001206316.1|28465_29257_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_020956917.1|29745_30645_+	class A extended-spectrum beta-lactamase VEB-3	NA	NA	NA	NA	NA
WP_151532708.1|31650_32136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039272567.1|35330_38363_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_039272634.1|38359_38953_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.7	1.2e-40
WP_120783633.1|38987_39248_-|transposase	transposase	transposase	NA	NA	NA	NA
39015:39215	attR	TGTCGTTTTCAGAAGACGGCTGCACTGAACGTCAGAAGCCGACTGCACTATAGCAGCGGAGGGGTTGGATCCATCAGGCAACGACGGGCTGCTGCCGGCCATCAGCGGACGCAGGGAGGACTTTCCGCAACCGGCCGTTCGATGCGGCACCGATGGCCTTCGCGCAGGGGTAGTGAATCCGCCAGGATTGACTTGCGCTGC	NA	NA	NA	NA
WP_063840321.1|40304_40859_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|40989_41820_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|41957_42590_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|42674_43127_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|43349_43697_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|43690_44530_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|44459_44639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376616.1|44657_44861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|45016_46222_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|46232_46538_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|46553_46736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|46764_47529_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|47719_48076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|48021_48606_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|48605_49844_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|49840_50746_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|50867_51572_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557454.1|51804_52665_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067855.1|53033_53738_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000215515.1|56634_56991_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001067848.1|57393_58098_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
NZ_CP042519	Citrobacter freundii strain E33 plasmid pE33_002, complete sequence	176400	69400	126164	176400	transposase,integrase	Escherichia_phage(20.0%)	50	102809:102824	127949:127964
WP_001395480.1|69400_70432_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_001118618.1|71253_72177_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
WP_022652268.1|74918_75902_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	39.4	1.3e-47
WP_001166628.1|75995_76451_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294653.1|76522_76918_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|76933_77209_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|77236_77662_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|77700_79386_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|79403_79769_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_022652270.1|79765_80002_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|79985_80105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|80067_80280_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|80479_81184_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001752509.1|81510_82011_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_087893729.1|82084_83357_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
WP_016947617.1|83663_84644_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_000780222.1|84921_85203_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|85183_85513_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_022652300.1|85931_86885_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_022652302.1|87505_88216_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.7e-31
WP_022652303.1|88217_89423_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_022652304.1|89419_90571_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004393990.1|90567_91176_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022652300.1|91363_92317_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032645789.1|92571_92757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050483874.1|92907_93417_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_021314637.1|94588_94819_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_022652307.1|95096_95300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032430841.1|95381_96209_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.3	4.9e-51
WP_022652309.1|96226_97705_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	73.2	1.9e-194
WP_032430957.1|98211_99234_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_059331197.1|99991_100135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652310.1|100309_101050_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_022652311.1|101375_102365_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	61.2	5.0e-103
102809:102824	attL	TACCTGCTCCTGCCAG	NA	NA	NA	NA
WP_022652312.1|103220_103490_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_022652313.1|103493_104024_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077873527.1|104155_105049_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	86.8	4.3e-154
WP_072033343.1|105581_106319_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.1	2.9e-55
WP_043016701.1|106335_107880_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	48.0	4.4e-130
WP_022652315.1|108792_109944_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	9.8e-42
WP_001201739.1|110052_110436_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_000609174.1|110432_110780_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000409.1|110829_112365_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_032430835.1|112421_113780_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.5	1.3e-117
WP_022652317.1|114605_115772_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	94.3	1.1e-218
WP_022652318.1|115771_116737_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	77.5	8.8e-137
WP_022652236.1|118765_120904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652237.1|121207_122641_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_022652238.1|122674_123889_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.9	9.4e-35
WP_022652239.1|124037_126164_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
127949:127964	attR	TACCTGCTCCTGCCAG	NA	NA	NA	NA
