The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042512	Serratia marcescens strain E28 chromosome, complete genome	5419694	1863104	1900894	5419694	protease,integrase,tail,terminase	Pectobacterium_phage(31.43%)	49	1861954:1861969	1884630:1884645
1861954:1861969	attL	CATCACGTCCGGCATC	NA	NA	NA	NA
WP_151522950.1|1863104_1864175_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	53.9	5.1e-109
WP_047568270.1|1864116_1864377_-	excisionase	NA	A0A1V0E5M4	Salmonella_phage	62.9	8.4e-18
WP_151522951.1|1864342_1864543_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	55.7	3.8e-10
WP_151522952.1|1864810_1865311_-	hypothetical protein	NA	H9C156	Pectobacterium_phage	68.1	3.7e-54
WP_151522953.1|1865307_1867500_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.8	6.8e-100
WP_151522954.1|1867547_1867826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151522955.1|1867836_1868154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151522956.1|1868302_1868623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151522957.1|1868645_1869053_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	48.1	4.1e-27
WP_147190763.1|1869135_1869336_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	46.6	2.5e-09
WP_151522958.1|1869397_1869850_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	1.3e-29
WP_079451884.1|1869874_1870099_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	73.0	4.7e-25
WP_139145182.1|1870146_1870905_+	replication protein	NA	H9C164	Pectobacterium_phage	62.8	1.3e-37
WP_151522959.1|1870894_1872310_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	67.2	2.4e-175
WP_151522960.1|1872354_1872777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079451893.1|1872780_1873026_+	hypothetical protein	NA	H9C167	Pectobacterium_phage	47.6	5.0e-12
WP_151522961.1|1873132_1873339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151522962.1|1873325_1873844_+	SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.4	7.7e-71
WP_151522963.1|1873840_1874080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151522964.1|1874079_1874541_+	hypothetical protein	NA	R9W086	Serratia_phage	37.9	2.6e-22
WP_151522965.1|1874712_1875000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151522966.1|1875176_1875368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151522967.1|1875437_1876034_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	66.2	1.0e-74
WP_079451910.1|1876042_1876348_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	57.3	1.2e-26
WP_041034508.1|1876502_1876799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151522968.1|1876827_1877280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060435325.1|1877290_1877518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151522969.1|1877521_1879144_+|tail	phage tail protein	tail	A0A2H4J3N6	uncultured_Caudovirales_phage	58.1	5.6e-176
WP_060431585.1|1879143_1879377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151522970.1|1879363_1880185_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	39.6	1.1e-39
WP_151522971.1|1880396_1881308_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	38.3	2.4e-43
WP_151522972.1|1881363_1881927_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	50.3	1.4e-49
WP_151522973.1|1881929_1883921_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	47.4	4.3e-178
WP_151522974.1|1883923_1884373_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	45.0	2.3e-23
WP_151522975.1|1884375_1884903_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	45.7	1.1e-08
1884630:1884645	attR	CATCACGTCCGGCATC	NA	NA	NA	NA
WP_151522976.1|1884902_1887428_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	44.6	3.3e-175
WP_151522977.1|1887424_1888894_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	49.7	1.6e-100
WP_151522978.1|1888898_1891373_+	hypothetical protein	NA	A0A193GZ61	Enterobacter_phage	74.6	0.0e+00
WP_151522979.1|1891390_1891729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151522980.1|1891797_1892139_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	47.3	2.6e-19
WP_151522981.1|1892135_1893746_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	71.2	1.1e-229
WP_151522982.1|1893761_1895684_+	hypothetical protein	NA	A0A2H4J3Z5	uncultured_Caudovirales_phage	42.6	3.9e-27
WP_151522983.1|1895680_1897297_+	hypothetical protein	NA	A0A2K9VAJ5	Klebsiella_virus	25.6	8.1e-26
WP_151522984.1|1897614_1898130_+	glycoside hydrolase family protein	NA	I6PBN2	Cronobacter_phage	64.0	2.8e-49
WP_151522985.1|1898114_1898489_+	hypothetical protein	NA	A0A248XD11	Klebsiella_phage	44.6	2.4e-13
WP_151522986.1|1898485_1898743_+	hypothetical protein	NA	A0A248XCT8	Klebsiella_phage	55.8	1.7e-15
WP_151522987.1|1898860_1899259_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	52.0	3.2e-24
WP_004928095.1|1899793_1900123_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_004928091.1|1900234_1900894_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	48.8	4.7e-41
>prophage 3
NZ_CP042512	Serratia marcescens strain E28 chromosome, complete genome	5419694	3512868	3682870	5419694	plate,head,protease,integrase,terminase,transposase,capsid,tail,portal	Salmonella_phage(33.33%)	214	3589384:3589443	3668036:3668506
WP_000019473.1|3512868_3513849_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_151523062.1|3513894_3516105_-	hypothetical protein	NA	H6X4Z1	Enterobacteria_phage	43.4	5.0e-18
WP_151523063.1|3516104_3516512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146158857.1|3516495_3516795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151523064.1|3516799_3518518_-	hypothetical protein	NA	A0A2I5ARA4	Synechococcus_phage	24.0	6.8e-23
WP_151523065.1|3518462_3520010_-|portal	phage portal protein	portal	D5LH02	Escherichia_phage	24.8	1.6e-23
WP_072271352.1|3520009_3520498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072271353.1|3520500_3522417_-	hypothetical protein	NA	V5YTA4	Pseudomonas_phage	25.9	9.9e-39
WP_151523066.1|3522304_3522829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151523067.1|3523630_3524005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151523068.1|3524343_3524961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060435456.1|3525273_3526284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072271336.1|3526508_3526712_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_151523069.1|3526810_3527320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151523070.1|3527469_3528108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060435458.1|3528728_3529199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060435459.1|3529247_3529847_-	hypothetical protein	NA	A0A2H4PHE8	Dickeya_phage	30.9	3.1e-15
WP_060433683.1|3530635_3531139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072271250.1|3531392_3533129_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	27.1	2.8e-16
WP_134268154.1|3533166_3533370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038876300.1|3533414_3533990_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	1.9e-14
WP_134268142.1|3534002_3534251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038876302.1|3534402_3535986_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_055316180.1|3536079_3537891_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048234471.1|3537900_3538992_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_047730239.1|3538988_3540014_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_047730238.1|3540015_3541626_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.9	2.1e-18
WP_047730237.1|3541635_3541980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055316175.1|3542574_3543771_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.3	2.4e-22
WP_055316172.1|3543812_3544526_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_047730234.1|3544844_3546602_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.4	1.7e-98
WP_019453645.1|3546764_3547049_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_047730233.1|3547133_3548141_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.4	4.1e-84
WP_004935782.1|3548352_3548580_+	YejL family protein	NA	NA	NA	NA	NA
WP_060433679.1|3548589_3550371_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_004157630.1|3550783_3550939_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	78.4	1.2e-16
WP_151523071.1|3550961_3551372_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	51.5	3.7e-36
WP_151523072.1|3551417_3551924_+	acetyltransferase	NA	NA	NA	NA	NA
WP_151523140.1|3551925_3552378_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	42.5	9.9e-14
WP_151523073.1|3553707_3554295_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	78.5	9.0e-92
WP_151523074.1|3554298_3555372_-|plate	phage baseplate protein	plate	A0A192Y6E4	Salmonella_phage	71.5	1.9e-148
WP_151523141.1|3555364_3555778_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	71.5	4.9e-52
WP_048796478.1|3555777_3556314_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	52.2	2.3e-38
WP_151523075.1|3556313_3557384_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	69.9	3.4e-145
WP_151523076.1|3557380_3558682_-	DNA circularization protein	NA	U5P4I0	Shigella_phage	60.5	2.8e-146
WP_151523077.1|3558717_3560625_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	56.9	5.5e-183
WP_055312938.1|3560709_3561033_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	58.9	3.3e-27
WP_025303576.1|3561029_3561386_-	hypothetical protein	NA	Q8W622	Enterobacteria_phage	82.2	7.2e-52
WP_151523078.1|3561385_3562903_-|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	70.1	1.1e-194
WP_071826132.1|3562899_3563073_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	61.8	6.0e-12
WP_048796484.1|3563076_3563637_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	81.7	1.7e-84
WP_055312932.1|3563633_3564152_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	84.1	5.0e-78
WP_055312929.1|3564123_3564534_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	69.9	3.0e-46
WP_025303580.1|3564530_3564854_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	65.1	3.2e-35
WP_151523079.1|3564934_3566173_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	83.7	6.8e-190
WP_049193565.1|3566182_3566782_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	79.9	1.4e-87
WP_025303583.1|3566774_3568001_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	80.2	2.4e-195
WP_049193569.1|3568148_3569882_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	85.2	7.5e-304
WP_048796489.1|3569878_3570373_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	85.4	3.6e-78
WP_151523080.1|3570468_3570825_-	HNH endonuclease	NA	S5FKR6	Shigella_phage	75.4	1.5e-49
WP_151523081.1|3570805_3571171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151523082.1|3571167_3571797_-	hypothetical protein	NA	A0A2H4PI74	Pseudomonas_phage	46.9	2.0e-44
WP_151523083.1|3571771_3572644_-	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	46.5	2.5e-69
WP_151523084.1|3572652_3573201_-	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	54.2	1.8e-49
WP_151523142.1|3573439_3573646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151523085.1|3573590_3573971_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_151523086.1|3573967_3574447_-	glycoside hydrolase family protein	NA	A0A1R3Y5W5	Salmonella_virus	61.0	2.2e-51
WP_049193623.1|3574448_3574721_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	91.1	2.0e-38
WP_151523087.1|3575402_3576224_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	38.5	3.1e-50
WP_151523088.1|3576220_3577258_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	46.6	7.1e-84
WP_151523089.1|3577254_3578385_-	site-specific DNA-methyltransferase	NA	A0A1P8DTZ3	Salmonella_phage	53.0	1.9e-98
WP_151523090.1|3578381_3578624_-	hypothetical protein	NA	A0A1W6JP32	Morganella_phage	41.2	8.4e-12
WP_151523091.1|3578620_3579712_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	53.1	1.1e-71
WP_151523092.1|3579708_3579897_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_055312896.1|3579893_3580076_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_048797340.1|3580075_3580897_-	hypothetical protein	NA	A0A248SL11	Klebsiella_phage	50.8	2.0e-41
WP_151523093.1|3580889_3581084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151523094.1|3581149_3581623_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	64.7	1.1e-52
WP_129939134.1|3581648_3581909_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151523143.1|3582030_3582612_+	helix-turn-helix domain-containing protein	NA	A0A059NT51	Lactococcus_phage	42.9	1.8e-07
WP_151523095.1|3582900_3583059_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	50.0	8.4e-05
WP_151523096.1|3583972_3584344_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	74.0	5.5e-47
WP_151523097.1|3584398_3585220_+	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	62.9	2.7e-94
WP_013813841.1|3585304_3585838_+	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	59.8	1.8e-54
WP_151523098.1|3585837_3586020_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_151523099.1|3586016_3586781_+	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	62.2	1.0e-87
WP_151523100.1|3586926_3587445_+	hypothetical protein	NA	Q7Y3W7	Yersinia_phage	57.6	2.3e-54
WP_151523101.1|3587444_3587939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013813848.1|3587986_3588205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151523102.1|3588204_3589383_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	31.4	5.0e-33
3589384:3589443	attL	TCAAATTGGGGGGAATCCCCCCAACTCATGCTCAGTCGTAAAAAGCAGGAAGCCCACCTG	NA	NA	NA	NA
WP_151523103.1|3589414_3589624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004157630.1|3590109_3590265_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	78.4	1.2e-16
WP_151523071.1|3590287_3590698_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	51.5	3.7e-36
WP_151523072.1|3590743_3591250_+	acetyltransferase	NA	NA	NA	NA	NA
WP_151523140.1|3591251_3591704_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	42.5	9.9e-14
WP_151523073.1|3593033_3593621_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	78.5	9.0e-92
WP_151523074.1|3593624_3594698_-|plate	phage baseplate protein	plate	A0A192Y6E4	Salmonella_phage	71.5	1.9e-148
WP_151523141.1|3594690_3595104_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	71.5	4.9e-52
WP_048796478.1|3595103_3595640_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	52.2	2.3e-38
WP_151523075.1|3595639_3596710_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	69.9	3.4e-145
WP_151523076.1|3596706_3598008_-	DNA circularization protein	NA	U5P4I0	Shigella_phage	60.5	2.8e-146
WP_151523077.1|3598043_3599951_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	56.9	5.5e-183
WP_055312938.1|3600035_3600359_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	58.9	3.3e-27
WP_025303576.1|3600355_3600712_-	hypothetical protein	NA	Q8W622	Enterobacteria_phage	82.2	7.2e-52
WP_151523078.1|3600711_3602229_-|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	70.1	1.1e-194
WP_071826132.1|3602225_3602399_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	61.8	6.0e-12
WP_048796484.1|3602402_3602963_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	81.7	1.7e-84
WP_055312932.1|3602959_3603478_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	84.1	5.0e-78
WP_055312929.1|3603449_3603860_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	69.9	3.0e-46
WP_025303580.1|3603856_3604180_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	65.1	3.2e-35
WP_151523079.1|3604260_3605499_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	83.7	6.8e-190
WP_049193565.1|3605508_3606108_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	79.9	1.4e-87
WP_025303583.1|3606100_3607327_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	80.2	2.4e-195
WP_049193569.1|3607474_3609208_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	85.2	7.5e-304
WP_048796489.1|3609204_3609699_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	85.4	3.6e-78
WP_151523080.1|3609794_3610151_-	HNH endonuclease	NA	S5FKR6	Shigella_phage	75.4	1.5e-49
WP_151523081.1|3610131_3610497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151523082.1|3610493_3611123_-	hypothetical protein	NA	A0A2H4PI74	Pseudomonas_phage	46.9	2.0e-44
WP_151523083.1|3611097_3611970_-	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	46.5	2.5e-69
WP_151523084.1|3611978_3612527_-	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	54.2	1.8e-49
WP_151523142.1|3612765_3612972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151523085.1|3612916_3613297_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_151523086.1|3613293_3613773_-	glycoside hydrolase family protein	NA	A0A1R3Y5W5	Salmonella_virus	61.0	2.2e-51
WP_049193623.1|3613774_3614047_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	91.1	2.0e-38
WP_151523087.1|3614728_3615550_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	38.5	3.1e-50
WP_151523088.1|3615546_3616584_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	46.6	7.1e-84
WP_151523089.1|3616580_3617711_-	site-specific DNA-methyltransferase	NA	A0A1P8DTZ3	Salmonella_phage	53.0	1.9e-98
WP_151523090.1|3617707_3617950_-	hypothetical protein	NA	A0A1W6JP32	Morganella_phage	41.2	8.4e-12
WP_151523091.1|3617946_3619038_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	53.1	1.1e-71
WP_151523092.1|3619034_3619223_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_055312896.1|3619219_3619402_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_048797340.1|3619401_3620223_-	hypothetical protein	NA	A0A248SL11	Klebsiella_phage	50.8	2.0e-41
WP_151523093.1|3620215_3620410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151523094.1|3620475_3620949_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	64.7	1.1e-52
WP_129939134.1|3620974_3621235_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151523143.1|3621356_3621938_+	helix-turn-helix domain-containing protein	NA	A0A059NT51	Lactococcus_phage	42.9	1.8e-07
WP_151523095.1|3622226_3622385_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	50.0	8.4e-05
WP_151523096.1|3623298_3623670_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	74.0	5.5e-47
WP_151523097.1|3623724_3624546_+	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	62.9	2.7e-94
WP_013813841.1|3624630_3625164_+	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	59.8	1.8e-54
WP_151523098.1|3625163_3625346_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_151523099.1|3625342_3626107_+	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	62.2	1.0e-87
WP_151523100.1|3626252_3626771_+	hypothetical protein	NA	Q7Y3W7	Yersinia_phage	57.6	2.3e-54
WP_151523101.1|3626770_3627265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013813848.1|3627312_3627531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151523102.1|3627530_3628709_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	31.4	5.0e-33
WP_151523103.1|3628740_3628950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004157630.1|3629435_3629591_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	78.4	1.2e-16
WP_151523071.1|3629613_3630024_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	51.5	3.7e-36
WP_151523072.1|3630069_3630576_+	acetyltransferase	NA	NA	NA	NA	NA
WP_151523140.1|3630577_3631030_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	42.5	9.9e-14
WP_151523073.1|3632359_3632947_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	78.5	9.0e-92
WP_151523074.1|3632950_3634024_-|plate	phage baseplate protein	plate	A0A192Y6E4	Salmonella_phage	71.5	1.9e-148
WP_151523141.1|3634016_3634430_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	71.5	4.9e-52
WP_048796478.1|3634429_3634966_-|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	52.2	2.3e-38
WP_151523075.1|3634965_3636036_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	69.9	3.4e-145
WP_151523076.1|3636032_3637334_-	DNA circularization protein	NA	U5P4I0	Shigella_phage	60.5	2.8e-146
WP_151523077.1|3637369_3639277_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	56.9	5.5e-183
WP_055312938.1|3639361_3639685_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	58.9	3.3e-27
WP_025303576.1|3639681_3640038_-	hypothetical protein	NA	Q8W622	Enterobacteria_phage	82.2	7.2e-52
WP_151523078.1|3640037_3641555_-|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	70.1	1.1e-194
WP_071826132.1|3641551_3641725_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	61.8	6.0e-12
WP_048796484.1|3641728_3642289_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	81.7	1.7e-84
WP_055312932.1|3642285_3642804_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	84.1	5.0e-78
WP_055312929.1|3642775_3643186_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	69.9	3.0e-46
WP_025303580.1|3643182_3643506_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	65.1	3.2e-35
WP_151523079.1|3643586_3644825_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	83.7	6.8e-190
WP_049193565.1|3644834_3645434_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	79.9	1.4e-87
WP_025303583.1|3645426_3646653_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	80.2	2.4e-195
WP_049193569.1|3646800_3648534_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	85.2	7.5e-304
WP_048796489.1|3648530_3649025_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	85.4	3.6e-78
WP_151523080.1|3649120_3649477_-	HNH endonuclease	NA	S5FKR6	Shigella_phage	75.4	1.5e-49
WP_151523081.1|3649457_3649823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151523082.1|3649819_3650449_-	hypothetical protein	NA	A0A2H4PI74	Pseudomonas_phage	46.9	2.0e-44
WP_151523083.1|3650423_3651296_-	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	46.5	2.5e-69
WP_151523084.1|3651304_3651853_-	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	54.2	1.8e-49
WP_151523142.1|3652091_3652298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151523085.1|3652242_3652623_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_151523086.1|3652619_3653099_-	glycoside hydrolase family protein	NA	A0A1R3Y5W5	Salmonella_virus	61.0	2.2e-51
WP_049193623.1|3653100_3653373_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	91.1	2.0e-38
WP_151523087.1|3654054_3654876_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	38.5	3.1e-50
WP_151523088.1|3654872_3655910_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	46.6	7.1e-84
WP_151523089.1|3655906_3657037_-	site-specific DNA-methyltransferase	NA	A0A1P8DTZ3	Salmonella_phage	53.0	1.9e-98
WP_151523090.1|3657033_3657276_-	hypothetical protein	NA	A0A1W6JP32	Morganella_phage	41.2	8.4e-12
WP_151523091.1|3657272_3658364_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	53.1	1.1e-71
WP_151523092.1|3658360_3658549_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_055312896.1|3658545_3658728_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_048797340.1|3658727_3659549_-	hypothetical protein	NA	A0A248SL11	Klebsiella_phage	50.8	2.0e-41
WP_151523093.1|3659541_3659736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151523094.1|3659801_3660275_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	64.7	1.1e-52
WP_129939134.1|3660300_3660561_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_151523143.1|3660682_3661264_+	helix-turn-helix domain-containing protein	NA	A0A059NT51	Lactococcus_phage	42.9	1.8e-07
WP_151523095.1|3661552_3661711_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	50.0	8.4e-05
WP_151523096.1|3662624_3662996_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	74.0	5.5e-47
WP_151523097.1|3663050_3663872_+	DUF2303 family protein	NA	A0A192Y6E5	Salmonella_phage	62.9	2.7e-94
WP_013813841.1|3663956_3664490_+	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	59.8	1.8e-54
WP_151523098.1|3664489_3664672_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_151523099.1|3664668_3665433_+	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	62.2	1.0e-87
WP_151523100.1|3665578_3666097_+	hypothetical protein	NA	Q7Y3W7	Yersinia_phage	57.6	2.3e-54
WP_151523101.1|3666096_3666591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013813848.1|3666638_3666857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151523102.1|3666856_3668035_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	31.4	5.0e-33
WP_151523103.1|3668066_3668276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_055317203.1|3668715_3671787_-	tetrathionate reductase subunit TtrA	NA	A0A077SK27	Escherichia_phage	27.1	3.8e-08
3668036:3668506	attR	TCAAATTGGGGGGAATCCCCCCAACTCATGCTCAGTCGTAAAAAGCAGGAAGCCCACCTGCAAGAGCCTCAATGGTATCTCTGGCTTTCATCCCTACCATCCCTTTACGAATAACAAATAAATTTGCATTATCTGGGTTATTTTCATAACCATTTTCCTGCAAAAAGCGATTGTATTCATCTACAAGCTGTTGTCGCTCAATAGACTCCCAGTGCAACTGGTTAGGGCTTTTCCTTGGCATGTAGCCATCCTCATTTAGAGTTAACGTTTTTGAATTATAACGGAAATGTCATGATGGCAAAACCGTGTCTAAGTTATTGATGTATATAGACCGATTTTGGCGAGAAATGCACTGTTTGTATGAACAGTCAAAACAGAGAAGAGCCAGTCGTGGCGGGGCTTGCAGCGGTTTAGTGTCGGTGTCATGGGGTGTCGGGGGTCGGAGGTTCGAATCCTCTCATGCCGACCAAA	NA	NA	NA	NA
WP_048234475.1|3671779_3672805_-	tetrathionate reductase subunit TtrC	NA	NA	NA	NA	NA
WP_060433678.1|3672801_3673539_-	tetrathionate reductase subunit TtrB	NA	NA	NA	NA	NA
WP_151523144.1|3673735_3675490_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_060433675.1|3675461_3676061_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_038876336.1|3676400_3677063_+	VUT family protein	NA	NA	NA	NA	NA
WP_038876338.1|3677080_3677812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038876340.1|3677804_3678293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038876342.1|3678293_3678947_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_055317200.1|3679816_3680059_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	82.3	5.8e-29
WP_060433671.1|3681709_3682870_-|tail	tail fiber domain-containing protein	tail	Q5G8V6	Enterobacteria_phage	38.6	6.6e-54
>prophage 4
NZ_CP042512	Serratia marcescens strain E28 chromosome, complete genome	5419694	3724778	3744487	5419694	transposase,holin,integrase,tail	Klebsiella_phage(22.22%)	22	3715897:3715911	3735632:3735646
3715897:3715911	attL	GCCGTGCTCCTGCCG	NA	NA	NA	NA
WP_151523104.1|3724778_3725920_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	59.5	5.3e-88
WP_003092330.1|3726235_3726745_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_003092331.1|3727096_3728161_-	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	41.0	7.2e-23
WP_001062689.1|3728157_3729357_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_147190872.1|3729960_3730764_-	hypothetical protein	NA	A0A1P8DUT0	Escherichia_phage	39.6	3.7e-48
WP_147190871.1|3730756_3731131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151523105.1|3731127_3734244_-	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	65.4	0.0e+00
WP_080490636.1|3734298_3734913_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	57.1	7.0e-55
WP_019453668.1|3734955_3735306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151523106.1|3735343_3736048_-	peptidase P60	NA	K7PGR2	Enterobacteria_phage	73.6	1.4e-104
3735632:3735646	attR	GCCGTGCTCCTGCCG	NA	NA	NA	NA
WP_047730874.1|3736057_3736807_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	64.9	4.5e-96
WP_004935824.1|3736820_3737159_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	60.0	1.1e-33
WP_110594732.1|3737158_3739318_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	43.1	2.1e-16
WP_019453673.1|3739310_3739532_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	49.3	7.7e-12
WP_055317208.1|3739549_3739915_-|tail	phage tail protein	tail	Q7Y401	Yersinia_phage	45.0	5.0e-24
WP_016926946.1|3740038_3740494_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	74.8	1.2e-56
WP_151523107.1|3740535_3740928_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	47.6	9.4e-21
WP_151523108.1|3740924_3741314_-	hypothetical protein	NA	Q7Y405	Yersinia_phage	42.9	2.2e-25
WP_047730205.1|3741371_3741812_-	lysozyme	NA	A0A0M5M782	Salmonella_phage	62.3	8.9e-44
WP_019453678.1|3741798_3742119_-|holin	holin	holin	F1C5D1	Cronobacter_phage	81.0	2.5e-40
WP_047730873.1|3743237_3743600_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	64.6	1.6e-38
WP_047730204.1|3743809_3744487_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	45.7	6.0e-07
>prophage 1
NZ_CP042513	Serratia marcescens strain E28 plasmid pE28_001, complete sequence	186249	1708	53422	186249	transposase,integrase	Bacillus_phage(33.33%)	56	NA	NA
WP_001515717.1|1708_2449_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_000227969.1|3404_4481_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004187025.1|5975_6224_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_014386491.1|6694_7675_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.2e-185
WP_009310077.1|8312_8570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023287113.1|8627_9407_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_009309921.1|9604_10621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009309920.1|10654_10990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009309919.1|11039_11351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197633.1|11408_11714_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_006788213.1|11715_11934_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_009483878.1|11985_12213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151523147.1|12103_12538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|12521_12752_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|12748_13165_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004206609.1|13238_14801_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_151523148.1|14785_15808_+	DNA helicase UvrD	NA	NA	NA	NA	NA
WP_032411229.1|16351_17260_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_004187110.1|17445_17796_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
WP_004187113.1|17943_18375_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|18625_20101_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|20093_20774_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|20963_22349_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_004213578.1|22377_22740_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_048270279.1|22853_24146_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_048270278.1|24156_27303_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.4	8.0e-62
WP_048270277.1|27389_27830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048270276.1|27956_30404_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.6	1.3e-83
WP_000843497.1|30444_30642_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|30675_31413_-	peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
WP_001023257.1|31701_32151_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|32384_34202_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|34201_35098_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|35137_35518_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004213583.1|35522_36452_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|36506_37187_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|37183_38584_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004118347.1|38799_39234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654306.1|39612_39732_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004118349.1|39697_39877_-	antitoxin	NA	NA	NA	NA	NA
WP_032415726.1|40190_40439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200905.1|40435_41668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200903.1|41801_42293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071606120.1|43331_43628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017896554.1|43517_43826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087759866.1|43932_45053_-|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
WP_022631396.1|45176_45413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001567366.1|45544_46093_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_001567367.1|46139_46574_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_003026799.1|46818_47085_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|47072_47555_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001567368.1|47755_49159_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|49187_49820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077253535.1|50045_51392_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004143398.1|51440_51836_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_009653207.1|52024_53422_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP042513	Serratia marcescens strain E28 plasmid pE28_001, complete sequence	186249	60777	85315	186249	transposase,integrase	Escherichia_phage(28.57%)	26	73733:73792	77701:78969
WP_151523149.1|60777_61983_+|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	51.1	1.8e-102
WP_151523150.1|62028_63312_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_004099052.1|63441_65634_-	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_001118616.1|66051_66975_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.1e-176
WP_003100847.1|67662_68220_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_003100853.1|68213_68585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|68581_69082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100858.1|69078_69405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003465043.1|69659_70016_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|70005_70407_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|70403_70694_-	nucleotidyltransferase	NA	NA	NA	NA	NA
73733:73792	attL	CTTAGCGTGCTTTATTTAATGAGATGGTCACTCCCTCCTTCCCAGTACTATGCTGAGGAC	NA	NA	NA	NA
WP_000427614.1|73815_74820_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_104877020.1|75001_75496_-	hypothetical protein	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	63.1	2.2e-43
WP_001549890.1|75492_75825_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_076752161.1|76314_76491_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_000427614.1|76672_77677_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000429838.1|77776_78211_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294667.1|78282_78633_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000735441.1|78648_78924_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000654684.1|78926_79172_+	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
77701:78969	attR	GTCCTCAGCATAGTACTGGGAAGGAGGGAGTGACCATCTCATTAAATAAAGCACGCTAAGGCGTAGTTCCCTCGGGCTACACCGCGTCCGCACTGCGCGGTTCTTTCTTCCCTTGCAGTGACGCAATCAGCGGACAGGAAACGTTCCCCTTCCGCGCATGGCAGGCGCACACCAAATCAGACAGCACGGCCTCCATGCGCGCCAGGTCAGCCATCCTCTCGCGCACGTCCTTGAGCTTGTGCTCGGCCAGGCTGCTGGCTTCCTCGCAATGGGTGCCATCCTCCAGCCGCAGCAGCTCGGCGATCTCATCCAGGCTGAAGCCCAACCGCTGGGCTGATTTCACGAAGCGCACCCGCGTTACATCCGTCTCGCCATAGCGGCGAATGCTGCCGTAAGGCTTGTCCGGTTCCGGGAGCAAGCCCTTGCGCTGATAGAACCGGATGGTCTCCACATTGACCCCGGCCGTCCTGGCGAAAACGCCAATGGTCAGGTTCTCCAAATTGTTTTCCATATCGCTTGACTCCGTACATAACTACGGAAGTAAGCTTAAGCTATCCAATTCAGATTCGAAAGGACAAACGTATGTCTGAACCTCAAAACGGGCGCGGCGCGCTCTTCACTGGCGGGCTGGCCGCCATCCTCGCCTCGGCTTGCTGCCTCGGGCCGCTGGTTCTGATCGCCTTGGGGTTCAGCGGCGCTTGGATCGGCAACTTGACGGTGTTGGAACCCTATCGCCCCATCTTTATCGGCGTGGCGCTGGTGGCGTTGTTCTTCGCCTGGCGGCGCATCTACCGGCCGTCAGCCGCCTGCAAACCGGGTGAGGTTTGCGCGATTCCCCAAGTGCGAGCTACTTACAAGCTCATTTTCTGGGGCGTGGCCGTGCTGGTTTTGGTCGCGCTCGGATTTCCCTACGTCGTGCCATTTTTCTATTGATCACAGGAGTTCACCATGAAAAAGCTGCTTTCCGCCCTTGCCCTCGCTGCCGTTGTTGCCCCCGTGTGGGCCGCCACCCAGACCGTTACGCTGTCCGTACCGGGCATGACCTGCTCGGCCTGTCCGATCACTGTCAAGAAGGCGATTTCCAAGGTCGATGGCGTCAGTAAAGTTGACGTGACCTTCGAGACGCGCGAAGCGGTGGTCACCTTCGATGATGCCAAGACCAGCGTGCAGAAACTGACCAAGGCTACCGAGGATGCGGGCTACCCATCATCAGTCAAGAACTGATCATGAAAGACCCGAAGACACTGCTGCGGGTCAGCATCATTGGCA	NA	NA	NA	NA
WP_000136268.1|79168_80815_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
WP_003465059.1|80831_81197_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087809.1|81193_81430_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000904941.1|81482_82097_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.3	6.6e-37
WP_013213991.1|82228_82702_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000019473.1|84334_85315_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 3
NZ_CP042513	Serratia marcescens strain E28 plasmid pE28_001, complete sequence	186249	176583	185499	186249		Macacine_betaherpesvirus(33.33%)	10	NA	NA
WP_032425559.1|176583_177555_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.4e-73
WP_032425560.1|177803_179288_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_072201151.1|179287_179539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009309980.1|179693_180119_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_004206782.1|180118_181390_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	8.6e-156
WP_004206783.1|181468_181720_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_009309981.1|181773_182079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240375.1|182104_182362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309982.1|183361_184333_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
WP_000523812.1|184332_185499_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
>prophage 1
NZ_CP042514	Serratia marcescens strain E28 plasmid pE28_002, complete sequence	87731	2110	36530	87731	protease,transposase,integrase	Escherichia_phage(37.5%)	39	1913:1972	22534:23488
1913:1972	attL	GGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATC	NA	NA	NA	NA
WP_001067834.1|2110_2815_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_014344500.1|2848_3121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|3089_4103_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015060105.1|4255_4996_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_015063357.1|5227_5560_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_003159191.1|5686_6241_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|6335_6968_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_000679427.1|7124_7472_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|7465_8305_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|8709_10251_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_003833285.1|11557_12010_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_012695489.1|12051_12696_-	quinolone resistance pentapeptide repeat protein QnrB2	NA	NA	NA	NA	NA
WP_000259031.1|13186_14026_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|13955_14135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883563.1|14153_14426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427614.1|14607_15612_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|15839_17045_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|17055_17361_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|17376_17559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|17587_18352_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|18542_18899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|18844_19429_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|19428_20667_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|20663_21569_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067834.1|21690_22395_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000557454.1|22627_23488_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
22534:23488	attR	GATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTATAGTGTTTTGCAGTTTAGAGGAGATATCGCGATGCATACGCGGAAGGCAATAACGGAGGCGCTTCAAAAACTCGGAGTCCAAACCGGTGACCTCTTGATGGTGCATGCCTCACTTAAAGCGATTGGTCCGGTCGAAGGAGGAGCGGAGACGGTCGTTGCCGCGTTACGCTCCGCGGTTGGGCCGACTGGCACTGTGATGGGATACGCGTCGTGGGACCGATCACCCTACGAGGAGACTCTGAATGGCGCTCGGCTGGATGACGAAGCCCGCCGTACCTGGCTGCCGTTCGATCCCGCAACAGCCGGGACTTACCGTGGGTTCGGCCTGCTGAATCAATTTCTGGTTCAAGCCCCCGGCGCGCGGCGCAGCGCGCACCCCGATGCATCGATGGTCGCGGTTGGTCCGCTGGCTGAAACGCTGACGGAGCCTCACGAACTCGGTCACGCCTTGGGGGAAGGATCGCCCGTCGAGCGGTTCGTTCGCCTTGGCGGGAAGGCCCTGCTGTTGGGTGCGCCGCTAAACTCCGTTACCGCATTGCACTACGCCGAGGCGGTTGCCGATATCCCCAACAAACGGTGGGTGACGTATGAGATGCCGATGCTTGGAAGAGACGGTGAAGTCGCCTGGAAAACGGCATCGGATTACGATTCAAACGGCATTCTCGATTGCTTTGCTATCGAAGGAAAGCCGGATGCGGTTGAAACTATAGCAAATGCTTACGTGAAGCTCGGTCGCCATCGAGAAGGTGTCGTGGGCTTTGCTCAGTGCTACCTGTTCGACGCGCAGGACATCGTGACGTTCGGCGTCACCTATCTTGAGAAGCATTTCGGAACCACTCCGATCGTGCCTCCGCACGAGGCCGTCGAGCGCTCTTGCGAGCCTTCAGGTTAG	NA	NA	NA	NA
WP_000587837.1|23500_24043_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|24524_24716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|24721_24967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080861.1|25017_26154_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000971921.1|26268_27639_+|transposase	IS1182-like element ISCfr1 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|28459_29320_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_011091091.1|29988_30498_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011091092.1|30545_32633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012579091.1|32645_33596_-	DsbC family protein	NA	NA	NA	NA	NA
WP_045626305.1|33606_34869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077256341.1|34913_35189_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_045626302.1|35413_35797_-	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_011091025.1|35876_36530_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
