The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	0	8569	4919347		Yellowstone_lake_phycodnavirus(33.33%)	8	NA	NA
WP_125293958.1|211_592_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_151602002.1|591_1323_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_125293960.1|1396_2134_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_125293961.1|2145_3051_-	GTPase Era	NA	NA	NA	NA	NA
WP_125293962.1|3047_3728_-	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	4.8e-20
WP_125293963.1|4016_4991_-	signal peptidase I	NA	NA	NA	NA	NA
WP_125293964.1|5005_6805_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.6	1.9e-23
WP_151602005.1|7033_8569_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	43.3	1.2e-34
>prophage 2
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	14789	19259	4919347	tRNA	uncultured_Mediterranean_phage(25.0%)	5	NA	NA
WP_125293971.1|14789_16115_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	28.4	6.6e-42
WP_125293972.1|16162_16546_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	2.3e-32
WP_125293973.1|16863_17544_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.8	1.1e-56
WP_151602011.1|17582_18635_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_125293975.1|18839_19259_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	41.5	9.1e-14
>prophage 3
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	24568	25024	4919347		Synechococcus_phage(100.0%)	1	NA	NA
WP_125293978.1|24568_25024_-	DUF4385 domain-containing protein	NA	A0A222YVL1	Synechococcus_phage	47.3	3.6e-32
>prophage 4
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	30753	33327	4919347		Enterobacteria_phage(100.0%)	1	NA	NA
WP_125294794.1|30753_33327_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.1	1.2e-127
>prophage 5
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	39211	40282	4919347		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_151602019.1|39211_40282_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.1	7.6e-89
>prophage 6
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	45356	45539	4919347		Moraxella_phage(100.0%)	1	NA	NA
WP_125294807.1|45356_45539_-	hypothetical protein	NA	A0A0R6PKW9	Moraxella_phage	70.3	6.1e-07
>prophage 7
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	57610	61441	4919347		Staphylococcus_phage(50.0%)	3	NA	NA
WP_125294822.1|57610_58093_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	3.0e-29
WP_144130595.1|58129_59299_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_151602033.1|59308_61441_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.4	8.2e-26
>prophage 8
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	76835	77982	4919347	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_151602041.1|76835_77982_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	1.7e-147
>prophage 9
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	88494	92087	4919347		Burkholderia_virus(50.0%)	4	NA	NA
WP_151602058.1|88494_89847_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.9	1.3e-61
WP_151602060.1|89936_90635_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151602063.1|90850_91093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151602066.1|91427_92087_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	70.8	5.2e-88
>prophage 10
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	125188	125401	4919347		Morganella_phage(100.0%)	1	NA	NA
WP_125294852.1|125188_125401_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
>prophage 11
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	129774	135078	4919347		Gordonia_phage(25.0%)	4	NA	NA
WP_151602114.1|129774_130020_+	glutaredoxin-like protein NrdH	NA	A0A0E3T8B5	Gordonia_phage	40.3	1.5e-11
WP_151602116.1|130016_130412_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A076GDF1	Bacillus_phage	30.0	1.9e-08
WP_151602119.1|130399_132544_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.0	1.0e-193
WP_125294862.1|133875_135078_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.1	1.9e-27
>prophage 12
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	147865	164921	4919347	tRNA	uncultured_Mediterranean_phage(22.22%)	16	NA	NA
WP_002434672.1|147865_148051_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_151602140.1|148417_151048_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	7.1e-80
WP_151602142.1|151186_151690_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_125294877.1|151741_152806_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.5	4.7e-115
WP_151602144.1|152895_153393_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.3	6.1e-33
WP_125294879.1|153500_154589_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_144130633.1|154841_155378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125294881.1|155654_158222_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.0	4.3e-29
WP_125294882.1|158266_158503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151602147.1|158516_159941_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_144130636.1|159930_160533_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_151602149.1|160699_161104_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002434658.1|161179_162172_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_125294886.1|162287_163415_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	36.4	6.5e-06
WP_125294887.1|163539_164166_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.4	8.2e-35
WP_151602151.1|164159_164921_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	46.7	1.3e-55
>prophage 13
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	168019	170052	4919347		Tupanvirus(50.0%)	2	NA	NA
WP_125295614.1|168019_168625_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	39.5	9.4e-28
WP_144130642.1|168624_170052_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.3	2.5e-34
>prophage 14
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	179198	184589	4919347		Vibrio_phage(33.33%)	4	NA	NA
WP_151602178.1|179198_179870_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.3	2.3e-11
WP_125295604.1|180170_181508_+	gluconate permease	NA	NA	NA	NA	NA
WP_125295603.1|181569_182868_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	57.1	2.2e-130
WP_125295602.1|182951_184589_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.6	3.9e-153
>prophage 15
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	187960	194242	4919347	transposase	Streptococcus_phage(33.33%)	4	NA	NA
WP_151602181.1|187960_189262_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	25.9	1.6e-32
WP_125295598.1|189317_192071_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.5	3.1e-49
WP_151602183.1|192122_192833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142273976.1|193095_194242_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.7	4.6e-148
>prophage 16
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	197712	201671	4919347		Streptococcus_phage(50.0%)	3	NA	NA
WP_151602189.1|197712_198855_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.2	7.4e-50
WP_151605583.1|198965_200306_-	glucarate dehydratase	NA	NA	NA	NA	NA
WP_151602191.1|200330_201671_-	glucarate dehydratase	NA	Q6A202	Oenococcus_phage	24.6	1.3e-05
>prophage 17
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	206325	207171	4919347		Vibrio_phage(100.0%)	1	NA	NA
WP_144130665.1|206325_207171_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.2	6.1e-41
>prophage 18
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	211965	212721	4919347		Bacillus_phage(100.0%)	1	NA	NA
WP_151602199.1|211965_212721_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	2.0e-11
>prophage 19
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	216001	231281	4919347	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_151602203.1|216001_217207_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	35.2	6.4e-68
WP_151602206.1|217207_217651_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_151602208.1|217654_218461_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	34.4	1.2e-17
WP_125295572.1|218510_219611_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_151602211.1|220199_221462_-	AMIN domain-containing protein	NA	Q5YA51	Bacillus_phage	33.6	3.7e-18
WP_125295281.1|221694_223026_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_151602214.1|223027_224857_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.6	6.0e-25
WP_151602216.1|224853_228396_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	22.0	1.0e-09
WP_151602219.1|228392_231281_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.3	1.8e-60
>prophage 20
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	236749	240823	4919347		Cronobacter_phage(50.0%)	3	NA	NA
WP_144130685.1|236749_237544_-	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	63.2	1.3e-117
WP_125295349.1|237550_238426_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_125295291.1|238576_240823_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.6	1.5e-09
>prophage 21
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	245488	247645	4919347		Staphylococcus_phage(100.0%)	1	NA	NA
WP_151602228.1|245488_247645_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.2	1.2e-16
>prophage 22
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	253343	257626	4919347		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
WP_043865925.1|253343_254105_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	4.5e-19
WP_151602241.1|254519_254921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144130694.1|254932_255283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151602244.1|255506_256688_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_125295308.1|256918_257626_-	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	43.5	6.7e-41
>prophage 23
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	262809	273828	4919347	transposase	uncultured_Caudovirales_phage(50.0%)	10	NA	NA
WP_142273976.1|262809_263957_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.7	4.6e-148
WP_151602251.1|264275_266033_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_109455549.1|266138_267346_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
WP_038423326.1|267508_268045_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_063438092.1|268079_268505_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	1.5e-51
WP_063438093.1|268517_269807_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.5	1.0e-172
WP_151602254.1|269854_271606_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_047644109.1|271623_271986_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_057107865.1|272033_272384_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.5	4.8e-24
WP_151602257.1|272708_273828_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.7	3.0e-51
>prophage 24
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	277934	280225	4919347	integrase	Enterobacteria_phage(50.0%)	2	269839:269852	288152:288165
269839:269852	attL	TGTATATGCCAAAA	NA	NA	NA	NA
WP_063438095.1|277934_279161_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	60.4	1.2e-138
WP_125295314.1|279478_280225_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1C9LWW7	Streptomyces_phage	49.0	3.6e-05
288152:288165	attR	TGTATATGCCAAAA	NA	NA	NA	NA
>prophage 25
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	304365	318619	4919347	tRNA	environmental_Halophage(14.29%)	10	NA	NA
WP_125295331.1|304365_305760_+	purine permease	NA	H9YQ34	environmental_Halophage	46.2	5.2e-21
WP_151602294.1|305777_307094_+	guanine deaminase	NA	NA	NA	NA	NA
WP_125295333.1|307123_308491_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	4.7e-160
WP_151602296.1|308546_310490_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_144130709.1|311019_312468_+	purine permease	NA	Q9KX94	Enterobacteria_phage	28.6	1.6e-28
WP_144130710.1|312521_314039_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	8.6e-86
WP_125295337.1|314048_315147_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	7.0e-05
WP_125295338.1|315243_316977_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.0	3.1e-63
WP_125295339.1|316980_317694_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_125295350.1|317719_318619_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.1	6.1e-31
>prophage 26
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	323267	329995	4919347		Pandoravirus(33.33%)	4	NA	NA
WP_151602307.1|323267_324701_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	3.1e-29
WP_151602309.1|324900_326292_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_151602311.1|326316_327060_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	25.8	2.3e-07
WP_151602314.1|327121_329995_-	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.0	1.9e-259
>prophage 27
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	337834	339073	4919347		Catovirus(100.0%)	1	NA	NA
WP_125293251.1|337834_339073_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.6	9.1e-102
>prophage 28
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	350201	350885	4919347		Staphylococcus_phage(100.0%)	1	NA	NA
WP_151602338.1|350201_350885_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	5.5e-08
>prophage 29
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	357979	359134	4919347		Staphylococcus_phage(100.0%)	1	NA	NA
WP_125293231.1|357979_359134_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.7	6.9e-128
>prophage 30
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	393174	394899	4919347		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_144131004.1|393174_394899_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	25.1	7.3e-33
>prophage 31
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	407603	408302	4919347		Planktothrix_phage(100.0%)	1	NA	NA
WP_144130752.1|407603_408302_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.6	1.9e-24
>prophage 32
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	414570	419965	4919347		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_144130755.1|414570_416928_+	DNA polymerase II	NA	A0A0N7KVW0	Yellowstone_lake_phycodnavirus	25.4	1.2e-30
WP_151605585.1|417058_419965_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	35.6	1.6e-19
>prophage 33
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	427739	429117	4919347		Salmonella_phage(50.0%)	2	NA	NA
WP_125293175.1|427739_428594_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	29.7	7.6e-07
WP_144130760.1|428637_429117_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	41.2	1.2e-28
>prophage 34
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	438699	444313	4919347		Vibrio_phage(50.0%)	4	NA	NA
WP_151602405.1|438699_440214_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	25.2	4.5e-10
WP_144130768.1|440254_441397_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_151605587.1|441487_442690_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_151602408.1|442756_444313_+	crotonobetaine/carnitine-CoA ligase	NA	A0A2K9KZV5	Tupanvirus	22.0	5.3e-14
>prophage 35
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	450427	451159	4919347		Enterobacteria_phage(100.0%)	1	NA	NA
WP_125293268.1|450427_451159_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	53.3	5.8e-56
>prophage 36
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	454453	455602	4919347		Halovirus(100.0%)	1	NA	NA
WP_151602420.1|454453_455602_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.5	1.1e-48
>prophage 37
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	467287	470822	4919347	transposase	Phage_Gifsy-1(50.0%)	4	NA	NA
WP_151602426.1|467287_468418_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	90.4	1.5e-196
WP_125293146.1|468542_469010_+	cellulose synthase	NA	NA	NA	NA	NA
WP_125293145.1|469019_470015_+	endoglucanase	NA	NA	NA	NA	NA
WP_144130778.1|470051_470822_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.7	5.6e-17
>prophage 38
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	485704	488521	4919347	tRNA	Bandra_megavirus(100.0%)	1	NA	NA
WP_151602449.1|485704_488521_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9V7W4	Bandra_megavirus	26.0	7.9e-77
>prophage 39
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	496881	501500	4919347		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_144130805.1|496881_498060_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.3	3.3e-85
WP_125293113.1|498300_499434_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	35.6	5.9e-31
WP_151602453.1|499583_501500_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	48.5	4.2e-146
>prophage 40
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	504585	505539	4919347		Cyanophage(100.0%)	1	NA	NA
WP_125293108.1|504585_505539_-	transaldolase	NA	A0A127KNC6	Cyanophage	32.1	4.3e-11
>prophage 41
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	516651	518079	4919347		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_151602465.1|516651_518079_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.7	1.5e-10
>prophage 42
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	521921	525755	4919347		Bacillus_phage(50.0%)	2	NA	NA
WP_151602469.1|521921_523856_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	38.3	1.3e-14
WP_125293091.1|524087_525755_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	5.4e-41
>prophage 43
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	530678	532178	4919347		Staphylococcus_phage(100.0%)	1	NA	NA
WP_151602473.1|530678_532178_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	31.2	1.0e-22
>prophage 44
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	537703	539371	4919347		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_125293079.1|537703_539371_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.4	9.0e-12
>prophage 45
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	546636	547071	4919347		Morganella_phage(100.0%)	1	NA	NA
WP_125293068.1|546636_547071_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.0	1.7e-26
>prophage 46
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	554470	570549	4919347	tRNA,transposase	Shigella_phage(33.33%)	10	NA	NA
WP_109455549.1|554470_555678_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
WP_151602493.1|556250_557524_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.1	1.4e-145
WP_151602495.1|558188_559457_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	39.6	4.8e-82
WP_151602497.1|559857_561498_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_151602499.1|561635_563138_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	44.4	2.6e-82
WP_125293046.1|563191_564274_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_125293045.1|564260_565373_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_125293044.1|565641_567153_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	37.4	8.6e-46
WP_151602501.1|567232_567688_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_144130930.1|567693_570549_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	3.4e-144
>prophage 47
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	576860	588922	4919347		Paramecium_bursaria_Chlorella_virus(20.0%)	11	NA	NA
WP_125293034.1|576860_577796_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.2	5.5e-51
WP_125293033.1|577809_578274_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_151602509.1|578361_578748_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_144130942.1|578843_579950_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_144130944.1|579964_580327_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_144130946.1|580316_580664_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_151602511.1|580723_582217_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	27.4	9.5e-29
WP_144130950.1|582213_583929_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	27.7	8.3e-37
WP_125293026.1|584012_584867_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_151602513.1|584886_587601_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.3	1.2e-45
WP_125293024.1|587974_588922_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.3	1.9e-11
>prophage 48
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	592549	595152	4919347		Vibrio_phage(100.0%)	2	NA	NA
WP_125293022.1|592549_594688_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.3	5.5e-264
WP_151602517.1|594687_595152_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2D0YLR2	Vibrio_phage	57.8	3.2e-52
>prophage 49
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	603350	648229	4919347	protease,transposase,tRNA,integrase	Pseudomonas_phage(20.0%)	44	599699:599713	650693:650707
599699:599713	attL	ATTAGCCATGTTCGC	NA	NA	NA	NA
WP_125293008.1|603350_604703_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_125293007.1|604809_605361_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_151602529.1|605415_605907_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.6	2.9e-27
WP_125293005.1|605912_606554_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002437466.1|606867_607260_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002437467.1|607275_607704_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_151602531.1|607947_609072_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002437469.1|609267_609666_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_125293003.1|609843_611211_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	1.3e-19
WP_151602533.1|611303_612368_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_125293001.1|612424_613363_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_125293000.1|613785_614256_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_151602535.1|614604_614868_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_125292998.1|614961_615228_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_125292997.1|615282_615561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151602537.1|615590_617045_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_151602539.1|617146_619114_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_125292994.1|619118_620051_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002437480.1|620058_620262_-	AaeX family protein	NA	NA	NA	NA	NA
WP_125292993.1|620433_621366_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_125292992.1|621404_622850_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_151602541.1|622914_626712_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_125292990.1|626763_628233_-	ribonuclease G	NA	NA	NA	NA	NA
WP_151602543.1|628241_628817_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_125292988.1|628825_629314_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_125292987.1|629313_630318_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|630387_631431_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_125292986.1|631740_633681_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_125292985.1|633902_634877_+	oxidoreductase	NA	NA	NA	NA	NA
WP_144130985.1|634980_635985_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_151602545.1|635985_636585_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_125292982.1|636819_637272_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_125292981.1|637293_637770_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_125292980.1|637780_639130_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_125292979.1|639230_639473_+	YhdT family protein	NA	NA	NA	NA	NA
WP_151602547.1|639462_640917_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_151602549.1|640928_641810_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_125292976.1|641957_642698_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_125292975.1|643028_644036_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|644139_644436_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_151602551.1|644588_644777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142273976.1|644896_646044_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.7	4.6e-148
WP_103848558.1|646358_647009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103848555.1|647008_648229_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.7	1.0e-153
650693:650707	attR	GCGAACATGGCTAAT	NA	NA	NA	NA
>prophage 50
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	654796	658958	4919347		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_125292954.1|654796_655822_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	4.0e-71
WP_151602557.1|655895_657077_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_125292951.1|658199_658958_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.8	4.5e-19
>prophage 51
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	666508	670825	4919347	tRNA	Pandoravirus(33.33%)	5	NA	NA
WP_151602563.1|666508_667624_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	28.4	5.1e-11
WP_125295727.1|667649_668123_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_151602565.1|668094_669216_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_125295725.1|669346_669853_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.5e-18
WP_151602567.1|669877_670825_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.4	3.1e-09
>prophage 52
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	690712	696288	4919347		Tupanvirus(33.33%)	7	NA	NA
WP_125317950.1|690712_691897_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.8	3.4e-13
WP_151602577.1|691967_694082_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	4.7e-58
WP_008807044.1|694179_694650_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_002436309.1|694745_695120_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_125292514.1|695244_695532_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_151602579.1|695539_695902_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_144131593.1|695901_696288_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	34.4	4.0e-16
>prophage 53
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	702005	703910	4919347		Tupanvirus(100.0%)	1	NA	NA
WP_151602584.1|702005_703910_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	32.8	4.0e-72
>prophage 54
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	707561	711514	4919347		environmental_Halophage(50.0%)	3	NA	NA
WP_151602588.1|707561_709658_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	86.5	1.2e-66
WP_151602590.1|709647_710865_-	acetylornithine/succinylornithine family transaminase	NA	NA	NA	NA	NA
WP_151602591.1|710950_711514_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	2.5e-59
>prophage 55
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	736641	737457	4919347		Vibrio_phage(100.0%)	1	NA	NA
WP_151602620.1|736641_737457_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	50.4	1.6e-70
>prophage 56
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	740864	742115	4919347		Enterobacteria_phage(100.0%)	1	NA	NA
WP_151605592.1|740864_742115_-	DNA uptake porin HofQ	NA	G4WZN6	Enterobacteria_phage	24.1	1.1e-14
>prophage 57
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	752384	759430	4919347		Bacillus_phage(50.0%)	5	NA	NA
WP_125292568.1|752384_754004_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	7.9e-138
WP_151602635.1|754078_755431_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	1.6e-11
WP_006177890.1|755427_756147_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_125292570.1|756694_757879_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_151602636.1|757960_759430_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	1.1e-45
>prophage 58
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	767843	773747	4919347		Thermus_phage(50.0%)	4	NA	NA
WP_151602644.1|767843_768527_+	DNA utilization protein GntX	NA	S6B1L6	Thermus_phage	42.2	4.4e-05
WP_002436473.1|768585_769161_+	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_151602646.1|769226_771335_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_151602648.1|771344_773747_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	6.6e-16
>prophage 59
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	776971	783174	4919347	protease	Escherichia_phage(50.0%)	5	NA	NA
WP_125292584.1|776971_777730_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.3	2.2e-21
WP_125292585.1|777754_778585_-|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
WP_151602652.1|778631_778961_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_144131673.1|779177_780683_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_125292588.1|780726_783174_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 60
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	796984	802962	4919347		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_151602660.1|796984_798628_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	57.1	1.0e-07
WP_151602662.1|798822_800562_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_125292599.1|800684_801161_+	DUF2756 family protein	NA	NA	NA	NA	NA
WP_151602664.1|801157_801898_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	27.0	4.4e-11
WP_151602665.1|801894_802962_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.0	9.8e-20
>prophage 61
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	807006	808489	4919347		Planktothrix_phage(50.0%)	2	NA	NA
WP_125292606.1|807006_807720_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	1.2e-13
WP_125292607.1|807721_808489_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	2.2e-13
>prophage 62
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	814215	819966	4919347		Klosneuvirus(25.0%)	5	NA	NA
WP_151602673.1|814215_815475_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	8.3e-26
WP_151602675.1|815590_817084_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A1X9I5H2	Streptococcus_phage	25.8	2.7e-15
WP_125292615.1|817137_817995_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	43.0	6.4e-46
WP_125292616.1|818249_819305_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_125292617.1|819297_819966_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	5.5e-13
>prophage 63
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	823011	825956	4919347		Dickeya_phage(50.0%)	2	NA	NA
WP_125292622.1|823011_823638_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	62.8	3.8e-32
WP_151602681.1|823733_825956_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.6	3.6e-117
>prophage 64
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	829945	831028	4919347		Dickeya_phage(50.0%)	2	NA	NA
WP_125292627.1|829945_830191_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	2.7e-10
WP_151602685.1|830362_831028_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	57.0	5.6e-58
>prophage 65
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	856638	860133	4919347		Bacillus_phage(50.0%)	4	NA	NA
WP_125292655.1|856638_857154_-	hypothetical protein	NA	S5MM68	Bacillus_phage	39.3	7.8e-15
WP_144131741.1|857572_858007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151602720.1|858001_858748_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_151602722.1|859248_860133_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	55.0	1.1e-80
>prophage 66
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	864109	864874	4919347		Bacillus_phage(100.0%)	1	NA	NA
WP_151602726.1|864109_864874_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.3	1.6e-16
>prophage 67
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	900879	905996	4919347	transposase	Shigella_phage(100.0%)	3	NA	NA
WP_142273976.1|900879_902026_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.7	4.6e-148
WP_151602760.1|902176_904552_+	carbamoyltransferase HypF	NA	NA	NA	NA	NA
WP_109455549.1|904788_905996_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
>prophage 68
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	910318	912361	4919347		Indivirus(100.0%)	1	NA	NA
WP_151602768.1|910318_912361_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.6	2.2e-44
>prophage 69
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	933434	935424	4919347		Bacillus_virus(50.0%)	2	NA	NA
WP_125292713.1|933434_934445_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	28.9	7.3e-17
WP_151602793.1|934431_935424_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.0	7.5e-14
>prophage 70
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	946604	947812	4919347	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_109455549.1|946604_947812_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
>prophage 71
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	959329	961663	4919347		Escherichia_phage(100.0%)	1	NA	NA
WP_151602809.1|959329_961663_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.9	2.8e-72
>prophage 72
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	976054	976855	4919347		Dickeya_phage(100.0%)	1	NA	NA
WP_151602822.1|976054_976855_+	ATP-binding cassette domain-containing protein	NA	A0A140XAK6	Dickeya_phage	65.9	1.2e-27
>prophage 73
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	987143	988139	4919347		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_144131848.1|987143_988139_+	acyltransferase family protein	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	25.8	1.9e-09
>prophage 74
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	993958	995500	4919347		Staphylococcus_phage(100.0%)	1	NA	NA
WP_151602838.1|993958_995500_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.5e-16
>prophage 75
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1005488	1007333	4919347		Tupanvirus(100.0%)	1	NA	NA
WP_151602849.1|1005488_1007333_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.5e-15
>prophage 76
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1021247	1021868	4919347		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_144131890.1|1021247_1021868_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	2.9e-64
>prophage 77
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1035143	1038194	4919347		Escherichia_phage(100.0%)	1	NA	NA
WP_151602881.1|1035143_1038194_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.6	3.8e-08
>prophage 78
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1046296	1047322	4919347		Wolbachia_phage(100.0%)	1	NA	NA
WP_151602892.1|1046296_1047322_+	hydroxyacid dehydrogenase	NA	Q9JMN3	Wolbachia_phage	44.7	3.4e-70
>prophage 79
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1056609	1057428	4919347		Planktothrix_phage(100.0%)	1	NA	NA
WP_125292861.1|1056609_1057428_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	1.3e-32
>prophage 80
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1068991	1077205	4919347		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_151602912.1|1068991_1070680_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.8	7.3e-62
WP_125292878.1|1070792_1070891_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_125292879.1|1071469_1071559_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_151602914.1|1071671_1072295_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_151602915.1|1072463_1073648_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.3	2.3e-14
WP_125292882.1|1073644_1073983_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_125292883.1|1073975_1074323_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_125292884.1|1074439_1076101_-	putative transporter	NA	NA	NA	NA	NA
WP_125292885.1|1076255_1076684_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	34.5	3.2e-14
WP_002435514.1|1076791_1077205_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.8e-17
>prophage 81
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1080586	1091085	4919347		Oenococcus_phage(25.0%)	10	NA	NA
WP_151602919.1|1080586_1081735_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	31.9	1.8e-51
WP_151602921.1|1081816_1082506_-	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_151602923.1|1082782_1083595_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_125292893.1|1083742_1086157_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	1.2e-113
WP_151602925.1|1086185_1087259_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_125292895.1|1087258_1088359_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	33.6	1.1e-50
WP_125292896.1|1088363_1089743_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000831330.1|1090346_1090487_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_002435532.1|1090504_1090864_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_072042720.1|1090827_1091085_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	9.2e-17
>prophage 82
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1099154	1109619	4919347		Moraxella_phage(20.0%)	9	NA	NA
WP_151602932.1|1099154_1100492_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.5	1.9e-65
WP_125292905.1|1100671_1101337_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_125292906.1|1101376_1102102_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_125292907.1|1102115_1102889_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.8	1.2e-14
WP_125292908.1|1102934_1103825_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_125292909.1|1103824_1104784_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_144132014.1|1104898_1105939_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	34.8	3.5e-46
WP_125292911.1|1106248_1108078_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.0	1.4e-130
WP_125292912.1|1108248_1109619_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.4	8.7e-37
>prophage 83
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1121729	1129889	4919347		Heterosigma_akashiwo_virus(25.0%)	6	NA	NA
WP_125292921.1|1121729_1122722_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	7.6e-51
WP_151602940.1|1122725_1124177_-	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_144132023.1|1124173_1125667_-	ATPase RavA	NA	A0A0N9NIH9	Sulfolobus_monocaudavirus	32.9	9.8e-18
WP_151602942.1|1125922_1127791_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	7.1e-66
WP_125292925.1|1127959_1128379_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_151602944.1|1128386_1129889_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	21.7	1.3e-17
>prophage 84
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1146005	1148792	4919347		Enterococcus_phage(100.0%)	1	NA	NA
WP_125295050.1|1146005_1148792_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	29.0	4.6e-45
>prophage 85
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1152689	1155205	4919347		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_125295046.1|1152689_1154099_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	27.1	6.2e-06
WP_125295045.1|1154155_1155205_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.5	4.1e-10
>prophage 86
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1168640	1171416	4919347		Staphylococcus_phage(50.0%)	3	NA	NA
WP_151602968.1|1168640_1169525_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	91.5	2.3e-62
WP_125295033.1|1169678_1170575_+	sugar kinase	NA	NA	NA	NA	NA
WP_125295032.1|1170609_1171416_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.0	1.9e-20
>prophage 87
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1182753	1195420	4919347	transposase,tRNA	Enterobacter_phage(28.57%)	10	NA	NA
WP_151602980.1|1182753_1184145_-	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	91.0	5.3e-66
WP_151602982.1|1184305_1186387_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_151602984.1|1186387_1187110_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_125295017.1|1187114_1189229_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_002436668.1|1189248_1189524_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_125295016.1|1189578_1190202_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.0	1.1e-18
WP_151602986.1|1190454_1192140_+	NAD-dependent DNA ligase LigB	NA	G3M9X7	Bacillus_virus	22.5	3.4e-19
WP_151602988.1|1192101_1193730_-	acyltransferase family protein	NA	A0A193GZ69	Enterobacter_phage	26.2	2.1e-29
WP_109455549.1|1193763_1194971_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
WP_151602990.1|1195054_1195420_-	acyltransferase family protein	NA	A0A193GZ69	Enterobacter_phage	51.0	1.4e-21
>prophage 88
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1201316	1205826	4919347		Xanthomonas_phage(25.0%)	7	NA	NA
WP_144133016.1|1201316_1201775_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.8	5.6e-49
WP_125295007.1|1201752_1202967_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.6	7.4e-40
WP_125295006.1|1203132_1203807_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_002436699.1|1204023_1204260_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_003024094.1|1204280_1204448_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_125295005.1|1204520_1205330_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	29.4	7.2e-23
WP_151602994.1|1205337_1205826_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.6	6.4e-27
>prophage 89
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1210669	1211653	4919347		Catovirus(100.0%)	1	NA	NA
WP_144133001.1|1210669_1211653_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	33.6	2.2e-13
>prophage 90
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1218748	1232908	4919347	tRNA	Prochlorococcus_phage(14.29%)	15	NA	NA
WP_125294991.1|1218748_1219681_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.1	1.9e-35
WP_144132989.1|1219910_1221107_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	28.8	1.2e-34
WP_125294988.1|1221116_1222145_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_151605599.1|1222296_1223106_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_144132985.1|1223120_1224059_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_144132983.1|1224062_1225343_-	murein hydrolase activator EnvC	NA	A0A2H4JGI7	uncultured_Caudovirales_phage	42.9	2.8e-05
WP_151603010.1|1225352_1226900_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_125294981.1|1227145_1227577_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_125294979.1|1227596_1227848_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	1.3e-15
WP_002436726.1|1227899_1228367_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_125294977.1|1228366_1229386_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_125294975.1|1229461_1230283_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_151603011.1|1230279_1230753_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_151603013.1|1230839_1232213_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.3	2.9e-16
WP_125294970.1|1232209_1232908_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	1.1e-06
>prophage 91
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1249078	1249930	4919347		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_125294946.1|1249078_1249930_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	26.4	3.6e-09
>prophage 92
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1253299	1254634	4919347		Erwinia_phage(100.0%)	1	NA	NA
WP_125294940.1|1253299_1254634_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	29.8	1.0e-42
>prophage 93
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1279866	1281708	4919347		Acinetobacter_phage(100.0%)	1	NA	NA
WP_151605601.1|1279866_1281708_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	31.2	3.9e-08
>prophage 94
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1291766	1293413	4919347		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_125295427.1|1291766_1293413_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	32.9	5.3e-65
>prophage 95
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1301375	1306637	4919347		Bacillus_phage(33.33%)	4	NA	NA
WP_144133094.1|1301375_1303406_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	9.0e-115
WP_151603050.1|1303430_1304915_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_125295437.1|1304920_1306189_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.7	1.1e-41
WP_002437994.1|1306307_1306637_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	37.5	4.2e-14
>prophage 96
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1310715	1316858	4919347		Enterobacteria_phage(40.0%)	6	NA	NA
WP_151603052.1|1310715_1311846_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.8	4.6e-28
WP_151603054.1|1311842_1313105_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	26.1	4.3e-22
WP_144133102.1|1313101_1314169_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.9	3.6e-99
WP_125295443.1|1314186_1315068_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	1.2e-108
WP_151603056.1|1315045_1315723_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_125295445.1|1315727_1316858_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	42.5	1.1e-18
>prophage 97
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1333178	1337024	4919347		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_125295461.1|1333178_1334084_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	30.7	9.2e-19
WP_151603068.1|1334083_1334800_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_151603069.1|1334861_1337024_+	DNA helicase II	NA	A7KV33	Bacillus_phage	38.0	9.3e-118
>prophage 98
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1343905	1345735	4919347		Catovirus(100.0%)	1	NA	NA
WP_125295470.1|1343905_1345735_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	36.9	2.4e-82
>prophage 99
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1355347	1361623	4919347		Alteromonas_phage(33.33%)	7	NA	NA
WP_151603085.1|1355347_1356784_+	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	48.3	7.5e-07
WP_125295480.1|1356862_1357618_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_125295481.1|1357630_1358236_+	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_151603087.1|1358232_1359879_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.5	1.7e-39
WP_125295483.1|1360064_1360316_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_151603089.1|1360319_1360853_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_125295485.1|1360855_1361623_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	29.0	1.2e-22
>prophage 100
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1370385	1370997	4919347		Streptococcus_phage(100.0%)	1	NA	NA
WP_144133148.1|1370385_1370997_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	34.8	3.3e-20
>prophage 101
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1380669	1396270	4919347		uncultured_Mediterranean_phage(20.0%)	10	NA	NA
WP_151605603.1|1380669_1381641_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.6	1.2e-27
WP_125317950.1|1382656_1383841_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.8	3.4e-13
WP_002438629.1|1384122_1384506_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_125295710.1|1384507_1385053_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.1	2.4e-14
WP_002438627.1|1385207_1385636_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_125295709.1|1385639_1386344_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_002438625.1|1386691_1387189_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_002884142.1|1387255_1387621_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_125295708.1|1387941_1391970_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.8	8.5e-24
WP_125295707.1|1392046_1396270_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.9	3.8e-67
>prophage 102
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1403865	1404621	4919347		Catovirus(100.0%)	1	NA	NA
WP_151603115.1|1403865_1404621_-	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SAV8	Catovirus	25.0	1.0e-10
>prophage 103
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1409951	1415352	4919347		Klosneuvirus(33.33%)	6	NA	NA
WP_125295692.1|1409951_1410623_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.8	4.7e-20
WP_125295691.1|1410667_1411258_+	YjaG family protein	NA	NA	NA	NA	NA
WP_002438605.1|1411444_1411717_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	9.4e-20
WP_151603125.1|1411723_1412425_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_151603127.1|1412459_1413752_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_151603129.1|1413762_1415352_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.1	4.9e-68
>prophage 104
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1428218	1431902	4919347		Dickeya_phage(100.0%)	1	NA	NA
WP_151603135.1|1428218_1431902_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	87.3	4.9e-26
>prophage 105
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1449324	1450434	4919347		Mycoplasma_phage(100.0%)	1	NA	NA
WP_125294758.1|1449324_1450434_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	46.1	8.9e-16
>prophage 106
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1457562	1458171	4919347		Shigella_phage(100.0%)	1	NA	NA
WP_125294750.1|1457562_1458171_+	repressor LexA	NA	U5P451	Shigella_phage	42.2	6.2e-11
>prophage 107
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1464951	1476930	4919347		Salmonella_phage(20.0%)	10	NA	NA
WP_125294743.1|1464951_1466358_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	77.9	1.5e-198
WP_151603155.1|1466511_1467591_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.1	1.7e-27
WP_151603157.1|1467704_1468898_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_151603159.1|1469105_1469819_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_125294739.1|1470075_1470429_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_125294738.1|1470429_1473264_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	2.3e-310
WP_144131071.1|1473524_1474064_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	87.2	2.0e-53
WP_151603161.1|1474307_1474652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125294735.1|1474684_1474963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151603163.1|1475532_1476930_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.9	9.5e-15
>prophage 108
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1480950	1484982	4919347		Moraxella_phage(50.0%)	3	NA	NA
WP_125294729.1|1480950_1482297_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.4e-159
WP_125294728.1|1482438_1484085_+	Na+/H+ antiporter	NA	NA	NA	NA	NA
WP_125294727.1|1484088_1484982_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.1	2.6e-18
>prophage 109
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1490195	1492154	4919347		Staphylococcus_phage(100.0%)	1	NA	NA
WP_125294723.1|1490195_1492154_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.7	6.3e-89
>prophage 110
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1512031	1513555	4919347		Staphylococcus_phage(100.0%)	1	NA	NA
WP_151603185.1|1512031_1513555_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.2e-15
>prophage 111
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1520158	1521625	4919347		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_151603200.1|1520158_1520857_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	1.8e-06
WP_125294697.1|1520866_1521625_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.9	6.7e-15
>prophage 112
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1527180	1561700	4919347	transposase,integrase	Shigella_phage(33.33%)	28	1553234:1553248	1562491:1562505
WP_151603208.1|1527180_1527969_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.8	2.0e-14
WP_151603210.1|1528253_1529462_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_151603212.1|1529458_1530760_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.9	5.7e-06
WP_001395480.1|1530870_1531902_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_151603214.1|1531921_1532158_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_125294686.1|1532498_1532834_-	phnA family protein	NA	NA	NA	NA	NA
WP_151603216.1|1533415_1535785_+	clamp-binding protein CrfC	NA	NA	NA	NA	NA
WP_125294684.1|1535781_1536657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144131132.1|1536723_1537719_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_125294682.1|1538095_1538932_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_151603219.1|1539122_1539695_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_142273976.1|1540096_1541244_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.7	4.6e-148
WP_151603221.1|1541304_1541736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151602493.1|1541943_1543216_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.1	1.4e-145
WP_109455549.1|1543358_1544565_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
WP_151603223.1|1544800_1545340_-	helix-turn-helix domain-containing protein	NA	M9Q1K0	Clostridium_phage	51.7	1.6e-34
WP_151603225.1|1545577_1545928_-	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_151603227.1|1545924_1546356_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_052672191.1|1548319_1549117_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_045332109.1|1549212_1550841_-	PTS transporter subunit IICB	NA	NA	NA	NA	NA
WP_000019450.1|1551624_1552605_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
WP_139935786.1|1553037_1555668_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	30.8	3.5e-42
1553234:1553248	attL	AACTCATCCCTGAAA	NA	NA	NA	NA
WP_114385767.1|1555730_1555976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114385768.1|1556120_1556918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114385769.1|1557209_1557476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114385770.1|1557512_1559165_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_031617517.1|1559451_1560336_+	ParA family protein	NA	NA	NA	NA	NA
WP_032676543.1|1560332_1561700_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	54.2	2.3e-122
1562491:1562505	attR	TTTCAGGGATGAGTT	NA	NA	NA	NA
>prophage 113
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1565075	1574937	4919347		Klebsiella_phage(25.0%)	12	NA	NA
WP_001178480.1|1565075_1565306_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	46.6	2.0e-07
WP_032676549.1|1565384_1566617_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000818555.1|1566958_1567681_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_032676550.1|1567694_1569704_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	27.6	5.5e-40
WP_032676551.1|1570332_1570824_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_032676552.1|1570896_1571100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032676553.1|1571117_1571666_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	61.4	1.4e-51
WP_001144085.1|1571744_1571987_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_000155614.1|1571970_1572219_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_032676556.1|1572527_1573406_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032676557.1|1573408_1574281_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_032676558.1|1574277_1574937_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	25.6	5.8e-15
>prophage 114
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1588546	1589668	4919347	integrase	Pseudomonas_phage(100.0%)	1	1581790:1581802	1590565:1590577
1581790:1581802	attL	GCCCGCCGCGCCG	NA	NA	NA	NA
WP_032676573.1|1588546_1589668_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	45.3	2.9e-46
WP_032676573.1|1588546_1589668_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	45.3	2.9e-46
1590565:1590577	attR	CGGCGCGGCGGGC	NA	NA	NA	NA
>prophage 115
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1610243	1612931	4919347		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_032676599.1|1610243_1612931_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	19.2	3.1e-06
>prophage 116
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1620214	1622742	4919347	integrase	Macacine_betaherpesvirus(33.33%)	3	1612042:1612056	1621470:1621484
1612042:1612056	attL	AGCTGAGAAATTACG	NA	NA	NA	NA
WP_032676605.1|1620214_1621006_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	81.7	5.7e-49
WP_032676606.1|1621033_1622308_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.5	3.1e-153
1621470:1621484	attR	CGTAATTTCTCAGCT	NA	NA	NA	NA
WP_151603231.1|1622307_1622742_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	1.4e-28
>prophage 117
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1630960	1632394	4919347		Ochrobactrum_phage(100.0%)	1	NA	NA
WP_032676618.1|1630960_1632394_+	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	75.3	1.1e-37
>prophage 118
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1639663	1642515	4919347		Caulobacter_phage(50.0%)	3	NA	NA
WP_032676633.1|1639663_1640656_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.6	5.3e-52
WP_151603233.1|1640747_1641701_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000793034.1|1641831_1642515_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	37.6	9.6e-29
>prophage 119
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1656939	1658927	4919347		uncultured_virus(50.0%)	2	NA	NA
WP_125294674.1|1656939_1657233_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	36.8	3.3e-10
WP_125294673.1|1657280_1658927_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.3	5.8e-189
>prophage 120
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1663838	1667363	4919347		Morganella_phage(50.0%)	3	NA	NA
WP_125294665.1|1663838_1664369_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	57.3	4.2e-48
WP_151603245.1|1664436_1665651_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_151603247.1|1665821_1667363_+	PTS glucose transporter subunit IIB	NA	A0A2I7SAJ6	Vibrio_phage	38.4	7.3e-08
>prophage 121
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1675264	1676242	4919347		Tupanvirus(100.0%)	1	NA	NA
WP_151603255.1|1675264_1676242_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.0	8.9e-28
>prophage 122
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1684287	1689316	4919347		Diachasmimorpha_longicaudata_entomopoxvirus(33.33%)	4	NA	NA
WP_151603257.1|1684287_1684833_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.0	5.0e-28
WP_151603259.1|1685176_1685842_-	fructose-6-phosphate aldolase	NA	A0A1D8KSY7	Synechococcus_phage	31.8	1.3e-22
WP_125294646.1|1685979_1686879_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_151603261.1|1686883_1689316_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	49.1	1.0e-08
>prophage 123
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1694096	1697300	4919347		Vibrio_phage(50.0%)	2	NA	NA
WP_151603269.1|1694096_1695437_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.2	4.4e-17
WP_125294166.1|1695446_1697300_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.5	7.5e-60
>prophage 124
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1702819	1711740	4919347		Pithovirus(33.33%)	6	NA	NA
WP_002434131.1|1702819_1704118_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	4.9e-66
WP_125294321.1|1704270_1704696_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_151603273.1|1704806_1707251_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.7	3.4e-68
WP_125294174.1|1707334_1708069_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_151603275.1|1708174_1709809_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_151603277.1|1709805_1711740_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.9	1.2e-15
>prophage 125
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1747279	1755494	4919347		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_125294207.1|1747279_1747810_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	5.5e-56
WP_125294208.1|1748210_1749167_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144131263.1|1749235_1750738_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	25.2	1.4e-11
WP_125294210.1|1750747_1751767_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_125294211.1|1751759_1752761_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_151603311.1|1752862_1754428_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.6	1.3e-15
WP_144131266.1|1754495_1755494_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	43.3	1.0e-71
>prophage 126
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1764786	1777842	4919347		Ectocarpus_siliculosus_virus(16.67%)	15	NA	NA
WP_144131274.1|1764786_1767123_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	Q8QKV7	Ectocarpus_siliculosus_virus	29.0	8.4e-40
WP_151603315.1|1767351_1768005_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_151603317.1|1768001_1768730_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_125294223.1|1768745_1769018_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_125294224.1|1769014_1769869_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_125294225.1|1769929_1770409_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_125294226.1|1770492_1770780_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_125294227.1|1770802_1772236_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_125294228.1|1772403_1773129_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	2.4e-22
WP_144131278.1|1773135_1773693_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_125294230.1|1773661_1774237_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_125294231.1|1774233_1774800_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	80.0	5.9e-56
WP_125294232.1|1774817_1775804_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	33.2	3.5e-40
WP_125294233.1|1775817_1776795_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_125294234.1|1777026_1777842_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	28.8	2.4e-18
>prophage 127
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1781895	1783336	4919347		Vibrio_phage(50.0%)	2	NA	NA
WP_125294239.1|1781895_1782159_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	65.6	6.1e-16
WP_144131282.1|1782364_1783336_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	27.1	1.9e-09
>prophage 128
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1790002	1792864	4919347	protease	Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_040459606.1|1790002_1791934_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	48.7	9.1e-117
WP_144131287.1|1792015_1792864_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	31.9	3.7e-22
>prophage 129
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1800872	1803587	4919347		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_151603334.1|1800872_1803587_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.2	4.4e-24
>prophage 130
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1808979	1810923	4919347		Klosneuvirus(100.0%)	1	NA	NA
WP_125294260.1|1808979_1810923_+	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A1V0SIR5	Klosneuvirus	35.0	6.1e-52
>prophage 131
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1816600	1824611	4919347	transposase	Diadromus_pulchellus_ascovirus(20.0%)	10	NA	NA
WP_125294267.1|1816600_1816903_-	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	45.5	6.8e-11
WP_144131318.1|1816997_1817420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125294269.1|1817423_1817942_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.6	2.6e-10
WP_109455549.1|1818097_1819304_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
WP_151603342.1|1819410_1820058_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_125294271.1|1820094_1820670_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_125294272.1|1820679_1821270_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	32.5	1.9e-12
WP_125294273.1|1821299_1821689_-	YraN family protein	NA	NA	NA	NA	NA
WP_151603344.1|1821646_1823683_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_125294275.1|1823747_1824611_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.1	9.0e-48
>prophage 132
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1834188	1837936	4919347		Streptococcus_phage(50.0%)	3	NA	NA
WP_125294325.1|1834188_1835334_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.6	1.4e-48
WP_125294285.1|1836066_1837188_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_151605606.1|1837288_1837936_+	NUDIX domain-containing protein	NA	D0R7J3	Paenibacillus_phage	35.0	1.6e-09
>prophage 133
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1852768	1853737	4919347		Enterobacteria_phage(100.0%)	1	NA	NA
WP_125294303.1|1852768_1853737_-	TerC family protein	NA	A0A140G639	Enterobacteria_phage	33.9	4.0e-36
>prophage 134
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1863385	1864674	4919347		Morganella_phage(50.0%)	2	NA	NA
WP_125294311.1|1863385_1864126_-	DNA replication protein DnaC	NA	A0A1W6JP39	Morganella_phage	48.1	2.1e-61
WP_125294312.1|1864128_1864674_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	64.9	5.9e-29
>prophage 135
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1871236	1872304	4919347		Bacillus_phage(100.0%)	1	NA	NA
WP_151603379.1|1871236_1872304_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.9	3.4e-20
>prophage 136
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1876052	1878974	4919347		Streptococcus_phage(50.0%)	3	NA	NA
WP_144131361.1|1876052_1877642_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	27.0	5.3e-30
WP_125293787.1|1878058_1878682_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_002437547.1|1878812_1878974_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	8.0e-11
>prophage 137
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1884500	1885823	4919347		Geobacillus_virus(100.0%)	1	NA	NA
WP_151603391.1|1884500_1885823_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.2	1.7e-77
>prophage 138
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1893570	1898216	4919347		Enterococcus_phage(33.33%)	3	NA	NA
WP_125293773.1|1893570_1894803_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.7	3.1e-86
WP_151603396.1|1894848_1896273_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.9	1.9e-34
WP_151603398.1|1896695_1898216_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.6	1.3e-36
>prophage 139
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1914074	1915118	4919347		Bacillus_virus(100.0%)	1	NA	NA
WP_151603418.1|1914074_1915118_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	2.3e-34
>prophage 140
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1924389	1933931	4919347		Yellowstone_lake_phycodnavirus(25.0%)	8	NA	NA
WP_125293749.1|1924389_1924965_+	DJ-1/PfpI family protein	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	32.4	1.5e-14
WP_125293748.1|1925013_1927566_+	glycyl radical protein	NA	A0A249Y0V4	Salmonella_phage	45.6	2.7e-07
WP_151603435.1|1927675_1928593_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_151603437.1|1928738_1929644_+	permease	NA	NA	NA	NA	NA
WP_151603439.1|1929758_1930304_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_151603441.1|1930348_1931500_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.7	1.6e-108
WP_151603443.1|1931619_1932684_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_125293742.1|1932701_1933931_-	ATPase	NA	Q9EYF3	Enterobacteria_phage	27.3	2.7e-13
>prophage 141
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1943281	1951968	4919347	tRNA	Vibrio_phage(25.0%)	8	NA	NA
WP_125293733.1|1943281_1945126_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_151603456.1|1945279_1947022_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.1	3.2e-76
WP_001144069.1|1947200_1947416_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_151603457.1|1947661_1948675_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	60.9	1.6e-112
WP_125293730.1|1948690_1949308_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_125293729.1|1949414_1949783_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_151603459.1|1949897_1950716_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_151603461.1|1950732_1951968_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	49.7	1.1e-88
>prophage 142
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1957141	1963714	4919347		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_125293724.1|1957141_1958575_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	1.8e-40
WP_125293723.1|1958608_1958953_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_151603469.1|1959370_1960024_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	1.8e-45
WP_125293721.1|1960086_1960860_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_151603470.1|1961056_1961845_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_151603473.1|1961878_1963039_-	hypothetical protein	NA	B2ZXR7	Ralstonia_phage	43.4	4.1e-88
WP_151603475.1|1963042_1963714_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	47.5	2.4e-40
>prophage 143
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1968100	1980797	4919347		Bacillus_virus(50.0%)	9	NA	NA
WP_151603479.1|1968100_1969993_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	36.4	3.1e-93
WP_125293711.1|1970056_1970371_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_125293710.1|1970460_1971042_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_151603481.1|1971292_1973563_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.2	5.2e-87
WP_125293708.1|1973787_1974525_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_151603483.1|1974582_1975995_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_151603485.1|1976122_1978306_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.7e-104
WP_151603487.1|1978342_1979797_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_151603489.1|1979969_1980797_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.6	7.2e-63
>prophage 144
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	1986602	1987499	4919347		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_125293697.1|1986602_1987499_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.5	1.5e-66
>prophage 145
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2005515	2006241	4919347		Planktothrix_phage(100.0%)	1	NA	NA
WP_125293679.1|2005515_2006241_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	2.0e-32
>prophage 146
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2022101	2023145	4919347		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_125293662.1|2022101_2023145_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	57.0	2.5e-105
>prophage 147
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2027371	2027935	4919347		Sphingobium_phage(100.0%)	1	NA	NA
WP_151603532.1|2027371_2027935_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	9.7e-11
>prophage 148
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2050775	2057231	4919347		Mamastrovirus(33.33%)	5	NA	NA
WP_151605613.1|2050775_2052326_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	50.0	1.6e-15
WP_151603548.1|2052376_2054776_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_151603550.1|2054959_2055508_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	36.1	8.0e-18
WP_125293636.1|2055534_2056197_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_151603552.1|2056304_2057231_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.7	3.1e-22
>prophage 149
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2062610	2069403	4919347	tRNA	Bacillus_virus(50.0%)	6	NA	NA
WP_144131519.1|2062610_2064047_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	30.3	2.9e-27
WP_144131521.1|2064063_2064945_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_002436912.1|2065004_2065460_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_151603560.1|2065638_2066343_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_151603562.1|2066355_2066883_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_151603564.1|2066970_2069403_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	29.7	2.4e-37
>prophage 150
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2074583	2075381	4919347		Planktothrix_phage(100.0%)	1	NA	NA
WP_125293621.1|2074583_2075381_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	28.3	7.1e-15
>prophage 151
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2083098	2083443	4919347		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_125293614.1|2083098_2083443_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	3.5e-27
>prophage 152
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2087363	2088794	4919347	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_125293609.1|2087363_2088794_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	3.2e-26
>prophage 153
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2100231	2100990	4919347		Flavobacterium_phage(100.0%)	1	NA	NA
WP_125293794.1|2100231_2100990_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	41.5	5.5e-25
>prophage 154
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2109801	2113912	4919347		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_125293594.1|2109801_2110398_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.7	2.7e-27
WP_125293593.1|2110429_2113912_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.9e-206
>prophage 155
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2126144	2127176	4919347		Planktothrix_phage(100.0%)	1	NA	NA
WP_125293579.1|2126144_2127176_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	4.7e-35
>prophage 156
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2133545	2140599	4919347		Burkholderia_virus(25.0%)	8	NA	NA
WP_125295169.1|2133545_2134451_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.8	4.0e-14
WP_125295176.1|2134709_2135513_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_151603606.1|2135582_2136350_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_151603608.1|2136401_2137766_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	35.1	1.7e-08
WP_151603610.1|2137837_2138593_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_125295165.1|2138626_2139346_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_125295164.1|2139338_2139875_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	55.7	2.9e-49
WP_151603612.1|2139867_2140599_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.3	2.4e-38
>prophage 157
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2145840	2146422	4919347		Caulobacter_phage(100.0%)	1	NA	NA
WP_125295137.1|2145840_2146422_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	31.4	2.8e-13
>prophage 158
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2160243	2163959	4919347		Streptococcus_phage(66.67%)	3	NA	NA
WP_151603624.1|2160243_2161299_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.8	8.0e-115
WP_125295120.1|2161591_2162695_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.7	4.2e-58
WP_144129894.1|2162705_2163959_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	1.5e-99
>prophage 159
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2168138	2170402	4919347	integrase	Salmonella_phage(100.0%)	2	2163541:2163557	2179950:2179966
2163541:2163557	attL	CCAGCGGCGTGACGCTG	NA	NA	NA	NA
WP_004883034.1|2168138_2169338_+|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	22.6	1.3e-07
WP_004883035.1|2169334_2170402_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	40.7	9.5e-23
2179950:2179966	attR	CAGCGTCACGCCGCTGG	NA	NA	NA	NA
>prophage 160
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2178565	2181543	4919347		Cronobacter_phage(50.0%)	2	NA	NA
WP_004883049.1|2178565_2179396_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	39.6	8.4e-43
WP_004883050.1|2179476_2181543_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.8	2.4e-22
>prophage 161
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2186576	2187215	4919347		Halomonas_phage(100.0%)	1	NA	NA
WP_004883061.1|2186576_2187215_+	AAA family ATPase	NA	B0ZSI1	Halomonas_phage	40.1	1.1e-31
>prophage 162
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2226084	2226906	4919347		Pithovirus(100.0%)	1	NA	NA
WP_023093371.1|2226084_2226906_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	29.1	4.1e-10
>prophage 163
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2232535	2241376	4919347		uncultured_Caudovirales_phage(25.0%)	12	NA	NA
WP_003092312.1|2232535_2233174_-	AAA family ATPase	NA	A0A2H4JGZ2	uncultured_Caudovirales_phage	40.0	3.5e-33
WP_071534288.1|2233170_2233401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022652188.1|2233415_2234261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247107.1|2234287_2234572_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003092318.1|2234683_2235454_-	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_016487838.1|2235796_2236144_-	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	46.8	6.6e-18
WP_006379425.1|2236431_2236725_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001273857.1|2237037_2237352_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_086006326.1|2237370_2237766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022580212.1|2238127_2238337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000994919.1|2238398_2240468_-	chromosome partitioning protein ParB	NA	A0A0F7L836	uncultured_marine_virus	34.9	2.5e-11
WP_003092327.1|2240548_2241376_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	39.6	1.6e-46
>prophage 164
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2245152	2246217	4919347		Salmonella_phage(100.0%)	1	NA	NA
WP_003092331.1|2245152_2246217_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	41.0	7.2e-23
>prophage 165
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2266431	2266890	4919347		Bordetella_phage(100.0%)	1	NA	NA
WP_151603647.1|2266431_2266890_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.1	4.5e-14
>prophage 166
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2281466	2284755	4919347		Staphylococcus_phage(50.0%)	3	NA	NA
WP_151603670.1|2281466_2283023_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	2.2e-105
WP_151603672.1|2283211_2283865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151603674.1|2283861_2284755_-	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	41.4	7.9e-31
>prophage 167
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2289739	2291038	4919347	integrase	Ralstonia_phage(100.0%)	1	2286056:2286069	2292922:2292935
2286056:2286069	attL	ACAACTTTTATTTA	NA	NA	NA	NA
WP_151603684.1|2289739_2291038_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	27.0	4.0e-07
WP_151603684.1|2289739_2291038_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	27.0	4.0e-07
2292922:2292935	attR	ACAACTTTTATTTA	NA	NA	NA	NA
>prophage 168
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2294577	2295552	4919347		Erwinia_phage(100.0%)	1	NA	NA
WP_151603690.1|2294577_2295552_+	UV damage endonuclease UvsE	NA	A0A2H4IBJ4	Erwinia_phage	50.9	5.3e-89
>prophage 169
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2299621	2304261	4919347		Burkholderia_virus(33.33%)	5	NA	NA
WP_151603697.1|2299621_2300548_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.4	7.2e-11
WP_125295091.1|2300719_2301670_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_125295090.1|2301678_2302785_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_125295089.1|2302781_2303549_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	2.8e-16
WP_151603699.1|2303541_2304261_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	26.0	3.9e-12
>prophage 170
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2327672	2329163	4919347		Burkholderia_virus(100.0%)	1	NA	NA
WP_144129990.1|2327672_2329163_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.5	3.2e-08
>prophage 171
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2333824	2355109	4919347	transposase	Acinetobacter_phage(18.18%)	21	NA	NA
WP_151603733.1|2333824_2334904_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.5	1.7e-40
WP_125295070.1|2334896_2335676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144130002.1|2335668_2336796_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.5	1.8e-32
WP_151603735.1|2336782_2337859_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
WP_125295067.1|2338185_2338770_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	7.5e-14
WP_144130006.1|2338766_2339927_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_144130008.1|2339949_2340405_+	Tellurium resistance protein TerB	NA	A0A1B2IBD1	Erwinia_phage	26.8	2.0e-06
WP_125295064.1|2340427_2341471_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	48.8	5.9e-78
WP_125295063.1|2341519_2342098_+	TerD family protein	NA	A0A2P1N0L4	Streptomyces_phage	38.3	9.7e-06
WP_125295062.1|2342160_2342736_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	39.6	8.1e-29
WP_151605616.1|2342864_2343083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144130024.1|2343476_2344148_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_151603737.1|2344480_2346376_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.6	5.6e-10
WP_151603739.1|2346446_2347127_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_151603741.1|2347130_2347754_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_151605617.1|2348013_2348997_+	purine nucleoside permease	NA	NA	NA	NA	NA
WP_125295565.1|2349264_2350281_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	35.1	1.1e-33
WP_125295564.1|2350273_2350942_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_144130032.1|2350963_2351767_+	methionine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_151603743.1|2351823_2353767_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.0	2.6e-18
WP_151602493.1|2353836_2355109_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.1	1.4e-145
>prophage 172
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2372092	2373202	4919347		Bacillus_phage(100.0%)	1	NA	NA
WP_151603755.1|2372092_2373202_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	32.9	2.5e-18
>prophage 173
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2377892	2386731	4919347		Bacillus_phage(50.0%)	6	NA	NA
WP_125295571.1|2377892_2378804_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	6.0e-103
WP_125295534.1|2378929_2379835_+	fructokinase	NA	NA	NA	NA	NA
WP_151603765.1|2380164_2383308_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	24.7	2.6e-12
WP_151605618.1|2383304_2384519_-	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_002437058.1|2384707_2385397_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	7.4e-37
WP_144130060.1|2385420_2386731_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.1	7.0e-28
>prophage 174
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2398852	2403191	4919347	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_144130074.1|2398852_2399980_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	7.3e-90
WP_000007630.1|2400001_2400334_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_125294035.1|2400361_2402209_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_125294036.1|2402219_2403191_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	40.7	4.7e-45
>prophage 175
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2407060	2408726	4919347		Indivirus(50.0%)	2	NA	NA
WP_151603785.1|2407060_2408164_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.7	6.1e-49
WP_151603787.1|2408255_2408726_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.1	6.6e-29
>prophage 176
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2417366	2419550	4919347		Bacillus_phage(100.0%)	1	NA	NA
WP_151603797.1|2417366_2419550_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.6	4.9e-34
>prophage 177
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2433685	2434237	4919347		Escherichia_phage(100.0%)	1	NA	NA
WP_125294059.1|2433685_2434237_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	38.8	4.5e-37
>prophage 178
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2448618	2453669	4919347	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_125294074.1|2448618_2449242_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.9	4.9e-64
WP_125294075.1|2449374_2450649_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.1	1.9e-131
WP_125294076.1|2450831_2453186_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	1.8e-223
WP_125294077.1|2453396_2453669_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	59.6	3.8e-21
>prophage 179
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2456845	2457541	4919347		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_125294081.1|2456845_2457541_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	66.7	1.2e-87
>prophage 180
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2461954	2465495	4919347		Bacillus_phage(100.0%)	2	NA	NA
WP_151603827.1|2461954_2463724_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	3.6e-51
WP_151603829.1|2463716_2465495_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	3.4e-41
>prophage 181
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2471587	2472795	4919347	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_109455549.1|2471587_2472795_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
>prophage 182
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2486856	2488110	4919347		Aeromonas_phage(100.0%)	1	NA	NA
WP_125294104.1|2486856_2488110_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	5.0e-100
>prophage 183
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2495694	2502101	4919347		Faustovirus(20.0%)	8	NA	NA
WP_125294110.1|2495694_2496909_+	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.1	3.0e-33
WP_002463695.1|2496937_2497324_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_125294111.1|2497348_2497672_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	7.0e-22
WP_151603853.1|2497817_2498333_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_151603855.1|2498348_2500199_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.4	3.6e-102
WP_002463685.1|2500200_2500536_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_002463684.1|2500551_2500752_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_125294114.1|2500814_2502101_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	33.8	9.0e-36
>prophage 184
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2511442	2511874	4919347		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_125294119.1|2511442_2511874_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	7.4e-19
>prophage 185
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2520813	2525965	4919347		Indivirus(33.33%)	4	NA	NA
WP_151603867.1|2520813_2522196_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	39.7	1.5e-44
WP_125294129.1|2522365_2523832_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.3	9.8e-87
WP_144130142.1|2523900_2525478_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_125294131.1|2525773_2525965_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	73.0	3.9e-20
>prophage 186
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2532386	2537496	4919347		Prochlorococcus_phage(50.0%)	6	NA	NA
WP_125294135.1|2532386_2533028_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	43.1	2.4e-29
WP_125294136.1|2533027_2534065_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	45.1	1.3e-72
WP_002463640.1|2534288_2534915_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_125294137.1|2535021_2536308_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.0	3.7e-66
WP_125294138.1|2536381_2537107_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_125294139.1|2537139_2537496_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	51.8	1.1e-23
>prophage 187
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2543539	2544253	4919347		Cyanophage(100.0%)	1	NA	NA
WP_125294146.1|2543539_2544253_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	36.6	3.1e-38
>prophage 188
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2569039	2569990	4919347		Cyanophage(100.0%)	1	NA	NA
WP_125295678.1|2569039_2569990_-	transaldolase	NA	A0A127KMN5	Cyanophage	34.6	3.1e-09
>prophage 189
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2573519	2585049	4919347	transposase	uncultured_Caudovirales_phage(20.0%)	11	NA	NA
WP_125295674.1|2573519_2574389_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	32.6	1.6e-20
WP_151603892.1|2574605_2575031_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_125295672.1|2575058_2575478_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	48.5	8.8e-25
WP_151603894.1|2575647_2576646_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_151605624.1|2576774_2577212_+	DUF2919 family protein	NA	NA	NA	NA	NA
WP_151603896.1|2577275_2577848_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_144130170.1|2577948_2578848_+	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	34.4	5.9e-26
WP_125295668.1|2578902_2580150_-	formyl-CoA transferase	NA	NA	NA	NA	NA
WP_125295667.1|2580266_2580653_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_109455549.1|2581475_2582682_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
WP_151603898.1|2583300_2585049_-	oxalyl-CoA decarboxylase	NA	H8ZJ31	Ostreococcus_tauri_virus	23.6	1.5e-17
>prophage 190
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2590488	2603854	4919347		Streptococcus_phage(33.33%)	13	NA	NA
WP_125295659.1|2590488_2591574_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	4.3e-31
WP_151603900.1|2591643_2592555_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.6	5.4e-59
WP_144130181.1|2592608_2593454_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_002463576.1|2593507_2594011_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_151603902.1|2594054_2595782_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.0	4.3e-17
WP_002463574.1|2595825_2596083_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_151603904.1|2596463_2597435_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	51.0	1.3e-74
WP_144130185.1|2597597_2598359_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_151603906.1|2598587_2599523_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_151603908.1|2599592_2601611_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.8	5.2e-147
WP_125295650.1|2601612_2601825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151603910.1|2601827_2602826_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_125295648.1|2602912_2603854_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.7	9.6e-11
>prophage 191
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2618835	2620191	4919347		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_151605625.1|2618835_2620191_-	adenylosuccinate lyase family protein	NA	A0A2H4UUU6	Bodo_saltans_virus	22.9	1.2e-06
>prophage 192
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2627679	2628411	4919347		Clostridioides_phage(100.0%)	1	NA	NA
WP_151603935.1|2627679_2628411_-	response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.6	1.8e-12
>prophage 193
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2633512	2635289	4919347		Enterobacteria_phage(50.0%)	2	NA	NA
WP_125291481.1|2633512_2634472_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	82.2	5.2e-129
WP_125291482.1|2634671_2635289_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	31.0	6.5e-16
>prophage 194
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2650519	2651605	4919347		Pandoravirus(100.0%)	1	NA	NA
WP_144130230.1|2650519_2651605_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.7	2.7e-89
>prophage 195
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2662615	2663752	4919347		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_151603948.1|2662615_2663752_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	26.9	4.4e-18
>prophage 196
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2670202	2671720	4919347		Mollivirus(100.0%)	1	NA	NA
WP_125291513.1|2670202_2671720_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.6	1.2e-87
>prophage 197
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2676042	2676816	4919347		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_151603958.1|2676042_2676816_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	27.7	1.5e-06
>prophage 198
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2695406	2696006	4919347		Salmonella_phage(100.0%)	1	NA	NA
WP_125291537.1|2695406_2696006_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	37.6	1.2e-06
>prophage 199
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2724299	2725748	4919347		Tupanvirus(100.0%)	1	NA	NA
WP_144130294.1|2724299_2725748_-	catalase	NA	A0A2K9L0T1	Tupanvirus	46.4	5.5e-98
>prophage 200
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2728851	2730057	4919347		Oenococcus_phage(100.0%)	1	NA	NA
WP_151603998.1|2728851_2730057_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	7.9e-26
>prophage 201
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2737970	2745574	4919347		Pseudomonas_phage(50.0%)	5	NA	NA
WP_144130302.1|2737970_2738225_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	71.6	4.5e-24
WP_125291573.1|2738226_2739357_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	80.5	3.5e-177
WP_125291574.1|2739411_2741697_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.7	4.6e-285
WP_125291575.1|2742044_2742779_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_125291576.1|2742937_2745574_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	33.2	1.3e-100
>prophage 202
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2753061	2755911	4919347		Hokovirus(100.0%)	1	NA	NA
WP_125291582.1|2753061_2755911_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.7	1.2e-40
>prophage 203
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2761564	2767626	4919347		Powai_lake_megavirus(33.33%)	5	NA	NA
WP_151604019.1|2761564_2762629_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A167R6J9	Powai_lake_megavirus	54.3	2.4e-18
WP_151604021.1|2762628_2763279_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_125291589.1|2763362_2765009_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.8	6.1e-13
WP_144130318.1|2765182_2766616_+	magnesium transporter	NA	NA	NA	NA	NA
WP_151604023.1|2766645_2767626_-	transaldolase	NA	A0A127KMN5	Cyanophage	34.0	3.4e-11
>prophage 204
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2778546	2789163	4919347		Vibrio_phage(40.0%)	10	NA	NA
WP_125291601.1|2778546_2779221_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	65.0	5.9e-87
WP_151604034.1|2779463_2781227_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_125291603.1|2781246_2781474_-	YejL family protein	NA	NA	NA	NA	NA
WP_125291604.1|2781608_2782613_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.2	5.9e-83
WP_125291605.1|2782666_2782951_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_151604036.1|2783075_2784833_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	43.3	1.6e-104
WP_125291607.1|2784974_2785682_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_144130339.1|2785697_2786891_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.6	8.1e-23
WP_125291609.1|2787228_2787570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151604037.1|2787573_2789163_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.0	2.0e-21
>prophage 205
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2794951	2799261	4919347		Clostridioides_phage(50.0%)	4	NA	NA
WP_125291615.1|2794951_2795521_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	2.1e-13
WP_144130349.1|2795936_2796650_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_151604043.1|2796696_2797674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604045.1|2797794_2799261_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.7	3.4e-47
>prophage 206
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2805860	2806718	4919347		Indivirus(100.0%)	1	NA	NA
WP_151604053.1|2805860_2806718_-	deoxyribonuclease IV	NA	A0A1V0SCI4	Indivirus	30.0	8.1e-25
>prophage 207
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2810672	2815578	4919347		Acinetobacter_phage(50.0%)	4	NA	NA
WP_151604057.1|2810672_2812637_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.0	4.0e-11
WP_151604059.1|2812689_2813532_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_151604061.1|2813657_2814806_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_125291632.1|2814909_2815578_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	9.0e-56
>prophage 208
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2819281	2820802	4919347		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_125291636.1|2819281_2820802_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.5	5.3e-11
>prophage 209
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2831909	2837984	4919347	transposase	Leptospira_phage(25.0%)	6	NA	NA
WP_151602257.1|2831909_2833029_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.7	3.0e-51
WP_151604075.1|2833162_2833468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151604077.1|2833464_2833839_+	hypothetical protein	NA	A0A097EXN9	Escherichia_phage	36.1	4.8e-06
WP_151604079.1|2834284_2834728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109455549.1|2834757_2835964_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
WP_151604081.1|2836331_2837984_-	hypothetical protein	NA	Q3HQV4	Burkholderia_phage	34.6	1.6e-69
>prophage 210
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2844172	2844727	4919347		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_151604091.1|2844172_2844727_-	GNAT family N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	43.9	1.1e-25
>prophage 211
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2851304	2864479	4919347	transposase,tRNA	Enterobacteria_phage(50.0%)	12	NA	NA
WP_151604097.1|2851304_2852246_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.7	4.9e-23
WP_125291655.1|2852229_2852961_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_125291656.1|2852938_2853049_-	protein YohO	NA	NA	NA	NA	NA
WP_125291657.1|2853126_2853870_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	73.1	1.1e-81
WP_151604099.1|2854017_2856048_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	28.1	1.0e-57
WP_125291659.1|2856203_2857313_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_125291660.1|2857318_2857816_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_144130397.1|2857878_2859567_+	GAF domain-containing protein	NA	Q9EYF3	Enterobacteria_phage	84.3	5.0e-260
WP_144130399.1|2859560_2860280_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_144130401.1|2860355_2860829_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	72.7	2.3e-58
WP_125291664.1|2860935_2862741_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_142273976.1|2863332_2864479_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.7	4.6e-148
>prophage 212
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2868210	2869215	4919347		Bacillus_virus(100.0%)	1	NA	NA
WP_151604104.1|2868210_2869215_-	ADP-ribosylglycohydrolase family protein	NA	G3M9X5	Bacillus_virus	24.8	4.7e-08
>prophage 213
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2880505	2884129	4919347		Bacillus_phage(66.67%)	3	NA	NA
WP_151604116.1|2880505_2881867_-	U32 family peptidase	NA	Q6DW11	Phage_TP	91.0	6.1e-200
WP_151604118.1|2882003_2882726_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.3	2.9e-31
WP_125291696.1|2882722_2884129_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.3	7.5e-28
>prophage 214
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2900593	2901175	4919347		Saccharomonospora_phage(100.0%)	1	NA	NA
WP_144130456.1|2900593_2901175_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.1	7.4e-30
>prophage 215
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2911270	2913127	4919347		Planktothrix_phage(100.0%)	1	NA	NA
WP_151604150.1|2911270_2913127_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.6	6.3e-14
>prophage 216
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2923371	2924583	4919347		Stx2-converting_phage(100.0%)	1	NA	NA
WP_151604160.1|2923371_2924583_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.8	9.8e-101
>prophage 217
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2932841	2942158	4919347		Vibrio_phage(25.0%)	11	NA	NA
WP_125291731.1|2932841_2933108_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	1.7e-26
WP_125291732.1|2933304_2933595_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_151604166.1|2933578_2934301_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_151604168.1|2934378_2935281_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D8KN85	Synechococcus_phage	36.9	1.5e-37
WP_125291735.1|2935415_2935895_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_151604170.1|2936266_2937379_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_125291737.1|2937498_2938632_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	6.5e-30
WP_151604172.1|2938641_2939595_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_125291739.1|2939591_2940437_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_144130485.1|2940518_2940989_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_151604174.1|2941030_2942158_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.3	6.9e-24
>prophage 218
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2945993	2948793	4919347		Planktothrix_phage(50.0%)	4	NA	NA
WP_151604176.1|2945993_2946722_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	2.4e-30
WP_125291748.1|2946937_2947474_-	lipoprotein	NA	NA	NA	NA	NA
WP_125291749.1|2947642_2947966_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_125291750.1|2947962_2948793_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	29.5	5.1e-08
>prophage 219
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2952388	2954107	4919347		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_151604185.1|2952388_2954107_-	ubiquinone-dependent pyruvate dehydrogenase	NA	E4WLQ6	Ostreococcus_tauri_virus	24.2	1.0e-26
>prophage 220
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2957335	2958455	4919347	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_151602257.1|2957335_2958455_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.7	3.0e-51
>prophage 221
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2968164	2993041	4919347	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	18	NA	NA
WP_151604198.1|2968164_2970105_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.6	5.5e-37
WP_125291764.1|2970177_2970402_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	1.6e-17
WP_002463110.1|2970727_2971048_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.0	1.1e-11
WP_125291765.1|2971076_2973350_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	7.3e-166
WP_001040187.1|2973441_2973660_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_125291766.1|2973924_2974632_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_151604200.1|2974663_2976397_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.0	1.0e-21
WP_144130509.1|2976397_2978164_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	F2Y302	Organic_Lake_phycodnavirus	26.8	1.9e-12
WP_151604202.1|2978278_2979247_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.4	2.3e-60
WP_000228469.1|2979812_2980307_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_151604204.1|2980427_2984153_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	1.2e-88
WP_125291771.1|2984300_2984912_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_151604206.1|2984920_2986264_+	AAA family ATPase	NA	G3MBE0	Bacillus_virus	41.0	3.3e-81
WP_151604208.1|2986353_2987646_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.9	7.3e-94
WP_125291774.1|2987694_2988318_-	hydrolase	NA	NA	NA	NA	NA
WP_125291775.1|2988619_2989768_+	MFS transporter	NA	NA	NA	NA	NA
WP_125291776.1|2989819_2990560_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	1.2e-21
WP_151604210.1|2990758_2993041_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.2	3.2e-161
>prophage 222
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	2997109	2998195	4919347		Streptococcus_phage(100.0%)	1	NA	NA
WP_125291781.1|2997109_2998195_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	45.8	2.9e-80
>prophage 223
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3002288	3006820	4919347		Bacillus_phage(100.0%)	3	NA	NA
WP_125291785.1|3002288_3002573_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	39.1	7.1e-10
WP_151604216.1|3002773_3005035_+	ComEC family protein	NA	NA	NA	NA	NA
WP_125291787.1|3005071_3006820_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.4	1.9e-57
>prophage 224
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3024096	3027190	4919347	tRNA	Enterobacteria_phage(50.0%)	2	NA	NA
WP_151605634.1|3024096_3025206_-	porin	NA	Q1MVN1	Enterobacteria_phage	50.0	2.9e-91
WP_151604232.1|3025789_3027190_-|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	35.0	5.7e-76
>prophage 225
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3034004	3039261	4919347		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_151604240.1|3034004_3035117_-	MOSC domain-containing protein	NA	E3SNZ1	Prochlorococcus_phage	37.0	2.4e-05
WP_151604242.1|3035229_3037347_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_125291810.1|3037353_3039261_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.6	2.1e-49
>prophage 226
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3051781	3053836	4919347		Bacillus_phage(100.0%)	1	NA	NA
WP_151604248.1|3051781_3053836_+	DNA helicase IV	NA	A0A1P8CWU5	Bacillus_phage	23.8	5.5e-11
>prophage 227
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3058041	3058701	4919347	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_125291833.1|3058041_3058701_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	4.9e-46
>prophage 228
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3079420	3083901	4919347	transposase	Shigella_phage(100.0%)	4	NA	NA
WP_142273976.1|3079420_3080568_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.7	4.6e-148
WP_109455549.1|3080660_3081867_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
WP_151604268.1|3082091_3082574_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_151602493.1|3082627_3083901_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.1	1.4e-145
>prophage 229
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3094571	3095582	4919347		Bacillus_virus(100.0%)	1	NA	NA
WP_151604284.1|3094571_3095582_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.7	2.0e-14
>prophage 230
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3107590	3108343	4919347		Bacillus_virus(100.0%)	1	NA	NA
WP_151604292.1|3107590_3108343_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.9e-26
>prophage 231
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3126001	3211327	4919347	lysis,tRNA,terminase,capsid,holin,tail,transposase,protease,portal,head	Enterobacteria_phage(27.14%)	101	NA	NA
WP_087703402.1|3126001_3127148_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	6.6e-147
WP_151604306.1|3128185_3130633_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_151604308.1|3130677_3131889_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_144132647.1|3132094_3132334_+	DUF2492 family protein	NA	NA	NA	NA	NA
WP_125291890.1|3132364_3132862_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_125291891.1|3133101_3133434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604310.1|3133666_3134305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151604312.1|3134340_3135753_-	MFS transporter	NA	NA	NA	NA	NA
WP_085949471.1|3135972_3136056_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_125291894.1|3136212_3136461_+	DUF2766 family protein	NA	NA	NA	NA	NA
WP_151604314.1|3136710_3139035_+	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_151604316.1|3139481_3140695_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	56.4	1.5e-96
WP_151604318.1|3141451_3141946_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_125291896.1|3143857_3145588_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.6	8.0e-88
WP_151604320.1|3145781_3146345_+	VOC family protein	NA	NA	NA	NA	NA
WP_151604322.1|3146514_3147255_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_151605638.1|3147468_3147729_-	pyocin activator protein PrtN	NA	A0A1D9C9N7	Salinivibrio_phage	50.6	1.1e-14
WP_151604324.1|3147728_3148472_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	76.7	2.2e-103
WP_151604326.1|3148483_3149062_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	65.1	3.5e-72
WP_151604328.1|3149072_3149477_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	51.6	2.2e-28
WP_151604330.1|3149473_3149695_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	65.3	5.5e-18
WP_151604332.1|3149666_3149918_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	79.7	2.6e-24
WP_151604334.1|3149914_3150274_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	63.6	3.5e-30
WP_151604336.1|3150257_3150482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604338.1|3150578_3151004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604340.1|3151065_3151350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604342.1|3151493_3152162_-	hypothetical protein	NA	K7PH71	Enterobacterial_phage	58.5	1.2e-55
WP_151604344.1|3152268_3152511_+	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_151604346.1|3152500_3152779_+	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	61.4	5.1e-21
WP_151604348.1|3153058_3154723_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	72.4	2.3e-233
WP_151604349.1|3154719_3155685_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	69.5	2.2e-135
WP_151604351.1|3155684_3156545_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPA6	Escherichia_phage	82.1	1.0e-136
WP_151604353.1|3156541_3157378_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	72.6	1.8e-114
WP_151604355.1|3157799_3158207_-	HicB family protein	NA	NA	NA	NA	NA
WP_151604357.1|3158268_3158457_-	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_151604359.1|3158698_3159076_+	hypothetical protein	NA	F1C592	Cronobacter_phage	77.6	6.2e-46
WP_151604361.1|3159065_3159350_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	53.3	6.8e-21
WP_151604363.1|3159346_3159973_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	77.3	2.2e-88
WP_151604365.1|3159969_3160449_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	64.9	4.8e-43
WP_151604367.1|3160703_3161231_+	hypothetical protein	NA	Q38450	Enterobacteria_phage	53.5	3.0e-46
WP_151604369.1|3161568_3161856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151604371.1|3165842_3166145_+	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	71.0	1.5e-37
WP_151604373.1|3166145_3166820_+	hypothetical protein	NA	O64337	Escherichia_phage	64.9	8.8e-75
WP_151604375.1|3166878_3167589_+	hypothetical protein	NA	K7PM99	Enterobacterial_phage	56.0	3.0e-49
WP_109455549.1|3167623_3168831_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
WP_151604377.1|3169039_3169327_+	hypothetical protein	NA	W6ATR4	Escherichia_phage	66.7	2.8e-30
WP_151602257.1|3169353_3170474_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.7	3.0e-51
WP_151604379.1|3171482_3172454_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_151604381.1|3172446_3173193_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_151604383.1|3173232_3173628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604385.1|3173697_3174471_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.9	2.3e-58
WP_151604387.1|3174449_3175763_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	86.2	1.1e-225
WP_151604389.1|3175818_3176064_-	excisionase	NA	Q8W657	Enterobacteria_phage	86.8	1.2e-34
WP_151604391.1|3176047_3176434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605639.1|3176421_3177165_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	91.5	4.9e-127
WP_151605640.1|3177176_3177695_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	69.2	2.3e-67
WP_151604393.1|3177765_3178170_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	50.4	6.7e-30
WP_151604395.1|3178166_3178385_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	61.1	7.8e-17
WP_151604397.1|3178381_3178618_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	62.5	1.9e-13
WP_151604399.1|3178614_3178974_-	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	64.5	2.0e-30
WP_151604400.1|3178957_3179182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604402.1|3179278_3179704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604404.1|3179765_3180050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604406.1|3180192_3180861_-	hypothetical protein	NA	K7PH71	Enterobacterial_phage	58.5	1.5e-55
WP_151604408.1|3180967_3181210_+	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_151604410.1|3181199_3181475_+	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	61.4	3.9e-21
WP_151604412.1|3181756_3183421_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	73.8	1.1e-235
WP_151604414.1|3183417_3184383_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	69.2	2.4e-134
WP_151604416.1|3184382_3185243_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPA6	Escherichia_phage	83.2	3.9e-136
WP_151604418.1|3185239_3186076_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	73.7	8.2e-115
WP_151604420.1|3186591_3187011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604422.1|3187225_3187606_+	hypothetical protein	NA	F1C592	Cronobacter_phage	73.0	3.6e-41
WP_151604424.1|3187595_3187880_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	52.2	1.5e-20
WP_151604426.1|3187876_3188503_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.4	7.9e-86
WP_151604428.1|3188499_3188850_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.7	3.9e-10
WP_151604430.1|3189013_3189307_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	65.9	4.0e-24
WP_151604432.1|3189375_3189894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151604434.1|3190116_3190818_+	hypothetical protein	NA	G8C7Q4	Escherichia_phage	31.0	6.9e-14
WP_151604436.1|3190817_3191168_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	78.4	5.6e-49
WP_148051728.1|3191314_3191788_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	89.8	1.7e-77
WP_151604438.1|3191787_3193545_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	91.3	0.0e+00
WP_151604440.1|3193544_3194849_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	87.6	8.4e-223
WP_148051725.1|3194860_3195715_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	79.6	3.8e-123
WP_151604442.1|3195725_3196940_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	90.1	2.2e-201
WP_151604444.1|3196985_3197180_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	59.6	1.4e-09
WP_151604446.1|3197179_3197503_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	68.5	4.1e-38
WP_151604448.1|3197511_3197853_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	62.5	6.0e-32
WP_151604450.1|3197849_3198299_+	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	81.2	1.8e-63
WP_151604452.1|3198295_3198643_+	DUF3168 domain-containing protein	NA	K7P7Q9	Enterobacteria_phage	53.1	2.3e-26
WP_151604453.1|3198700_3199174_+|tail	phage tail protein	tail	A0A220NRQ0	Escherichia_phage	91.6	5.2e-74
WP_151604455.1|3199244_3199649_+|tail	phage tail protein	tail	A0A220NRP3	Escherichia_phage	70.1	4.8e-44
WP_151604457.1|3199672_3199936_+	DUF4035 domain-containing protein	NA	K7PLY6	Enterobacterial_phage	69.0	5.7e-30
WP_151604459.1|3199971_3203331_+|tail	phage tail tape measure protein	tail	K7PH87	Enterobacterial_phage	56.1	1.4e-237
WP_151604461.1|3203330_3203669_+|tail	phage tail protein	tail	K7PHJ6	Enterobacteria_phage	89.3	7.8e-56
WP_151604463.1|3203665_3204421_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	87.6	2.2e-130
WP_151604465.1|3204422_3205133_+	peptidase P60	NA	K7PGV2	Enterobacterial_phage	84.3	3.1e-123
WP_151604467.1|3205167_3205578_+	hypothetical protein	NA	K7PLY8	Enterobacterial_phage	71.3	1.0e-49
WP_151604468.1|3205634_3206234_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	64.3	2.4e-63
WP_151604470.1|3206235_3206781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604472.1|3206888_3210371_+	DUF1983 domain-containing protein	NA	K7P840	Enterobacteria_phage	76.9	0.0e+00
WP_151604473.1|3210370_3211327_+	hypothetical protein	NA	G5DMH8	Enterobacter_virus	44.8	6.6e-76
>prophage 232
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3214772	3227652	4919347	tRNA	Salmonella_phage(12.5%)	17	NA	NA
WP_151604477.1|3214772_3215303_+	phase 1 flagellin transcriptional repressor	NA	J9Q6L0	Salmonella_phage	31.2	6.3e-12
WP_151605641.1|3215406_3215460_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_151604479.1|3215497_3215872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604481.1|3215868_3216495_-	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	42.6	9.8e-20
WP_151604483.1|3217026_3217269_-	DinI-like family protein	NA	K7PKM2	Enterobacterial_phage	92.4	4.6e-34
WP_151604485.1|3217622_3218189_-	hydrolase	NA	NA	NA	NA	NA
WP_144132627.1|3218261_3218444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144132624.1|3218442_3220215_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	28.0	2.1e-11
WP_125291906.1|3220216_3220660_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_002462916.1|3220687_3221428_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_125291907.1|3221458_3221980_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	9.0e-11
WP_125291908.1|3222090_3222702_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_125291909.1|3222710_3223721_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.4	7.4e-09
WP_151604487.1|3223753_3224539_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_125291911.1|3224535_3225291_-	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.4	2.5e-14
WP_151604489.1|3225369_3226314_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_151604491.1|3226329_3227652_+	murein DD-endopeptidase MepM	NA	Q8SBN9	Clostridium_phage	38.9	4.5e-14
>prophage 233
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3231611	3233087	4919347		Cyanophage(100.0%)	1	NA	NA
WP_151604494.1|3231611_3233087_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.1	2.6e-79
>prophage 234
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3242369	3325270	4919347	capsid,terminase,tRNA,holin,tail,transposase,protease,integrase,portal,head	Enterobacteria_phage(21.43%)	98	3244589:3244615	3288559:3288585
WP_125291926.1|3242369_3242600_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	64.7	3.7e-17
WP_144132602.1|3242750_3243125_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_151604508.1|3243126_3244002_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_125291929.1|3244027_3244366_+	YebY family protein	NA	NA	NA	NA	NA
3244589:3244615	attL	AGGAATCGTATTCGGTCTTTTTTTATC	NA	NA	NA	NA
WP_151604510.1|3244698_3245781_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	48.5	4.2e-95
WP_151604512.1|3245755_3246028_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	48.3	1.5e-17
WP_151604514.1|3246092_3248678_-	exonuclease	NA	K7P6V4	Enterobacteria_phage	40.7	1.2e-127
WP_151604516.1|3248818_3249145_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_151604518.1|3249159_3249651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604520.1|3250125_3250554_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	60.3	4.2e-38
WP_151604522.1|3250643_3250874_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	59.2	3.6e-20
WP_151604523.1|3250876_3251431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151604525.1|3251485_3252310_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	47.1	9.4e-55
WP_151604527.1|3252312_3253053_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	71.1	1.8e-97
WP_151604529.1|3253071_3253797_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	26.1	2.9e-15
WP_151604531.1|3253786_3254098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151604533.1|3254094_3254487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151604535.1|3254489_3254765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151604537.1|3254761_3256630_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	51.1	7.1e-191
WP_151604539.1|3256791_3257016_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	64.9	1.7e-22
WP_151605642.1|3257082_3257316_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	58.2	9.9e-18
WP_151604541.1|3257440_3257644_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	51.5	1.3e-13
WP_151605643.1|3257643_3258015_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	71.8	8.0e-46
WP_151604543.1|3257999_3259034_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	53.5	3.9e-106
WP_151604546.1|3259046_3259661_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	57.6	9.2e-63
WP_151604548.1|3260061_3260877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125292274.1|3261063_3261441_+	hypothetical protein	NA	F1C592	Cronobacter_phage	80.8	1.8e-48
WP_125292273.1|3261430_3261715_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	54.3	3.1e-21
WP_151604550.1|3261714_3262191_+	glycoside hydrolase family protein	NA	K7P890	Enterobacteria_phage	76.4	1.9e-60
WP_151604552.1|3262187_3262550_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.8	1.6e-11
WP_151604554.1|3262731_3262959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151605644.1|3263085_3263343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151604556.1|3263401_3263605_+	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	84.8	1.2e-27
WP_151604558.1|3263773_3264490_+	hypothetical protein	NA	G8C7Q4	Escherichia_phage	30.7	2.9e-15
WP_151604560.1|3264494_3264785_+	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	92.7	1.4e-50
WP_151605645.1|3264899_3265334_+	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	94.4	1.9e-70
WP_151604561.1|3265344_3266877_+|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	96.1	2.6e-284
WP_151604563.1|3266879_3268157_+|portal	phage portal protein	portal	A0A286S1N5	Klebsiella_phage	96.2	6.9e-238
WP_151604565.1|3268162_3268843_+|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	95.1	4.5e-119
WP_151604567.1|3268854_3270018_+|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	96.1	2.7e-204
WP_151604569.1|3270054_3270300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151605646.1|3270268_3270574_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	77.6	1.3e-38
WP_151604571.1|3270634_3270835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151604573.1|3270837_3271170_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	71.8	1.7e-39
WP_151604575.1|3271162_3271648_+	hypothetical protein	NA	A0A0U3TGT7	Pseudomonas_phage	57.4	2.9e-43
WP_151604577.1|3271644_3272010_+	DUF3168 domain-containing protein	NA	K7PHI9	Enterobacteria_phage	81.0	9.3e-55
WP_125292256.1|3272058_3272550_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	79.6	4.0e-69
WP_125292255.1|3272549_3272978_+|tail	phage tail protein	tail	K7PJU9	Enterobacteria_phage	77.2	4.0e-49
WP_151604579.1|3272938_3273208_+|tail	phage tail protein	tail	Q9MCU7	Escherichia_phage	68.2	4.9e-29
WP_151604581.1|3273280_3273508_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_151604583.1|3273572_3275996_+|tail	phage tail tape measure protein	tail	K7PM62	Enterobacteria_phage	71.0	1.3e-311
WP_151604585.1|3275995_3276334_+|tail	phage tail protein	tail	K7PHJ6	Enterobacteria_phage	92.0	4.9e-58
WP_151604587.1|3276330_3277086_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	87.3	1.6e-130
WP_151604589.1|3277087_3277807_+	peptidase P60	NA	Q9MCU3	Escherichia_phage	86.8	7.5e-125
WP_151605647.1|3277913_3278309_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	66.4	1.5e-50
WP_151604591.1|3278368_3278947_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	73.5	5.0e-71
WP_151604593.1|3279007_3282373_+	DUF1983 domain-containing protein	NA	O64335	Escherichia_phage	72.1	0.0e+00
WP_151604595.1|3282372_3282675_+	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	73.0	1.3e-38
WP_151604597.1|3282675_3283347_+	hypothetical protein	NA	O64337	Escherichia_phage	63.6	4.1e-72
WP_151605648.1|3284040_3285135_+	hypothetical protein	NA	K7PGY2	Enterobacteria_phage	42.0	5.0e-35
WP_109455549.1|3285218_3286425_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
WP_151604599.1|3286664_3287084_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.3	5.5e-35
WP_151604601.1|3287083_3288352_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	86.7	4.6e-218
WP_151604603.1|3289103_3289748_+	serine/threonine-protein phosphatase	NA	S4TNS0	Salmonella_phage	45.5	2.8e-54
3288559:3288585	attR	AGGAATCGTATTCGGTCTTTTTTTATC	NA	NA	NA	NA
WP_125291931.1|3289748_3289940_-	YebW family protein	NA	NA	NA	NA	NA
WP_125291932.1|3290047_3290287_-	YebV family protein	NA	NA	NA	NA	NA
WP_151604605.1|3290401_3291838_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_144132592.1|3291915_3294549_-	MCE family protein	NA	NA	NA	NA	NA
WP_151604607.1|3294517_3295801_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_125291936.1|3295928_3296426_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_125291937.1|3296523_3297210_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_125291938.1|3297229_3299275_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	3.4e-85
WP_125291939.1|3299466_3300348_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_151604609.1|3300388_3301759_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_125291941.1|3301955_3302747_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_125291942.1|3302777_3303014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125291943.1|3303170_3303314_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_151604611.1|3303385_3303673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151604613.1|3304307_3304424_+	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
WP_001062678.1|3304463_3304673_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_151604615.1|3304808_3305621_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_151604617.1|3305617_3306181_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_144132582.1|3306564_3307023_-	DUF986 family protein	NA	NA	NA	NA	NA
WP_125291949.1|3307086_3307956_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_125291950.1|3307959_3308760_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_151604619.1|3308827_3309808_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_151604621.1|3310272_3311832_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	43.6	3.0e-41
WP_151604623.1|3311832_3313431_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_144132576.1|3313552_3314917_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_125291955.1|3315097_3315676_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_151604625.1|3315685_3317050_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.3	3.0e-45
WP_151604627.1|3317146_3317335_+	YoaH family protein	NA	NA	NA	NA	NA
WP_151604629.1|3317512_3319534_+	acyltransferase family protein	NA	A0A1R3Y5Q6	Salmonella_virus	31.4	1.8e-43
WP_125291960.1|3319590_3319935_-	RidA family protein	NA	NA	NA	NA	NA
WP_125292064.1|3320089_3322000_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.3	2.5e-90
WP_144132568.1|3322069_3322765_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_125291962.1|3322801_3323380_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_125291963.1|3323584_3325270_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	27.0	2.0e-35
>prophage 235
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3333108	3333378	4919347		Erwinia_phage(100.0%)	1	NA	NA
WP_151604641.1|3333108_3333378_+	hypothetical protein	NA	H2DE57	Erwinia_phage	45.6	7.2e-12
>prophage 236
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3343703	3351287	4919347		Planktothrix_phage(33.33%)	8	NA	NA
WP_125291980.1|3343703_3344408_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	42.8	1.2e-37
WP_151604651.1|3344407_3345652_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_125291982.1|3345667_3346579_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_151604653.1|3346594_3347413_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	1.6e-22
WP_144132549.1|3347451_3348498_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_144132547.1|3348518_3349313_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_151604655.1|3349309_3350167_-	spermidine/putrescine ABC transporter permease PotB	NA	NA	NA	NA	NA
WP_125291987.1|3350150_3351287_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.0	8.5e-30
>prophage 237
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3360832	3452602	4919347	tRNA,terminase,capsid,holin,tail,transposase,protease,integrase,portal,head	Enterobacteria_phage(33.33%)	101	3412957:3413016	3449596:3450824
WP_151604667.1|3360832_3361594_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.1	3.4e-14
WP_151604669.1|3361590_3362562_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_151604671.1|3362558_3363584_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_151604673.1|3363799_3365170_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.5	2.5e-108
WP_144132541.1|3365187_3365817_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_151604675.1|3365878_3366985_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_125291996.1|3367039_3367498_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_125291997.1|3367507_3368161_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_151604677.1|3368277_3369528_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-21
WP_151604679.1|3369578_3369842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125292000.1|3369928_3370174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125292001.1|3370336_3370576_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	86.1	9.4e-32
WP_125292003.1|3371409_3371679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151604681.1|3371729_3372080_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_125292005.1|3372336_3373044_+	CTP synthase	NA	NA	NA	NA	NA
WP_151604683.1|3373045_3374230_-	MFS transporter	NA	NA	NA	NA	NA
WP_151604685.1|3374330_3375101_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002433851.1|3375106_3375553_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_151604687.1|3375613_3376114_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_125292009.1|3376287_3376731_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_151604689.1|3376776_3379398_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_151604691.1|3380058_3381198_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	46.3	1.1e-90
WP_002433844.1|3381166_3381436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605649.1|3381533_3382280_-	DUF551 domain-containing protein	NA	A0A1I9LJU9	Stx_converting_phage	41.2	2.5e-22
WP_151604693.1|3382471_3382699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604695.1|3383110_3383467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604697.1|3383457_3383994_-	HD family hydrolase	NA	K7PKJ9	Enterobacteria_phage	73.0	1.5e-72
WP_151604699.1|3384034_3384289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604701.1|3384374_3385304_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	60.7	3.7e-100
WP_151604703.1|3386024_3386351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604705.1|3386666_3387263_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151604708.1|3387371_3387602_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	47.9	4.1e-08
WP_151604710.1|3387630_3388209_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	54.2	1.4e-52
WP_151604713.1|3388384_3388567_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	71.4	6.1e-15
WP_151604715.1|3388556_3389429_+	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	85.1	2.2e-41
WP_151604717.1|3389425_3389872_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	31.1	9.4e-17
WP_151604719.1|3390703_3391033_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	50.0	3.8e-23
WP_151604721.1|3391029_3391428_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	85.2	8.9e-59
WP_151604723.1|3391513_3392308_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	62.2	7.1e-92
WP_151604724.1|3392315_3393305_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	60.5	3.2e-118
WP_151604726.1|3393322_3394132_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	64.7	3.6e-91
WP_125292274.1|3394668_3395046_+	hypothetical protein	NA	F1C592	Cronobacter_phage	80.8	1.8e-48
WP_125293522.1|3395035_3395320_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	54.3	5.2e-21
WP_151604728.1|3395316_3395943_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	79.2	1.1e-90
WP_151604731.1|3395939_3396290_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	39.7	7.9e-11
WP_151605650.1|3397116_3397707_-	hypothetical protein	NA	M9NZJ1	Enterobacteria_phage	73.7	3.9e-79
WP_151604733.1|3397705_3397954_+	Fur-regulated protein	NA	Q38201	Enterobacteria_phage	54.1	8.0e-18
WP_151604735.1|3398082_3398799_+	hypothetical protein	NA	G8C7Q4	Escherichia_phage	43.2	8.0e-10
WP_151604436.1|3398798_3399149_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	78.4	5.6e-49
WP_148051728.1|3399296_3399770_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	89.8	1.7e-77
WP_151604737.1|3399769_3401527_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	91.1	0.0e+00
WP_151604739.1|3401526_3402831_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.9	4.6e-221
WP_151604741.1|3402842_3403697_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	80.5	1.2e-124
WP_151604743.1|3403707_3404922_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	90.1	1.3e-201
WP_125292262.1|3404967_3405162_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	55.2	7.0e-09
WP_125292261.1|3405171_3405498_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	50.9	1.3e-23
WP_151604746.1|3405567_3405768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151604748.1|3405770_3406103_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	70.9	5.0e-39
WP_151604750.1|3406095_3406581_+	hypothetical protein	NA	A0A0U3TGT7	Pseudomonas_phage	56.8	6.4e-43
WP_151604752.1|3406577_3406943_+	DUF3168 domain-containing protein	NA	K7PHI9	Enterobacteria_phage	81.0	9.3e-55
WP_125292256.1|3406990_3407482_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	79.6	4.0e-69
WP_125292255.1|3407481_3407910_+|tail	phage tail protein	tail	K7PJU9	Enterobacteria_phage	77.2	4.0e-49
WP_125292254.1|3407870_3408140_+|tail	phage tail protein	tail	Q9MCU7	Escherichia_phage	67.4	4.9e-29
WP_151604754.1|3408157_3410581_+|tail	phage tail tape measure protein	tail	K7PM62	Enterobacteria_phage	73.1	0.0e+00
WP_151604756.1|3410580_3410919_+|tail	phage tail protein	tail	K7PHJ6	Enterobacteria_phage	92.0	2.9e-58
WP_151604758.1|3410915_3411671_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	86.5	1.8e-129
WP_151604760.1|3411672_3412383_+	peptidase P60	NA	K7P6F5	Enterobacteria_phage	88.6	2.2e-129
WP_151604762.1|3412413_3412836_+	hypothetical protein	NA	J9Q806	Salmonella_phage	39.0	3.6e-18
3412957:3413016	attL	TGAATCGCCACGGGTTTAACAGACACCTCCGAGTCATTTAAAATGGCTTAAAGAGAGGTG	NA	NA	NA	NA
WP_142273976.1|3413019_3414166_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.7	4.6e-148
WP_151604764.1|3414783_3418266_+	DUF1983 domain-containing protein	NA	K7P840	Enterobacteria_phage	78.0	0.0e+00
WP_151604766.1|3418265_3419228_+	hypothetical protein	NA	I6PBN9	Cronobacter_phage	48.4	3.2e-78
WP_151604768.1|3419281_3420601_+|tail	phage tail protein	tail	K7PM99	Enterobacterial_phage	47.3	3.9e-95
WP_151604770.1|3420683_3420923_+	DNA polymerase V	NA	NA	NA	NA	NA
WP_151604772.1|3420924_3421296_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	56.6	1.9e-34
WP_151604774.1|3421565_3422867_-	DUF444 family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.0e-10
WP_125292012.1|3422918_3424853_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_151604776.1|3425279_3426026_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_151604778.1|3426058_3427120_-	1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_144132519.1|3427129_3428677_-	MFS transporter	NA	NA	NA	NA	NA
WP_151604780.1|3428732_3429752_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_151604782.1|3429758_3430826_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_151604784.1|3430926_3432081_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_151604786.1|3432271_3433372_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_151604788.1|3433384_3434245_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_151604790.1|3434286_3435174_-	D-hexose-6-phosphate mutarotase	NA	NA	NA	NA	NA
WP_125292022.1|3435249_3436245_-	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_125292023.1|3436591_3437005_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_125292024.1|3437046_3437325_+	YeaC family protein	NA	NA	NA	NA	NA
WP_125292065.1|3437352_3437994_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	36.4	2.9e-19
WP_151604792.1|3438004_3439021_-	asparaginase	NA	NA	NA	NA	NA
WP_151604794.1|3439118_3440969_-	signal peptide peptidase SppA	NA	NA	NA	NA	NA
WP_125292027.1|3441144_3441696_+	NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_125292028.1|3441939_3442986_+	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_151604796.1|3443389_3444721_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_151604799.1|3444723_3446508_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_151604801.1|3446507_3448385_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_142273976.1|3448444_3449592_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.7	4.6e-148
WP_151604803.1|3449678_3449957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604805.1|3450057_3450366_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151604807.1|3450494_3451433_+	AAA family ATPase	NA	G3MA40	Bacillus_virus	30.2	3.5e-29
3449596:3450824	attR	CACCTCTCTTTAAGCCATTTTAAATGACTCGGAGGTGTCTGTTAAACCCGTGGCGATTCAAATATCGGCGGCAGCGGACATCGTTAACTTAAGATACAAAAGCTGTCCGGAGATGGCGGGTCAAGATCACCAAAAGAAAACTGGTAGCTGATATTTTTTACCTTCCCATTAGCCTTTACAAGACCTTGATGCTTTAGCTGATAGATACCACGGTCAACCAGCCCTATAGCCTGTTTTTCAGAGAGTCGAAATTCAGTCATTGCGAGATTAATCAAATCACTACGCAATACCTGATGATTGGTCAGCTGGTTTAAAATATGACGAAATTTTTTACTGCTGCTGAATAAGATCCCTTGGTTCATGTCGGTCAAACTCATAGGCTAAAAACTTAGGATTGCTAAGTATACAGGAGTGAGAGAAACTTAGACAATCTAAGCATCCGAGACGCCAGATGATGAAAAAATTTTGCAGAACAATCCCTTCCCAGAACGACTCAAGCAGGCCAGAAAAAAAGCCGGTTTGTCCCAAAAGGATTTGGGGATCAAAGCCGGTATGGACGAAGGCTCGGCTAGCGGACGTATGAATCATTACGAAAAGGGGCGGCATATCCCTGATATGGATATGCTCAAGAAGTTGGCGAATGAACTTGGCGTCCCACTGAGTTACTTTTTTTGTGAAGACGAATTGAGTGCAGAACTCGTCTGCCTGTTTAATAATCTCGATGAGCAGTCAAAGCTGAGTCTGATTAGTAAACTGCGTCAAACTCTATGATTTTTAGGAGAATTAATCATGAATTACTATGCTGAGAATCACTTCTAGGTAATTGAAATAACTATGAAGTAGATGAAAAAACTTAAATCGCAGTATAAAAAAGTATCTATCCATATTTTAGGCTATCTATGTCATCTTATAATAAAAATCAACAGATTGCGATACATCATCATAGCGGCCCATTACTGATCATTGCCGGTCCGGGTTCAGGAAAAACGTATACACTCGTTGAGCGCATTATCAATCTCCTTACTGTTCACTCGGCATCATCTGATCAACTACTTGTTGTGACCTTTACGGAAAAGGCCGCGCAAGAGCTTAAGACACGGTTATCGAATAGAATTATCGAATTGGGCATAGACACCAATATCAACGAGATGTATTTGGGAACGTTTCACGCAATCTGCCTGAGAATATTGGAAGAATACCGTGAATATACTCGCTTGAAACGCTCATTT	NA	NA	NA	NA
WP_151602257.1|3451482_3452602_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.7	3.0e-51
>prophage 238
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3457549	3458770	4919347		Klosneuvirus(100.0%)	1	NA	NA
WP_125292034.1|3457549_3458770_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.3	2.5e-27
>prophage 239
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3467135	3474359	4919347		Bacillus_virus(25.0%)	7	NA	NA
WP_144132486.1|3467135_3467963_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.8	1.9e-71
WP_151604819.1|3468207_3468555_+	osmotically-inducible lipoprotein OsmE	NA	NA	NA	NA	NA
WP_151604821.1|3468650_3470903_-	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	48.9	5.8e-139
WP_151604823.1|3471079_3471310_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_125293556.1|3471378_3472770_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_125293555.1|3472898_3473489_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	41.1	7.6e-06
WP_151604825.1|3473597_3474359_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	2.5e-17
>prophage 240
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3479845	3497238	4919347	tRNA,transposase	uncultured_Caudovirales_phage(20.0%)	19	NA	NA
WP_142273976.1|3479845_3480992_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.7	4.6e-148
WP_125293490.1|3482204_3482525_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	1.0e-20
WP_125293489.1|3482610_3483309_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	3.8e-89
WP_125293576.1|3483432_3483498_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_144132342.1|3483771_3485700_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	2.1e-129
WP_125293487.1|3485703_3486246_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.3	6.3e-15
WP_001124225.1|3486344_3486542_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124849.1|3486589_3486946_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|3487065_3487110_+|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_125293486.1|3487238_3488222_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	4.9e-34
WP_151604831.1|3488237_3490625_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229266.1|3490629_3490929_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_151604833.1|3491030_3492008_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_151604835.1|3492038_3492590_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_151604837.1|3492589_3493336_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A1M7XV31	Cedratvirus	27.4	6.0e-08
WP_125293481.1|3493419_3493884_+	endopeptidase	NA	A0A217EQL1	Bacillus_phage	36.2	1.1e-12
WP_151604839.1|3494231_3494948_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_151604841.1|3495012_3496458_+	YdiU family protein	NA	NA	NA	NA	NA
WP_151604843.1|3496458_3497238_-	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	1.2e-11
>prophage 241
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3502558	3507308	4919347		Pandoravirus(50.0%)	3	NA	NA
WP_125293473.1|3502558_3503605_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	45.8	1.2e-81
WP_125293472.1|3503759_3504593_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_151604849.1|3504929_3507308_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.9	1.3e-173
>prophage 242
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3513813	3518904	4919347		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_125293465.1|3513813_3514191_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	36.4	6.3e-14
WP_125293464.1|3514193_3515678_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_125293463.1|3515694_3516441_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	30.8	1.9e-09
WP_151604856.1|3516415_3517687_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_144132273.1|3517683_3518904_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	44.3	5.8e-101
>prophage 243
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3526178	3534874	4919347		Orpheovirus(25.0%)	9	NA	NA
WP_125293454.1|3526178_3526814_+	riboflavin synthase subunit alpha	NA	A0A2I2L4R9	Orpheovirus	34.2	4.0e-21
WP_151604862.1|3526848_3527997_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	43.5	4.1e-80
WP_151604864.1|3528250_3529453_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_144132251.1|3529576_3530488_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_125293450.1|3530503_3531529_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.4	4.8e-32
WP_125293449.1|3531816_3531906_+	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_151604866.1|3532139_3533306_+	MFS transporter	NA	NA	NA	NA	NA
WP_144132246.1|3533342_3533924_-	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_125293446.1|3534043_3534874_-	NlpC/P60 family protein	NA	A0A2H5BM69	Streptomyces_phage	41.6	6.4e-19
>prophage 244
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3539987	3540509	4919347		Salmonella_phage(100.0%)	1	NA	NA
WP_125293438.1|3539987_3540509_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	59.2	7.5e-50
>prophage 245
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3544284	3544752	4919347		Bacillus_phage(100.0%)	1	NA	NA
WP_151604880.1|3544284_3544752_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	35.7	1.0e-13
>prophage 246
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3549206	3550481	4919347	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_151604893.1|3549206_3550481_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	1.4e-84
>prophage 247
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3577630	3578908	4919347		Bacillus_phage(100.0%)	1	NA	NA
WP_151604921.1|3577630_3578908_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.4	4.8e-13
>prophage 248
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3588447	3589428	4919347	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_016947617.1|3588447_3589428_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
>prophage 249
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3598500	3599583	4919347		Planktothrix_phage(100.0%)	1	NA	NA
WP_151604945.1|3598500_3599583_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.3	4.5e-20
>prophage 250
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3603791	3608326	4919347		Streptococcus_phage(50.0%)	5	NA	NA
WP_125293383.1|3603791_3604307_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	56.2	1.4e-24
WP_125293382.1|3604838_3605402_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_125293381.1|3605409_3606090_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_151604948.1|3606086_3606782_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_151604949.1|3606781_3608326_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	44.0	1.9e-19
>prophage 251
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3614492	3615986	4919347		Mycobacterium_phage(100.0%)	1	NA	NA
WP_151604952.1|3614492_3615986_+	SmvA family efflux MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	30.7	1.4e-32
>prophage 252
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3622677	3628193	4919347		Staphylococcus_phage(50.0%)	5	NA	NA
WP_125293572.1|3622677_3624153_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.1e-16
WP_144132087.1|3624191_3624785_-	DUF2291 family protein	NA	NA	NA	NA	NA
WP_125293367.1|3624797_3625739_-	D-ribose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_125293366.1|3625946_3626891_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_125293365.1|3627089_3628193_+	cobalamin-independent methionine synthase II family protein	NA	A0A218MNE0	uncultured_virus	48.7	1.2e-100
>prophage 253
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3638580	3640086	4919347		Brazilian_cedratvirus(50.0%)	2	NA	NA
WP_151605656.1|3638580_3639378_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	25.6	5.6e-12
WP_151604958.1|3639387_3640086_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	24.9	8.9e-14
>prophage 254
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3644061	3644436	4919347		Streptococcus_phage(100.0%)	1	NA	NA
WP_002435664.1|3644061_3644436_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.6e-09
>prophage 255
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3651295	3653587	4919347		Tetraselmis_virus(100.0%)	1	NA	NA
WP_125293349.1|3651295_3653587_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	3.8e-162
>prophage 256
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3659302	3695839	4919347	holin,transposase,terminase,head	Shigella_phage(20.0%)	41	NA	NA
WP_151604968.1|3659302_3660892_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.7	1.7e-12
WP_151604969.1|3660939_3661866_+	glutaminase B	NA	NA	NA	NA	NA
WP_144129801.1|3661964_3663407_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.6	1.0e-16
WP_151604970.1|3663544_3663784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|3664002_3665007_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_015065644.1|3665085_3668052_-|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_001247892.1|3668210_3668501_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|3668497_3668899_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|3668888_3669245_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|3669499_3669826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|3669822_3670323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100853.1|3670319_3670691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|3670684_3671242_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_109455549.1|3672727_3673935_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
WP_151604972.1|3674018_3674366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567369.1|3674642_3675275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|3675303_3676707_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|3676926_3677559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567368.1|3677587_3678991_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_151604974.1|3679313_3679847_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_151604975.1|3679843_3680371_-	glycoside hydrolase family protein	NA	H9C184	Pectobacterium_phage	76.0	1.5e-77
WP_104457361.1|3680360_3680546_-|holin	holin	holin	I6R0S9	Salmonella_phage	55.1	8.7e-09
WP_151604976.1|3680546_3680885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604977.1|3680884_3681499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604978.1|3681579_3681771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604979.1|3681780_3683886_-	tape measure protein	NA	W8VLG7	Pseudomonas_phage	33.3	8.4e-15
WP_151604980.1|3684013_3684502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604981.1|3684501_3684924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604982.1|3684927_3686286_-	DUF3383 family protein	NA	A0A142IDK3	Pseudomonas_phage	22.6	2.9e-08
WP_151604983.1|3686286_3687075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604984.1|3687074_3687428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604985.1|3687424_3687898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604986.1|3688082_3688280_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	95.4	2.0e-27
WP_151604987.1|3688337_3688697_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_151604988.1|3688706_3688964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151604989.1|3688967_3689906_-	DUF2184 domain-containing protein	NA	E5AGA8	Erwinia_phage	29.7	1.9e-27
WP_151604991.1|3689923_3690715_-	hypothetical protein	NA	A0A1S5R5Y7	Pseudomonas_phage	60.5	7.8e-14
WP_151604992.1|3690714_3691731_-	DUF2213 domain-containing protein	NA	A0A291LCH5	Klebsiella_phage	28.9	1.4e-15
WP_151604993.1|3691702_3693064_-|head	phage head morphogenesis protein	head	D6PSX3	Lactobacillus_phage	23.9	1.8e-10
WP_151604994.1|3693050_3694433_-	DUF1073 domain-containing protein	NA	NA	NA	NA	NA
WP_151604995.1|3694429_3695839_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	34.0	3.7e-59
>prophage 257
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3698908	3706962	4919347	plate	Enterobacteria_phage(20.0%)	13	NA	NA
WP_151604999.1|3698908_3699424_+	recombinase	NA	Q5QBN4	Enterobacteria_phage	49.2	5.0e-38
WP_151605000.1|3699537_3700569_+	hypothetical protein	NA	Q6QI97	Burkholderia_phage	37.6	5.3e-31
WP_151605001.1|3700764_3701025_-	hypothetical protein	NA	H6WRY4	Salmonella_phage	54.9	1.1e-20
WP_151605002.1|3701110_3701743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605003.1|3701742_3701979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605004.1|3701975_3702209_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_151605005.1|3702201_3702957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605006.1|3702956_3704366_-|plate	baseplate protein	plate	Q2NPA2	Xanthomonas_phage	26.9	2.1e-06
WP_151605007.1|3704352_3704700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605008.1|3704699_3704918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605658.1|3704914_3705292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605659.1|3705301_3706012_-|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_151605009.1|3706008_3706962_-	hypothetical protein	NA	A0A1D8EQC7	Escherichia_phage	23.1	6.1e-05
>prophage 258
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3710041	3710640	4919347		Salmonella_phage(50.0%)	2	NA	NA
WP_151605014.1|3710041_3710347_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	70.7	1.3e-30
WP_151605015.1|3710352_3710640_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	71.3	9.3e-34
>prophage 259
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3722951	3725141	4919347		Acinetobacter_phage(100.0%)	1	NA	NA
WP_151605027.1|3722951_3725141_-	molybdopterin-dependent oxidoreductase	NA	A0A0P0I429	Acinetobacter_phage	25.7	5.6e-38
>prophage 260
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3733179	3736242	4919347		Escherichia_phage(100.0%)	1	NA	NA
WP_151605033.1|3733179_3736242_+	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	26.0	6.1e-06
>prophage 261
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3741854	3747163	4919347		Escherichia_phage(100.0%)	5	NA	NA
WP_151605038.1|3741854_3742457_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	32.0	4.4e-17
WP_151605039.1|3742466_3743330_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_151605040.1|3743331_3744156_-	dimethyl sulfoxide reductase	NA	NA	NA	NA	NA
WP_151605041.1|3744158_3744779_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.4	3.9e-61
WP_151605042.1|3744775_3747163_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	39.2	4.0e-146
>prophage 262
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3762475	3763623	4919347	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_087703402.1|3762475_3763623_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.3	6.6e-147
>prophage 263
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3772199	3780645	4919347		Morganella_phage(25.0%)	7	NA	NA
WP_151605058.1|3772199_3773120_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	52.3	1.1e-75
WP_151605059.1|3773607_3775650_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	21.3	6.7e-17
WP_144129677.1|3775799_3776549_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_125295262.1|3776631_3777321_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151605060.1|3777435_3777639_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	53.7	3.2e-12
WP_151605061.1|3777677_3778961_-	MFS transporter	NA	NA	NA	NA	NA
WP_151605062.1|3779193_3780645_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.2	1.6e-41
>prophage 264
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3783728	3785417	4919347		Oenococcus_phage(50.0%)	2	NA	NA
WP_151605064.1|3783728_3784943_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	6.3e-47
WP_144129669.1|3785090_3785417_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
>prophage 265
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3796186	3797332	4919347		Planktothrix_phage(100.0%)	1	NA	NA
WP_125295243.1|3796186_3797332_+	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	33.0	1.7e-25
>prophage 266
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3812582	3815346	4919347		Salmonella_phage(50.0%)	3	NA	NA
WP_151605077.1|3812582_3813845_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	64.5	1.1e-155
WP_125295224.1|3814107_3814872_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_144129624.1|3814920_3815346_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.7	2.1e-34
>prophage 267
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3836774	3838892	4919347		Salmonella_phage(100.0%)	1	NA	NA
WP_151605090.1|3836774_3838892_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	69.4	5.8e-141
>prophage 268
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3854953	3856160	4919347	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_109455549.1|3854953_3856160_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
>prophage 269
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3869804	3870566	4919347		Escherichia_phage(100.0%)	1	NA	NA
WP_151605108.1|3869804_3870566_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.9	2.6e-30
>prophage 270
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3874746	3875760	4919347		Mycoplasma_phage(100.0%)	1	NA	NA
WP_151605110.1|3874746_3875760_-	ATP-binding cassette domain-containing protein	NA	Q6GZ03	Mycoplasma_phage	37.1	9.3e-28
>prophage 271
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3890415	3892380	4919347	protease	Phage_TP(100.0%)	1	NA	NA
WP_151605121.1|3890415_3892380_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	26.8	1.7e-22
>prophage 272
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3897098	3898079	4919347		Bacillus_phage(100.0%)	1	NA	NA
WP_151605124.1|3897098_3898079_+	hypothetical protein	NA	L0LC68	Bacillus_phage	57.9	5.7e-06
>prophage 273
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3910106	3910862	4919347		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_144129509.1|3910106_3910862_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.6	3.0e-15
>prophage 274
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3920517	3921636	4919347		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_151605134.1|3920517_3921636_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.0	2.1e-33
>prophage 275
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3927027	3935850	4919347		Escherichia_phage(33.33%)	6	NA	NA
WP_151605139.1|3927027_3927558_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	40.2	4.5e-18
WP_125294434.1|3927648_3929154_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	30.5	3.1e-56
WP_151605140.1|3929512_3930295_-	YdcF family protein	NA	NA	NA	NA	NA
WP_151605141.1|3930393_3931023_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151605142.1|3931218_3931908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151605143.1|3931947_3935850_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	30.4	3.4e-54
>prophage 276
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3947986	3948976	4919347		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_125294417.1|3947986_3948976_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	44.6	2.8e-69
>prophage 277
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3953606	3968595	4919347	holin,tRNA	Escherichia_phage(22.22%)	22	NA	NA
WP_151605157.1|3953606_3954980_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.6	1.5e-52
WP_125294412.1|3955082_3955280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605667.1|3955787_3955919_-	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	69.8	2.2e-11
WP_151605158.1|3956085_3956301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605159.1|3956369_3956567_-	hypothetical protein	NA	K7P7N1	Enterobacteria_phage	71.7	5.8e-11
WP_151605160.1|3957225_3957429_-	hypothetical protein	NA	A0A291AX22	Salmonella_phage	48.4	1.8e-07
WP_151605161.1|3957340_3957691_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	37.9	1.3e-08
WP_151605162.1|3957687_3958314_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	77.8	3.4e-89
WP_151605163.1|3958310_3958595_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	54.3	8.9e-21
WP_002433795.1|3958584_3958962_-	membrane protein	NA	F1C592	Cronobacter_phage	80.8	1.3e-48
WP_151605164.1|3959756_3960158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605165.1|3960367_3961177_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	63.9	7.5e-89
WP_151605166.1|3961173_3961452_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	64.9	2.1e-06
WP_151605167.1|3961402_3961999_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	66.7	6.0e-59
WP_151605168.1|3961998_3962454_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	70.9	1.0e-58
WP_151605169.1|3962450_3963047_-	hypothetical protein	NA	A0A142IE12	Pseudomonas_phage	39.1	3.5e-19
WP_151605170.1|3963142_3963355_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	69.0	5.4e-23
WP_151605171.1|3963351_3964590_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	67.3	1.1e-163
WP_151605172.1|3964637_3965573_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.8	5.4e-139
WP_151605173.1|3966011_3966995_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_151605174.1|3967177_3968332_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	8.4e-17
WP_125294408.1|3968328_3968595_-	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
>prophage 278
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	3992801	3994614	4919347		Planktothrix_phage(50.0%)	2	NA	NA
WP_151605189.1|3992801_3993794_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	25.8	5.5e-09
WP_144129340.1|3993795_3994614_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.9	1.0e-13
>prophage 279
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4007815	4008409	4919347		Staphylococcus_phage(100.0%)	1	NA	NA
WP_144129324.1|4007815_4008409_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	3.5e-43
>prophage 280
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4017688	4023043	4919347	protease	Acanthamoeba_polyphaga_mimivirus(33.33%)	4	NA	NA
WP_151605199.1|4017688_4020295_-	type I DNA topoisomerase	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	33.9	4.6e-87
WP_125294364.1|4020694_4020946_+	YciN family protein	NA	NA	NA	NA	NA
WP_151605200.1|4020982_4022032_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	1.9e-20
WP_151605201.1|4022281_4023043_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.5	9.8e-06
>prophage 281
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4028001	4030959	4919347		Acinetobacter_phage(100.0%)	2	NA	NA
WP_125294356.1|4028001_4029597_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.4	2.7e-50
WP_151605203.1|4029600_4030959_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.4	4.7e-35
>prophage 282
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4040907	4043845	4919347		Lactobacillus_phage(33.33%)	3	NA	NA
WP_144129304.1|4040907_4041741_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	29.3	7.4e-07
WP_125294342.1|4041851_4042856_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.7	4.0e-15
WP_125294341.1|4042852_4043845_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.0	2.2e-13
>prophage 283
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4051987	4059898	4919347		Bacillus_phage(40.0%)	8	NA	NA
WP_125294335.1|4051987_4052593_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	55.1	1.4e-52
WP_125294334.1|4053151_4053565_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_125294333.1|4053632_4054643_-	NAD-dependent epimerase	NA	A0A0K0KW07	Prochlorococcus_phage	30.7	2.4e-15
WP_125294332.1|4054654_4055998_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.3	4.5e-78
WP_125294331.1|4056021_4056930_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.9	3.5e-58
WP_125294330.1|4057130_4058144_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_151605214.1|4058547_4059006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125294328.1|4059055_4059898_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	36.4	2.7e-12
>prophage 284
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4064104	4065640	4919347		Escherichia_phage(100.0%)	1	NA	NA
WP_151605218.1|4064104_4065640_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.2	1.8e-19
>prophage 285
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4086377	4087166	4919347		Bacillus_virus(100.0%)	1	NA	NA
WP_151605225.1|4086377_4087166_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.5	2.6e-30
>prophage 286
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4094309	4098331	4919347		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_125295393.1|4094309_4095164_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.7	6.4e-46
WP_125295392.1|4095204_4096014_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_125295391.1|4096010_4096406_-	siroheme synthase	NA	NA	NA	NA	NA
WP_151605229.1|4096409_4097249_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_125295389.1|4097248_4098331_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.9e-07
>prophage 287
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4101447	4104196	4919347		Tupanvirus(50.0%)	2	NA	NA
WP_002437209.1|4101447_4102395_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	6.6e-44
WP_144129264.1|4102516_4104196_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	3.7e-21
>prophage 288
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4114899	4119479	4919347	transposase	Shigella_phage(50.0%)	4	NA	NA
WP_109455549.1|4114899_4116106_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
WP_151605236.1|4116287_4117268_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_151605237.1|4117346_4118357_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_125295367.1|4118558_4119479_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	27.0	1.6e-07
>prophage 289
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4126954	4128298	4919347		Dickeya_phage(100.0%)	1	NA	NA
WP_151605243.1|4126954_4128298_-	malate permease	NA	A0A140XAH4	Dickeya_phage	47.4	2.5e-20
>prophage 290
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4141453	4142146	4919347		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_144129236.1|4141453_4142146_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.0	6.6e-17
>prophage 291
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4152063	4152834	4919347		Bacillus_virus(100.0%)	1	NA	NA
WP_151605675.1|4152063_4152834_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	38.5	1.9e-33
>prophage 292
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4171316	4172366	4919347		Tupanvirus(100.0%)	1	NA	NA
WP_144129224.1|4171316_4172366_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L7I1	Tupanvirus	44.2	4.5e-86
>prophage 293
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4178599	4179235	4919347		Pseudomonas_phage(100.0%)	1	NA	NA
WP_151605267.1|4178599_4179235_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.6	6.4e-27
>prophage 294
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4182488	4183735	4919347		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|4182488_4182725_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_125292105.1|4183000_4183735_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	7.7e-16
>prophage 295
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4195563	4201177	4919347		Streptococcus_phage(33.33%)	5	NA	NA
WP_125292114.1|4195563_4196808_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	31.7	2.9e-55
WP_125292115.1|4196792_4197440_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	51.1	2.2e-51
WP_125292116.1|4197531_4198494_-	flagellar hook-filament junction protein FlgL	NA	NA	NA	NA	NA
WP_125292117.1|4198509_4200153_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_151605275.1|4200229_4201177_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	34.7	2.8e-10
>prophage 296
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4218213	4218459	4919347		Enterobacteria_phage(100.0%)	1	NA	NA
WP_125292137.1|4218213_4218459_+	DNA damage-inducible protein I	NA	K7PM44	Enterobacteria_phage	47.4	1.7e-12
>prophage 297
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4223316	4224237	4919347		Morganella_phage(100.0%)	1	NA	NA
WP_151605283.1|4223316_4224237_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	41.1	1.5e-56
>prophage 298
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4231966	4232509	4919347		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_125292150.1|4231966_4232509_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	45.2	4.6e-26
>prophage 299
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4236714	4237548	4919347		Pelagibacter_phage(100.0%)	1	NA	NA
WP_125292158.1|4236714_4237548_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	38.9	2.3e-40
>prophage 300
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4251116	4252598	4919347		Bacillus_virus(100.0%)	1	NA	NA
WP_151605294.1|4251116_4252598_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	27.8	2.7e-12
>prophage 301
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4260938	4266694	4919347		Bacillus_thuringiensis_phage(50.0%)	5	NA	NA
WP_024552273.1|4260938_4261328_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.2	1.3e-06
WP_125292179.1|4261344_4262394_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_125292180.1|4262390_4263257_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_151605297.1|4263277_4264882_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	58.5	8.1e-10
WP_151605298.1|4265017_4266694_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.2	1.3e-10
>prophage 302
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4282400	4283915	4919347		Staphylococcus_phage(100.0%)	1	NA	NA
WP_151605305.1|4282400_4283915_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	2.5e-13
>prophage 303
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4289094	4289892	4919347		Cronobacter_phage(100.0%)	1	NA	NA
WP_144129173.1|4289094_4289892_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	75.4	1.1e-89
>prophage 304
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4316520	4325520	4919347		Burkholderia_phage(40.0%)	9	NA	NA
WP_151605313.1|4316520_4318188_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	34.2	2.7e-16
WP_125292233.1|4318368_4318551_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_125292234.1|4318641_4319556_-	DUF808 family protein	NA	NA	NA	NA	NA
WP_151605314.1|4319897_4320809_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_125292236.1|4320811_4321279_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	45.6	9.2e-31
WP_151605315.1|4321282_4322686_-	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	53.1	7.4e-100
WP_151605316.1|4322745_4323432_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	29.9	1.5e-08
WP_151605317.1|4323486_4323750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605318.1|4324389_4325520_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-112
>prophage 305
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4331716	4332924	4919347	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_109455549.1|4331716_4332924_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
>prophage 306
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4338372	4342350	4919347	transposase	Shigella_phage(33.33%)	4	NA	NA
WP_142273976.1|4338372_4339520_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.7	4.6e-148
WP_151605323.1|4339658_4340648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605324.1|4340767_4341481_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	4.5e-13
WP_125292303.1|4341477_4342350_-	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	25.6	3.0e-11
>prophage 307
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4347996	4352290	4919347	integrase	Pseudomonas_phage(50.0%)	3	4332285:4332299	4358005:4358019
4332285:4332299	attL	AACAGCAGATTATGC	NA	NA	NA	NA
WP_117029998.1|4347996_4349250_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.4	3.2e-70
WP_117029997.1|4349948_4350719_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_117029996.1|4350859_4352290_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.2	4.1e-37
4358005:4358019	attR	AACAGCAGATTATGC	NA	NA	NA	NA
>prophage 308
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4358562	4358757	4919347		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_117029992.1|4358562_4358757_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	48.0	5.0e-07
>prophage 309
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4374474	4375419	4919347		Caulobacter_phage(100.0%)	1	NA	NA
WP_151605329.1|4374474_4375419_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	41.2	4.1e-54
>prophage 310
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4382862	4388610	4919347	transposase	Shigella_phage(50.0%)	3	NA	NA
WP_151602493.1|4382862_4384136_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.1	1.4e-145
WP_085802824.1|4384448_4385222_+	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_151605331.1|4385208_4388610_+	DEAD/DEAH box helicase	NA	E3T5F3	Cafeteria_roenbergensis_virus	21.5	1.4e-06
>prophage 311
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4394307	4395108	4919347		Planktothrix_phage(100.0%)	1	NA	NA
WP_151605335.1|4394307_4395108_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	7.3e-12
>prophage 312
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4398906	4404549	4919347		Clostridioides_phage(33.33%)	6	NA	NA
WP_125292352.1|4398906_4399668_+	NlpC/P60 family protein	NA	A0A1V0DZX6	Clostridioides_phage	35.8	1.0e-18
WP_125292353.1|4399734_4401474_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_144129110.1|4401427_4402270_+	OmpA family protein	NA	NA	NA	NA	NA
WP_151605339.1|4402270_4403008_-	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.4	1.8e-09
WP_125292356.1|4403053_4403815_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_125292357.1|4403829_4404549_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.8	8.1e-10
>prophage 313
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4415706	4416312	4919347		Canarypox_virus(100.0%)	1	NA	NA
WP_125292367.1|4415706_4416312_-	ankyrin repeat domain-containing protein	NA	Q6VZ28	Canarypox_virus	25.0	1.2e-06
>prophage 314
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4422823	4423993	4919347		Stx2-converting_phage(100.0%)	1	NA	NA
WP_125292375.1|4422823_4423993_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	78.1	4.4e-175
>prophage 315
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4429525	4430425	4919347		Cellulophaga_phage(100.0%)	1	NA	NA
WP_125292380.1|4429525_4430425_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	92.1	1.2e-10
>prophage 316
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4435956	4438018	4919347		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_144129089.1|4435956_4436556_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	29.7	3.4e-14
WP_151605355.1|4436605_4438018_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.4	7.3e-39
>prophage 317
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4443477	4457034	4919347		Acanthocystis_turfacea_Chlorella_virus(25.0%)	11	NA	NA
WP_151605361.1|4443477_4444371_-	NAD-dependent epimerase/dehydratase family protein	NA	M1HXY1	Acanthocystis_turfacea_Chlorella_virus	27.8	7.9e-15
WP_151605362.1|4444370_4445405_-	GDP-mannose 4,6-dehydratase	NA	M1HGM9	Acanthocystis_turfacea_Chlorella_virus	55.3	3.4e-102
WP_151605363.1|4445474_4446893_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_151605364.1|4446889_4448086_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_151605365.1|4448129_4449275_-	FkbM family methyltransferase	NA	A0A0N9QAD0	Chrysochromulina_ericina_virus	27.7	1.9e-05
WP_151605366.1|4449267_4450515_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	6.5e-15
WP_151605367.1|4450514_4451312_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_151605368.1|4451314_4452688_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.7	6.4e-32
WP_125292405.1|4452706_4454122_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.7	5.2e-61
WP_125292406.1|4454556_4455447_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.6	3.6e-44
WP_151605369.1|4455627_4457034_-	colanic acid biosynthesis protein WcaM	NA	K4F6L0	Cronobacter_phage	26.5	5.6e-15
>prophage 318
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4462564	4467802	4919347		Hokovirus(33.33%)	5	NA	NA
WP_125292412.1|4462564_4464010_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	27.9	5.5e-42
WP_151605372.1|4464013_4465234_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_151605373.1|4465230_4465710_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_125292415.1|4465712_4466678_-	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	50.3	4.2e-86
WP_125292416.1|4466680_4467802_-	GDP-mannose 4,6-dehydratase	NA	M1IBC3	Acanthocystis_turfacea_Chlorella_virus	66.4	1.4e-133
>prophage 319
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4477577	4480776	4919347		Moraxella_phage(50.0%)	2	NA	NA
WP_125292425.1|4477577_4479137_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	1.1e-38
WP_125292426.1|4479180_4480776_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.1	2.1e-58
>prophage 320
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4485817	4490960	4919347		Escherichia_phage(33.33%)	6	NA	NA
WP_125292432.1|4485817_4486327_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	36.0	8.2e-17
WP_144129055.1|4486679_4487567_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_125292434.1|4487868_4488372_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.1	1.4e-05
WP_125292435.1|4488734_4489481_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_125292436.1|4489581_4490241_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_002434736.1|4490237_4490960_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	43.6	5.0e-36
>prophage 321
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4495660	4496995	4919347		Moraxella_phage(100.0%)	1	NA	NA
WP_125292441.1|4495660_4496995_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	38.7	6.0e-67
>prophage 322
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4500034	4507400	4919347		Bacillus_phage(33.33%)	5	NA	NA
WP_151605389.1|4500034_4502215_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	1.7e-39
WP_151605390.1|4502348_4503758_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.4	8.9e-53
WP_144129047.1|4503986_4504667_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_151605391.1|4504666_4505671_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_151605392.1|4505660_4507400_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	3.2e-20
>prophage 323
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4516992	4521396	4919347		Streptococcus_phage(50.0%)	3	NA	NA
WP_125292459.1|4516992_4517901_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.1	1.6e-26
WP_151605395.1|4517910_4519932_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_125292462.1|4520685_4521396_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	21.2	1.1e-06
>prophage 324
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4525067	4528449	4919347		Klosneuvirus(50.0%)	3	NA	NA
WP_151605399.1|4525067_4526357_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.0e-19
WP_125292468.1|4526421_4526898_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_151605400.1|4526928_4528449_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.4	7.3e-85
>prophage 325
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4536769	4543258	4919347		Planktothrix_phage(33.33%)	7	NA	NA
WP_151605407.1|4536769_4537828_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	31.2	1.0e-16
WP_125292478.1|4537830_4538520_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_144129025.1|4538519_4539293_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_125292480.1|4539423_4539573_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_125292481.1|4539698_4540490_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_151605408.1|4540567_4542037_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.9	1.0e-11
WP_125292483.1|4542241_4543258_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.2	1.2e-78
>prophage 326
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4547530	4553122	4919347		Edwardsiella_phage(25.0%)	6	NA	NA
WP_151605412.1|4547530_4548583_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.9	3.6e-83
WP_144129018.1|4548901_4549372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125292490.1|4549468_4550410_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	26.6	3.2e-22
WP_125292491.1|4550406_4551123_-	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	27.7	5.0e-20
WP_151605686.1|4551168_4552212_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_151605413.1|4552561_4553122_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A2R2Z365	Escherichia_phage	30.3	1.4e-12
>prophage 327
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4580874	4581666	4919347		Kaumoebavirus(100.0%)	1	NA	NA
WP_144129005.1|4580874_4581666_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.7	4.9e-08
>prophage 328
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4584759	4586181	4919347		Hokovirus(100.0%)	1	NA	NA
WP_151605425.1|4584759_4586181_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	29.5	5.1e-56
>prophage 329
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4590293	4592342	4919347		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_151605429.1|4590293_4592342_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.4	7.9e-26
>prophage 330
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4598537	4602233	4919347		Salmonella_phage(100.0%)	1	NA	NA
WP_151605434.1|4598537_4602233_+	hypothetical protein	NA	S4TRP0	Salmonella_phage	55.4	7.3e-22
>prophage 331
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4610389	4615699	4919347	tRNA	Mycobacterium_phage(50.0%)	6	NA	NA
WP_125294535.1|4610389_4611157_+	esterase	NA	G1DB77	Mycobacterium_phage	38.5	5.8e-06
WP_125294536.1|4611227_4611581_+	LexA regulated protein	NA	NA	NA	NA	NA
WP_125294537.1|4611703_4612261_+	flavodoxin FldA	NA	NA	NA	NA	NA
WP_125294538.1|4612554_4613007_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_125294539.1|4613311_4613926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151605437.1|4614031_4615699_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	91.0	2.3e-310
>prophage 332
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4622537	4624202	4919347		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_125294546.1|4622537_4624202_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.1	6.1e-85
>prophage 333
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4628151	4629231	4919347		Pseudomonas_phage(100.0%)	1	NA	NA
WP_144128987.1|4628151_4629231_+	AAA family ATPase	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	3.3e-47
>prophage 334
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4635101	4639172	4919347	tRNA	Planktothrix_phage(50.0%)	3	NA	NA
WP_125294557.1|4635101_4635827_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	3.3e-27
WP_125294558.1|4635878_4636361_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_151605687.1|4636589_4639172_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	4.0e-184
>prophage 335
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4647297	4649770	4919347		Synechococcus_phage(50.0%)	2	NA	NA
WP_151605447.1|4647297_4648419_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	1.1e-08
WP_125294569.1|4648558_4649770_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.2	3.6e-103
>prophage 336
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4653364	4654183	4919347		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_151605448.1|4653364_4653748_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	45.9	1.7e-22
WP_002436076.1|4653973_4654183_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.0e-22
>prophage 337
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4664456	4665287	4919347		Mycobacterium_phage(100.0%)	1	NA	NA
WP_151605454.1|4664456_4665287_-	alpha/beta fold hydrolase	NA	A0A220NRX7	Mycobacterium_phage	32.0	1.2e-17
>prophage 338
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4669099	4671160	4919347		Morganella_phage(50.0%)	2	NA	NA
WP_125294593.1|4669099_4669528_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	34.3	2.0e-16
WP_151605456.1|4669594_4671160_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	33.0	2.4e-43
>prophage 339
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4682641	4690251	4919347	tRNA	uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_151605689.1|4682641_4683649_+	Fe(3+)-siderophore ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	25.5	3.9e-10
WP_151605462.1|4683645_4684635_+	iron-enterobactin ABC transporter permease	NA	NA	NA	NA	NA
WP_144128950.1|4684631_4685423_+	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HS04	Acanthocystis_turfacea_Chlorella_virus	29.0	2.8e-11
WP_125294608.1|4685457_4685790_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_151605690.1|4686011_4686995_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_151605463.1|4687158_4690251_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.3	9.7e-161
>prophage 340
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4695755	4699646	4919347		Tupanvirus(100.0%)	1	NA	NA
WP_151605466.1|4695755_4699646_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	23.1	3.4e-62
>prophage 341
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4709219	4722346	4919347	transposase	Escherichia_phage(57.14%)	12	NA	NA
WP_151605471.1|4709219_4711124_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.8	1.3e-11
WP_151605472.1|4711159_4714249_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.9	0.0e+00
WP_151605473.1|4714435_4715476_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	43.6	2.0e-65
WP_125294628.1|4715476_4715728_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_125294629.1|4715794_4716139_-	RamA family antibiotic efflux transcriptional regulator	NA	NA	NA	NA	NA
WP_125294630.1|4716394_4716979_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151605474.1|4717193_4718459_+	hypothetical protein	NA	A0A077SLJ7	Escherichia_phage	50.7	1.5e-104
WP_125294643.1|4718470_4719121_+	aldolase	NA	A0A077SK32	Escherichia_phage	55.6	3.7e-54
WP_144128933.1|4719126_4719921_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	44.3	4.1e-47
WP_151605475.1|4719913_4720690_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_151605476.1|4720719_4721265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016947617.1|4721365_4722346_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
>prophage 342
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4746703	4754018	4919347		Bacillus_virus(33.33%)	6	NA	NA
WP_151605495.1|4746703_4747564_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	26.9	2.9e-14
WP_151605496.1|4747599_4748028_-	transporter	NA	NA	NA	NA	NA
WP_144132906.1|4748429_4750577_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	8.8e-28
WP_125293824.1|4750653_4751451_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_151605497.1|4751474_4752962_-	xylulokinase	NA	NA	NA	NA	NA
WP_125293826.1|4752998_4754018_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	27.9	3.4e-22
>prophage 343
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4759039	4760080	4919347		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_125293982.1|4759039_4760080_-	zinc-binding dehydrogenase	NA	L7RC95	Acanthamoeba_polyphaga_moumouvirus	26.2	3.3e-12
>prophage 344
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4781239	4782446	4919347	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_109455549.1|4781239_4782446_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
>prophage 345
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4790288	4791788	4919347		Staphylococcus_phage(100.0%)	1	NA	NA
WP_151605517.1|4790288_4791788_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	2.5e-21
>prophage 346
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4838536	4840713	4919347	transposase	Burkholderia_virus(50.0%)	2	NA	NA
WP_151605541.1|4838536_4839472_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.4	6.3e-31
WP_109455549.1|4839505_4840713_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
>prophage 347
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4847029	4847896	4919347		Enterococcus_phage(100.0%)	1	NA	NA
WP_144132790.1|4847029_4847896_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.0e-30
>prophage 348
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4855329	4856715	4919347	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_125293908.1|4855329_4856715_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.6e-43
>prophage 349
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4859881	4861858	4919347		Tetraselmis_virus(100.0%)	1	NA	NA
WP_151605550.1|4859881_4861858_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.7	6.0e-164
>prophage 350
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4867384	4868071	4919347		Planktothrix_phage(100.0%)	1	NA	NA
WP_125293917.1|4867384_4868071_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	1.1e-32
>prophage 351
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4877680	4888139	4919347		Vibrio_phage(75.0%)	6	NA	NA
WP_151605557.1|4877680_4878679_-	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	40.3	9.4e-49
WP_151605558.1|4878693_4879629_-	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_151605559.1|4879625_4880933_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_151605560.1|4880949_4884186_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	27.0	2.2e-78
WP_125293930.1|4884182_4885166_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.9	5.6e-46
WP_151605561.1|4885637_4888139_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.9	5.3e-109
>prophage 352
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4896119	4904576	4919347		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_151605566.1|4896119_4897091_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	29.7	3.2e-17
WP_144132725.1|4897081_4898044_-	ferrochelatase	NA	NA	NA	NA	NA
WP_125293939.1|4898174_4898819_-	adenylate kinase	NA	NA	NA	NA	NA
WP_151605567.1|4899006_4900881_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.4	1.0e-112
WP_151605568.1|4900991_4901597_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_125293942.1|4901596_4901926_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_144132721.1|4902008_4903934_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	37.0	3.9e-43
WP_125293944.1|4904024_4904576_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.9	7.8e-29
>prophage 353
NZ_CP042499	Enterobacter sp. E76 chromosome, complete genome	4919347	4908429	4914288	4919347		Bacillus_phage(50.0%)	2	NA	NA
WP_144132715.1|4908429_4909866_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.1	1.0e-11
WP_151605573.1|4910400_4914288_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.6	1.9e-129
>prophage 1
NZ_CP042500	Enterobacter sp. E76 plasmid pE76_001, complete sequence	148871	0	94467	148871	integrase,transposase	uncultured_Caudovirales_phage(23.53%)	98	36664:36682	78456:78474
WP_151605694.1|1067_2261_+	DUF726 domain-containing protein	NA	NA	NA	NA	NA
WP_151605695.1|3230_4010_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	6.0e-51
WP_151605696.1|4042_4846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605697.1|4904_5246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605698.1|5766_6642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061549450.1|6705_6891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605699.1|7045_7444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061549448.1|8411_8642_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_061549447.1|8638_9055_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_071789783.1|9244_9571_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_151605700.1|10354_11263_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_142273976.1|11645_12792_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.7	4.6e-148
WP_151605701.1|12905_13337_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_151605702.1|13582_15058_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_032662190.1|15050_15731_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.7e-31
WP_151605703.1|15920_17306_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246152.1|17334_17688_+	Ag(+)/Cu(+) efflux RND transporter periplasmic metallochaperone SilF	NA	NA	NA	NA	NA
WP_001572354.1|17801_19094_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_151605704.1|19104_22251_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.2	5.2e-61
WP_002436620.1|22337_22778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151605705.1|22875_25347_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.1	2.2e-83
WP_000843497.1|25387_25585_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|25618_26356_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001395480.1|26500_27532_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_001023257.1|27799_28249_-	copper resistance protein	NA	NA	NA	NA	NA
WP_032669158.1|28483_30301_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_151605794.1|30300_31197_+	copper resistance protein CopB	NA	NA	NA	NA	NA
WP_032662224.1|31236_31617_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_151605706.1|31621_32551_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|32605_33286_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_151605707.1|33282_34683_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
WP_151605708.1|34898_35333_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_007374422.1|35711_35831_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004118349.1|35796_35976_-	antitoxin	NA	NA	NA	NA	NA
WP_151605709.1|36289_36550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151605710.1|36546_37800_+	hypothetical protein	NA	NA	NA	NA	NA
36664:36682	attL	CAGGGCGGTGACGCCCCGG	NA	NA	NA	NA
WP_151605711.1|37796_38477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151605712.1|38473_38953_+	hypothetical protein	NA	A0A0R6PHV6	Moraxella_phage	35.9	2.4e-18
WP_151605713.1|39363_39789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605714.1|40316_40577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151605715.1|41104_41434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605716.1|41652_42927_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_151605717.1|43275_43764_+	cytoplasmic protein	NA	NA	NA	NA	NA
WP_151605718.1|44013_44274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151605719.1|44710_44944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|45142_46147_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_023316432.1|46321_46747_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	1.9e-51
WP_032409266.1|46759_48049_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	3.4e-168
WP_004206577.1|48093_48414_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	2.9e-20
WP_016151343.1|48499_49198_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	4.5e-90
WP_004206574.1|49326_49632_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004206572.1|49642_50848_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_004206571.1|51023_51602_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	37.7	3.9e-23
WP_151605720.1|51760_54745_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.2	7.6e-304
WP_000427614.1|54823_55828_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_151605795.1|56229_56934_+	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_151605721.1|57767_58784_-	replication initiation protein	NA	NA	NA	NA	NA
WP_151605796.1|61078_62065_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	38.3	1.9e-46
WP_039265220.1|62454_62988_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_142273976.1|63033_64181_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.7	4.6e-148
WP_151605722.1|64351_64573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605723.1|64640_65761_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.7	3.0e-51
WP_151605724.1|65810_66260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605725.1|66256_66580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001166628.1|66705_67161_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294660.1|67232_67583_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_151605726.1|67598_67874_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_151605727.1|67901_68309_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_003055149.1|68347_70030_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.5e-38
WP_001277463.1|70047_70413_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|70409_70646_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|70629_70749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|70711_70924_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_151605728.1|71075_72791_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	24.4	1.2e-06
WP_151605729.1|72793_73702_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_151605730.1|73698_74910_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_151605731.1|74970_75585_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	44.2	6.6e-37
WP_151605732.1|75599_75962_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151605733.1|76106_76877_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_151605734.1|76886_77690_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_151605735.1|77702_78380_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_151605736.1|78381_79449_+	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	1.9e-23
78456:78474	attR	CCGGGGCGTCACCGCCCTG	NA	NA	NA	NA
WP_001162010.1|79705_80263_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	3.4e-48
WP_151605737.1|80347_81037_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	97.9	1.7e-134
WP_001752509.1|81363_81864_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_151605738.1|82180_83152_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.7	6.1e-178
WP_142515124.1|83136_84410_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.1e-170
WP_000780222.1|84774_85056_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|85036_85366_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_071787999.1|85586_85865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012817690.1|85970_88979_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_001556711.1|89142_89715_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
WP_004118313.1|89723_90128_+	arsenic transporter ATPase	NA	NA	NA	NA	NA
WP_000065758.1|90158_90584_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_000922630.1|90596_91886_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
WP_001556710.1|91934_93686_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_000783215.1|93703_94066_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001114073.1|94113_94467_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
>prophage 2
NZ_CP042500	Enterobacter sp. E76 plasmid pE76_001, complete sequence	148871	115188	115512	148871		Enterobacterial_phage(100.0%)	1	NA	NA
WP_151605750.1|115188_115512_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	48.0	3.9e-20
>prophage 3
NZ_CP042500	Enterobacter sp. E76 plasmid pE76_001, complete sequence	148871	126760	148389	148871		Enterobacteria_phage(20.0%)	27	NA	NA
WP_151605766.1|126760_127582_-	DUF932 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.5	3.2e-47
WP_151605767.1|127643_127856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605768.1|128573_129398_-	N-6 DNA methylase	NA	H7BVT3	unidentified_phage	35.3	8.9e-13
WP_151605769.1|129443_129590_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_151605770.1|129682_130039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605771.1|130142_130352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605772.1|130619_130910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151605773.1|131168_131384_-	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	47.9	2.8e-11
WP_151605774.1|131625_131952_-	theronine dehydrogenase	NA	I3UM57	Rhodobacter_phage	38.4	2.3e-12
WP_151605775.1|131948_132680_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_151605776.1|132676_133108_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_151605777.1|133152_135165_-	hypothetical protein	NA	G8DH78	Emiliania_huxleyi_virus	27.6	3.3e-16
WP_151605778.1|135525_136068_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	77.5	6.2e-55
WP_151605779.1|136732_136990_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	65.9	4.7e-21
WP_151605780.1|137178_137382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605781.1|137421_137922_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	29.4	8.1e-09
WP_151605782.1|138332_138806_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_151605783.1|138809_139034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605784.1|139030_139663_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	35.0	6.0e-25
WP_151605785.1|140168_141140_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.1	2.0e-112
WP_151605786.1|141136_142342_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	90.2	2.3e-206
WP_151605787.1|142850_143597_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	89.0	2.1e-125
WP_151605788.1|144028_145300_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	62.9	3.7e-151
WP_151605789.1|145299_145728_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.8	1.0e-28
WP_151605790.1|146291_147275_+	acryloyl-CoA reductase	NA	NA	NA	NA	NA
WP_151605791.1|147332_147989_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151605792.1|148218_148389_+	hypothetical protein	NA	O80281	Escherichia_phage	63.6	4.8e-14
>prophage 1
NZ_CP042501	Enterobacter sp. E76 plasmid pE76_002, complete sequence	96541	2110	45340	96541	transposase,protease,integrase	Escherichia_phage(25.0%)	46	1913:1972	31344:32298
1913:1972	attL	GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATC	NA	NA	NA	NA
WP_001067834.1|2110_2815_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_014344500.1|2848_3121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|3089_4103_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015060105.1|4255_4996_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_015063357.1|5227_5560_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_003159191.1|5686_6241_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|6335_6968_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000679427.1|7124_7472_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_012817690.1|8094_11103_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_001556711.1|11266_11839_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	89.0	2.0e-83
WP_004118313.1|11847_12252_+	arsenic transporter ATPase	NA	NA	NA	NA	NA
WP_000065758.1|12282_12708_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_000922630.1|12720_14010_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.5e-171
WP_001556710.1|14058_15810_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_000783215.1|15827_16190_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001114073.1|16237_16591_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_000050481.1|17519_19061_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003833285.1|20367_20820_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_012695489.1|20861_21506_-	quinolone resistance pentapeptide repeat protein QnrB2	NA	NA	NA	NA	NA
WP_000259031.1|21996_22836_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|22765_22945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883563.1|22963_23236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|23417_24422_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|24649_25855_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|25865_26171_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|26186_26369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|26397_27162_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|27352_27709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|27654_28239_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|28238_29477_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|29473_30379_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067834.1|30500_31205_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000557454.1|31437_32298_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
31344:32298	attR	GATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTATAGTGTTTTGCAGTTTAGAGGAGATATCGCGATGCATACGCGGAAGGCAATAACGGAGGCGCTTCAAAAACTCGGAGTCCAAACCGGTGACCTCTTGATGGTGCATGCCTCACTTAAAGCGATTGGTCCGGTCGAAGGAGGAGCGGAGACGGTCGTTGCCGCGTTACGCTCCGCGGTTGGGCCGACTGGCACTGTGATGGGATACGCGTCGTGGGACCGATCACCCTACGAGGAGACTCTGAATGGCGCTCGGCTGGATGACGAAGCCCGCCGTACCTGGCTGCCGTTCGATCCCGCAACAGCCGGGACTTACCGTGGGTTCGGCCTGCTGAATCAATTTCTGGTTCAAGCCCCCGGCGCGCGGCGCAGCGCGCACCCCGATGCATCGATGGTCGCGGTTGGTCCGCTGGCTGAAACGCTGACGGAGCCTCACGAACTCGGTCACGCCTTGGGGGAAGGATCGCCCGTCGAGCGGTTCGTTCGCCTTGGCGGGAAGGCCCTGCTGTTGGGTGCGCCGCTAAACTCCGTTACCGCATTGCACTACGCCGAGGCGGTTGCCGATATCCCCAACAAACGGTGGGTGACGTATGAGATGCCGATGCTTGGAAGAGACGGTGAAGTCGCCTGGAAAACGGCATCGGATTACGATTCAAACGGCATTCTCGATTGCTTTGCTATCGAAGGAAAGCCGGATGCGGTTGAAACTATAGCAAATGCTTACGTGAAGCTCGGTCGCCATCGAGAAGGTGTCGTGGGCTTTGCTCAGTGCTACCTGTTCGACGCGCAGGACATCGTGACGTTCGGCGTCACCTATCTTGAGAAGCATTTCGGAACCACTCCGATCGTGCCTCCGCACGAGGCCGTCGAGCGCTCTTGCGAGCCTTCAGGTTAG	NA	NA	NA	NA
WP_000587837.1|32310_32853_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|33334_33526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|33531_33777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|33827_34964_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000971921.1|35078_36449_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|37269_38130_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_011091091.1|38798_39308_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011091092.1|39355_41443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012579091.1|41455_42406_-	DsbC family protein	NA	NA	NA	NA	NA
WP_045626305.1|42416_43679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077256341.1|43723_43999_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_045626302.1|44223_44607_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_011091025.1|44686_45340_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP042502	Enterobacter sp. E76 plasmid pE76_003, complete sequence	76914	0	62741	76914	integrase,holin,terminase,lysis,tail,head,transposase	uncultured_Caudovirales_phage(28.95%)	60	34590:34649	66764:67584
WP_151605798.1|1316_1862_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	82.9	1.7e-84
WP_151605799.1|1858_2239_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	87.9	4.6e-57
WP_151605800.1|2225_2777_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	69.2	1.4e-62
WP_151605801.1|2773_3178_-	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	91.8	1.2e-63
WP_151605802.1|3143_3518_-	hypothetical protein	NA	A0A2H4J9M7	uncultured_Caudovirales_phage	65.9	4.7e-38
WP_151605803.1|3555_4494_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	88.1	1.7e-161
WP_151605804.1|4508_5003_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	87.8	5.8e-76
WP_151605805.1|5013_6249_-	DUF2213 domain-containing protein	NA	A0A2H4J159	uncultured_Caudovirales_phage	82.3	8.3e-180
WP_151605806.1|6251_6431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605807.1|6433_7081_-|head	phage head morphogenesis protein	head	A0A2H4J8F5	uncultured_Caudovirales_phage	89.3	6.4e-107
WP_151605808.1|7037_8513_-	DUF1073 domain-containing protein	NA	A0A2H4IYV2	uncultured_Caudovirales_phage	89.4	5.7e-260
WP_151605809.1|8515_10132_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	85.1	2.3e-283
WP_151605810.1|10219_10459_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_151605811.1|10481_11054_-|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	65.5	8.8e-60
WP_151605812.1|11239_11722_-|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	62.7	1.3e-43
WP_151605813.1|11718_12195_-	glycoside hydrolase family protein	NA	K7P890	Enterobacteria_phage	75.6	9.6e-60
WP_151605847.1|12181_12487_-|holin	holin	holin	E7C9S8	Salmonella_phage	80.0	4.9e-41
WP_001567368.1|12777_14181_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|14209_14842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605814.1|15181_15616_-	antitermination protein Q	NA	B6SD39	Bacteriophage	59.6	5.9e-40
WP_151605815.1|15922_18091_-	replication protein	NA	B6SCY1	Bacteriophage	72.6	5.4e-174
WP_151605816.1|18094_18307_-	helix-turn-helix domain-containing protein	NA	A0A0R6PHL1	Moraxella_phage	41.3	6.0e-06
WP_151605817.1|18428_19052_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	6.7e-37
WP_151605818.1|19738_21094_+	hypothetical protein	NA	A0A2H4FRY7	Salmonella_phage	65.3	7.3e-12
WP_151605819.1|21990_23292_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	58.1	2.3e-140
WP_151605820.1|23306_23855_+	DUF2815 family protein	NA	Q3LZQ2	Bacteriophage	62.8	8.8e-57
WP_151605821.1|23931_25998_+	DNA polymerase	NA	Q775A3	Bordetella_phage	68.0	8.7e-275
WP_151605822.1|26003_26207_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	58.1	1.4e-12
WP_151605823.1|26212_26410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065357949.1|26421_26634_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151605824.1|26634_26823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151605825.1|26825_27095_+	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	67.1	1.3e-26
WP_151605826.1|27087_27609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151605827.1|27674_28547_+	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	55.1	3.1e-80
WP_151605828.1|28533_29934_+	ATP-dependent helicase	NA	Q3LZN8	Bacteriophage	74.1	8.4e-213
WP_024154042.1|29930_30131_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_111760116.1|30127_31525_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_151605829.1|31897_32452_-	helix-turn-helix domain-containing protein	NA	A0A0F7LA37	Escherichia_phage	88.3	1.3e-87
WP_151605830.1|33200_33635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151605848.1|33631_34033_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	46.9	6.7e-22
34590:34649	attL	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067855.1|34642_35347_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_151602257.1|36821_37942_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.7	3.0e-51
WP_004098991.1|38378_40445_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001549948.1|41327_42563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549947.1|42615_43719_+	ring-opening amidohydrolase	NA	NA	NA	NA	NA
WP_059509648.1|43840_45145_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.2	4.4e-30
WP_072268827.1|45777_46221_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_024194858.1|46316_47867_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_001549942.1|47876_49298_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_059509645.1|49294_50257_+	carbamate kinase	NA	NA	NA	NA	NA
WP_049592198.1|50504_51407_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080400672.1|52862_53192_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001395480.1|53320_54352_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_151605831.1|54701_54851_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_151605832.1|55019_55760_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	7.0e-25
WP_151605849.1|56067_56706_-	DNA replication protein	NA	J9Q7H0	Salmonella_phage	50.8	1.1e-47
WP_151602493.1|56845_58119_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.1	1.4e-145
WP_109455549.1|59156_60364_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.6	1.8e-102
WP_151605833.1|60603_61767_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	96.4	2.8e-222
WP_151605834.1|61769_62741_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	83.9	3.6e-146
66764:67584	attR	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 2
NZ_CP042502	Enterobacter sp. E76 plasmid pE76_003, complete sequence	76914	66816	76726	76914	transposase	Salmonella_phage(72.73%)	13	NA	NA
WP_001067855.1|66816_67521_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_151605835.1|67778_68459_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	81.4	2.9e-110
WP_151605836.1|68455_69655_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	88.7	2.6e-194
WP_151605837.1|69655_70009_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	93.2	3.3e-57
WP_151605838.1|70008_70761_-	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	70.5	6.1e-93
WP_151605839.1|70898_71120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151605840.1|71180_71513_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	67.9	3.8e-23
WP_151605841.1|71512_72577_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	82.3	9.4e-156
WP_151605842.1|72579_72882_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	93.0	6.3e-49
WP_151605843.1|72881_73457_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	92.7	2.6e-91
WP_151605850.1|75668_75845_-	lytic transglycosylase	NA	NA	NA	NA	NA
WP_151605844.1|75856_76282_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	60.4	7.0e-38
WP_151605845.1|76285_76726_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	79.5	8.0e-61
