The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042556	Acinetobacter baumannii strain E47 chromosome, complete genome	3806017	55981	98933	3806017	integrase,transposase,tRNA	uncultured_Caudovirales_phage(20.0%)	36	83949:83963	102122:102136
WP_083040832.1|55981_56914_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002122388.1|57452_58151_-	hypothetical protein	NA	A0A2H4JCF6	uncultured_Caudovirales_phage	62.2	5.1e-78
WP_083040834.1|59570_60503_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002124426.1|60837_61320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122230.1|61469_61775_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	52.5	3.4e-18
WP_106631126.1|61813_62317_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_002125681.1|64669_67951_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	74.7	0.0e+00
WP_001240034.1|68115_68631_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_151532347.1|68645_70223_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000999587.1|70391_70931_+	DUF924 domain-containing protein	NA	NA	NA	NA	NA
WP_000876371.1|70990_71554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001055481.1|71567_72878_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_000939866.1|72905_74060_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_086231339.1|74148_75534_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_002125685.1|75591_76425_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000224581.1|76621_77293_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000650776.1|77548_78259_+	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	36.2	3.0e-33
WP_000273191.1|78268_79627_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.1	2.7e-30
WP_168071628.1|79695_80838_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000011219.1|81110_81962_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000188671.1|81958_82807_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_032069403.1|82957_84172_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.3	2.2e-47
83949:83963	attL	CTTAAATATTGTAAT	NA	NA	NA	NA
WP_031978393.1|84340_84784_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000778126.1|84823_85303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000255593.1|85556_85892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206799.1|86301_87525_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_002000748.1|87584_88892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131392.1|89131_90253_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	34.9	1.9e-53
WP_001007829.1|90264_90735_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.3	5.2e-34
WP_000084188.1|90738_91188_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002057489.1|91203_92121_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_025467252.1|92098_92614_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_031978396.1|92630_93995_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.6	7.6e-33
WP_032069402.1|94007_95846_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.6	2.4e-127
WP_039908674.1|96001_96808_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_005403456.1|96791_98933_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
102122:102136	attR	ATTACAATATTTAAG	NA	NA	NA	NA
>prophage 2
NZ_CP042556	Acinetobacter baumannii strain E47 chromosome, complete genome	3806017	114649	141150	3806017	transposase	uncultured_virus(25.0%)	22	NA	NA
WP_002125688.1|114649_115483_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_000343018.1|116097_117306_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_002122473.1|118880_120527_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002122437.1|120540_122064_+	TniQ family protein	NA	NA	NA	NA	NA
WP_002122447.1|122056_123664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002122459.1|123741_124959_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_002122470.1|124933_126259_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002122461.1|126255_127536_+	DNA methylase	NA	NA	NA	NA	NA
WP_151532348.1|127532_128222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002122556.1|128244_128991_-|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	4.3e-14
WP_151532349.1|128977_129688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002122468.1|129671_130226_+	LOG family protein	NA	A0A1V0S9E9	Catovirus	24.5	2.1e-05
WP_031949839.1|130217_130430_-	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	42.4	2.3e-05
WP_087486619.1|130601_131820_+|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_002123522.1|131927_132314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002123519.1|132566_133367_-	glutamate racemase	NA	NA	NA	NA	NA
WP_000415727.1|133390_134029_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_000797592.1|134133_135960_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_010326927.1|136661_137687_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_002123875.1|137886_138597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532350.1|138603_140436_+	carbamoyltransferase	NA	E3SL71	Synechococcus_phage	26.5	2.3e-37
WP_001223318.1|140448_141150_+|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
>prophage 3
NZ_CP042556	Acinetobacter baumannii strain E47 chromosome, complete genome	3806017	202729	274437	3806017	transposase,protease,tRNA	Paenibacillus_phage(11.76%)	58	NA	NA
WP_000691199.1|202729_203692_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	34.1	2.9e-07
WP_000084727.1|203688_204993_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_001097630.1|205035_205179_-	methionine/alanine import family NSS transporter small subunit	NA	NA	NA	NA	NA
WP_000132725.1|205191_206670_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_002122556.1|207191_207938_-|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	4.3e-14
WP_001256691.1|208125_208851_+	TIGR04219 family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_000587884.1|208908_209508_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_014538288.1|215367_215853_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	37.7	3.3e-15
WP_005137722.1|216068_217139_-	alpha/beta hydrolase	NA	A0A2K9L3Q5	Tupanvirus	27.3	2.9e-11
WP_139843022.1|217349_217532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000122230.1|217509_217815_+|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	52.5	3.4e-18
WP_106631126.1|217853_218357_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000733015.1|218737_218968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002051954.1|221387_221942_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004884231.1|222094_224035_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	7.7e-148
WP_004884233.1|224364_225282_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_025469577.1|225469_226375_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_006581484.1|226475_226862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171062655.1|226910_228119_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_151532351.1|228859_229981_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000994663.1|229990_230503_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.9	1.0e-19
WP_004711246.1|230686_231049_-	DMT family protein	NA	NA	NA	NA	NA
WP_004884241.1|231290_232664_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_004884245.1|234121_234718_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_004884247.1|235035_235989_+	TerC family protein	NA	A0A1D7XFL1	Escherichia_phage	32.8	2.6e-32
WP_004884249.1|236040_236664_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_004711255.1|236800_237166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004884251.1|237187_238348_+	glutathionylspermidine synthase family protein	NA	E5E3Y5	Acinetobacter_phage	45.3	6.3e-97
WP_004884253.1|238639_239695_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004884255.1|239751_241077_+	guanine deaminase	NA	NA	NA	NA	NA
WP_002051884.1|241291_241819_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.5	4.7e-15
WP_004884259.1|241991_242243_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_004884261.1|242289_242988_-	DsbC family protein	NA	NA	NA	NA	NA
WP_171492676.1|243082_244138_-	cation transporter	NA	NA	NA	NA	NA
WP_000018128.1|244180_244444_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_002124510.1|244489_245845_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_001188089.1|245935_247696_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_000251652.1|247701_248022_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	49.4	6.3e-15
WP_001240377.1|248032_248425_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831329.1|248454_248589_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000964768.1|249259_250657_+	chromosomal replication initiator protein DnaA	NA	A0A1B1IPE6	uncultured_Mediterranean_phage	31.0	5.2e-05
WP_001237350.1|250754_251903_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	32.6	1.0e-46
WP_000550807.1|251917_253000_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000093729.1|253052_255521_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.1	7.6e-116
WP_004832699.1|255558_255951_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001009202.1|256036_256594_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_086231559.1|256844_258776_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	31.3	1.6e-65
WP_002124524.1|259028_259970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000724999.1|260042_261050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001212536.1|261391_262396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000993572.1|262520_262856_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.5	1.2e-24
WP_002124516.1|262912_263758_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001274588.1|263885_265013_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017725738.1|265074_266307_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_171492677.1|266465_266663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162540408.1|272680_273022_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000964180.1|273067_273610_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002122556.1|273690_274437_-|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	4.3e-14
>prophage 4
NZ_CP042556	Acinetobacter baumannii strain E47 chromosome, complete genome	3806017	1201354	1272810	3806017	integrase,transposase	uncultured_virus(18.18%)	56	1227689:1227704	1275115:1275130
WP_024436016.1|1201354_1202506_+|integrase	site-specific integrase	integrase	A0A2H4J339	uncultured_Caudovirales_phage	62.6	1.9e-133
WP_000240807.1|1202490_1203174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343018.1|1203351_1204560_-|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_001185269.1|1204702_1205233_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000627259.1|1205319_1205661_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_086231607.1|1205897_1207892_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000151613.1|1207905_1209165_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_002000370.1|1209262_1209667_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_000070465.1|1209768_1210557_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_002122522.1|1210805_1211387_+	nicotinamide mononucleotide transporter	NA	A0A0S1S1B4	Klebsiella_phage	29.0	9.4e-09
WP_002122554.1|1211401_1211701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051057.1|1211746_1212559_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000118514.1|1212832_1213138_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_000847097.1|1213165_1213465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991783.1|1213481_1214549_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_002122528.1|1215317_1216247_+	VOC family protein	NA	NA	NA	NA	NA
WP_002122513.1|1216276_1217488_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000064049.1|1217530_1218754_+	MFS transporter	NA	NA	NA	NA	NA
WP_000211626.1|1218777_1219299_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002061302.1|1219334_1220159_+	alpha/beta hydrolase	NA	A0A249XPN5	Mycobacterium_phage	31.7	1.4e-13
WP_000009973.1|1220174_1220969_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	8.6e-13
WP_023897190.1|1220984_1221776_+	aspartate dehydrogenase	NA	NA	NA	NA	NA
WP_001040549.1|1221789_1223256_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_038342455.1|1223294_1224935_+	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.3	3.5e-24
WP_086231611.1|1225111_1226287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002122552.1|1226349_1227648_-	MFS transporter	NA	NA	NA	NA	NA
1227689:1227704	attL	GAAAAGTGAAATAAAA	NA	NA	NA	NA
WP_000117817.1|1227882_1228365_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.4	2.9e-19
WP_000856715.1|1228543_1229866_+	glutaminase	NA	NA	NA	NA	NA
WP_001285119.1|1229832_1230621_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171059634.1|1230745_1231948_+	MFS transporter	NA	NA	NA	NA	NA
WP_000731754.1|1232015_1233161_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_001016327.1|1233352_1233799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081311117.1|1233810_1234686_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002122491.1|1234869_1235619_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_086231609.1|1235670_1236999_+	MFS transporter	NA	NA	NA	NA	NA
WP_086231612.1|1237018_1237864_+	transketolase	NA	NA	NA	NA	NA
WP_000080247.1|1237874_1238879_+	transketolase	NA	NA	NA	NA	NA
WP_000105323.1|1238959_1242646_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	60.0	3.3e-14
WP_171492684.1|1243210_1244740_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_151532385.1|1246281_1247829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854552.1|1248365_1248530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002122868.1|1248821_1249754_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	43.6	8.7e-65
WP_005403465.1|1251931_1253134_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_039908678.1|1253147_1253420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005403463.1|1253435_1255589_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_005403462.1|1255585_1258351_-	hypothetical protein	NA	Q6NE04	Leptospira_phage	34.4	2.8e-119
WP_039908676.1|1258825_1261879_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_151532386.1|1261878_1262274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001055585.1|1262356_1262740_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_004642106.1|1262736_1263072_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_151532388.1|1263146_1264730_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	53.2	4.2e-144
WP_005403459.1|1265094_1266666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005403458.1|1266665_1268183_-	TniQ family protein	NA	NA	NA	NA	NA
WP_005403457.1|1268183_1269851_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_005403456.1|1269878_1272020_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_039908674.1|1272003_1272810_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
1275115:1275130	attR	GAAAAGTGAAATAAAA	NA	NA	NA	NA
>prophage 5
NZ_CP042556	Acinetobacter baumannii strain E47 chromosome, complete genome	3806017	1513019	1555460	3806017	transposase,tRNA	Acinetobacter_phage(29.41%)	48	NA	NA
WP_001277274.1|1513019_1513340_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	62.9	5.9e-29
WP_001223318.1|1513339_1514041_-|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_000253366.1|1514587_1515181_+	LysE family transporter	NA	NA	NA	NA	NA
WP_000825869.1|1515231_1515456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998196.1|1515680_1515875_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_057692742.1|1515867_1517130_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	21.6	7.3e-14
WP_000636785.1|1517634_1517868_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001185369.1|1518018_1518690_-	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	56.6	1.1e-64
WP_017725744.1|1518925_1519123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427184.1|1519290_1519680_+	hypothetical protein	NA	A0A0P0IVR6	Acinetobacter_phage	74.4	1.1e-48
WP_002058131.1|1519717_1520263_+	N-acetylmuramidase	NA	A0A0N7IRF5	Acinetobacter_phage	72.9	2.7e-74
WP_000015971.1|1520329_1520947_-	LysE family translocator	NA	NA	NA	NA	NA
WP_000072673.1|1521466_1521682_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.0	7.7e-17
WP_000350299.1|1521885_1522110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025469473.1|1522792_1523725_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_100223092.1|1523736_1524255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001982898.1|1524411_1524531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001127325.1|1525015_1525474_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.8	3.5e-27
WP_049590653.1|1526052_1526985_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000356133.1|1527138_1527519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002125256.1|1527611_1527773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002125242.1|1527906_1528260_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001182279.1|1528562_1529984_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.8	1.1e-55
WP_001133555.1|1530197_1531175_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	9.5e-38
WP_000179337.1|1531178_1531718_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_000381220.1|1531755_1532304_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000554244.1|1532287_1532836_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_001183458.1|1532835_1533582_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
WP_168071625.1|1534108_1535332_+	TolC family protein	NA	NA	NA	NA	NA
WP_002125253.1|1535328_1537470_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.7	2.7e-29
WP_002125245.1|1537466_1538657_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_002125235.1|1538748_1539348_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.6	3.8e-21
WP_000132356.1|1539340_1539952_+	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	55.6	1.6e-11
WP_001082436.1|1540107_1540950_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	2.6e-36
WP_001186837.1|1541066_1541735_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	43.3	3.3e-26
WP_000232556.1|1541874_1542546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000144889.1|1542726_1543050_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_086231346.1|1543394_1543925_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002125252.1|1543989_1546635_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	21.5	6.0e-34
WP_002125239.1|1547497_1548358_+	EamA family transporter	NA	NA	NA	NA	NA
WP_079269831.1|1548865_1550215_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_025467284.1|1551553_1551916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157163.1|1552114_1552645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532392.1|1552672_1553446_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_171066124.1|1553480_1553639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004835456.1|1553671_1554076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004835454.1|1554087_1554498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002056344.1|1554527_1555460_-|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP042556	Acinetobacter baumannii strain E47 chromosome, complete genome	3806017	1657943	1693708	3806017	transposase	Faecalibacterium_phage(30.0%)	32	NA	NA
WP_004994718.1|1657943_1658969_-|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
WP_087486619.1|1659283_1660503_-|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_000693745.1|1660679_1662635_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	41.1	2.1e-129
WP_010326927.1|1662992_1664018_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_000498477.1|1664450_1664672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132045.1|1664756_1665074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108364.1|1665179_1665401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010326927.1|1665939_1666965_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_001145687.1|1667570_1668980_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_151532393.1|1669034_1671179_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	46.9	4.4e-136
WP_000432331.1|1671234_1672113_-	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	41.8	2.9e-54
WP_025469473.1|1672320_1673253_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002124991.1|1673260_1673716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532394.1|1674200_1675172_+	stress-induced protein	NA	NA	NA	NA	NA
WP_000795915.1|1675232_1675469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001124840.1|1675751_1676363_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.9	2.2e-48
WP_000885224.1|1676433_1677045_-	LysE family translocator	NA	NA	NA	NA	NA
WP_000376212.1|1677201_1677657_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_086231622.1|1677715_1679362_-	allantoin permease	NA	NA	NA	NA	NA
WP_031949917.1|1679527_1682992_+	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.5	1.0e-33
WP_000107134.1|1682988_1683948_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000213662.1|1683994_1685065_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002084269.1|1685110_1685587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000608481.1|1685872_1686763_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000093901.1|1686740_1687946_-	MFS transporter	NA	NA	NA	NA	NA
WP_001025680.1|1688209_1688494_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_086231621.1|1688561_1688714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002002980.1|1688802_1689438_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001130362.1|1690095_1690827_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.5	5.6e-35
WP_000476794.1|1690857_1691718_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000209982.1|1691801_1692668_+	cysteine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002056344.1|1692775_1693708_+|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP042556	Acinetobacter baumannii strain E47 chromosome, complete genome	3806017	1794385	1804177	3806017	integrase,transposase	Faecalibacterium_phage(50.0%)	8	1797862:1797876	1807696:1807710
WP_087450843.1|1794385_1795207_+|transposase	IS5-like element ISAba27 family transposase	transposase	NA	NA	NA	NA
WP_010326927.1|1795405_1796431_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_001124724.1|1797012_1797876_+	hypothetical protein	NA	NA	NA	NA	NA
1797862:1797876	attL	CAAAATTTAGCTTAA	NA	NA	NA	NA
WP_151532396.1|1798307_1799336_+|integrase	integrase	integrase	A0A0R6PHM8	Moraxella_phage	44.7	9.6e-73
WP_004994718.1|1799373_1800399_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.4	2.0e-25
WP_032014572.1|1800447_1800630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025469473.1|1800979_1801912_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_004738162.1|1802953_1804177_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.3	3.2e-43
1807696:1807710	attR	TTAAGCTAAATTTTG	NA	NA	NA	NA
>prophage 8
NZ_CP042556	Acinetobacter baumannii strain E47 chromosome, complete genome	3806017	1932745	1977601	3806017	transposase,tRNA	uncultured_virus(50.0%)	38	NA	NA
WP_000186520.1|1932745_1933210_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_038343780.1|1933583_1935368_+	siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_032038943.1|1935360_1936794_+	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_052210385.1|1936808_1938230_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004739641.1|1938513_1939446_-|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
WP_151532400.1|1941171_1943082_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_038342530.1|1943094_1943865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001071705.1|1943851_1944469_+	RraA family protein	NA	NA	NA	NA	NA
WP_038342532.1|1944554_1946873_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000018791.1|1946957_1947251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038342535.1|1947251_1948775_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_000006591.1|1948771_1949110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956973.1|1949244_1949865_+	acetyltransferase	NA	NA	NA	NA	NA
WP_079454559.1|1950241_1952344_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_086231347.1|1952448_1953075_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_023896799.1|1953062_1953581_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_086231349.1|1953582_1954638_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_086231350.1|1954630_1955230_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_086231351.1|1955354_1956923_+	histidine-type phosphatase	NA	A0A218MNG5	uncultured_virus	67.6	1.1e-115
WP_086231353.1|1957029_1957773_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000572395.1|1957848_1958958_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	48.5	9.3e-82
WP_086231354.1|1959054_1959942_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_086231355.1|1960074_1960377_-	DUF1634 domain-containing protein	NA	NA	NA	NA	NA
WP_001988395.1|1962044_1962272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049590991.1|1962405_1964505_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_002036646.1|1964726_1965902_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_106631126.1|1967464_1967968_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_000122230.1|1968006_1968312_-|transposase	transposase	transposase	A0A218MNC9	uncultured_virus	52.5	3.4e-18
WP_086231358.1|1969132_1970251_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002000245.1|1970300_1971194_-	DUF2797 domain-containing protein	NA	NA	NA	NA	NA
WP_000840537.1|1971209_1971671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183448.1|1971770_1972361_+	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_000734917.1|1972468_1973575_-	porin	NA	NA	NA	NA	NA
WP_151532401.1|1973829_1974243_-	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_001037927.1|1974261_1974531_-	YARHG domain-containing protein	NA	NA	NA	NA	NA
WP_100243228.1|1974772_1975594_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_004738730.1|1975733_1976666_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_002122556.1|1976854_1977601_-|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	4.3e-14
>prophage 9
NZ_CP042556	Acinetobacter baumannii strain E47 chromosome, complete genome	3806017	1997868	2061243	3806017	transposase	Escherichia_phage(28.57%)	55	NA	NA
WP_100243228.1|1997868_1998691_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000364554.1|1998789_1999776_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_086231510.1|2000140_2001103_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_086231511.1|2001116_2002136_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_151532402.1|2002137_2003673_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_024436039.1|2003683_2005087_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_024436038.1|2005113_2005899_+	acetoin reductase	NA	NA	NA	NA	NA
WP_024436037.1|2005928_2006987_+	2,3-butanediol dehydrogenase	NA	NA	NA	NA	NA
WP_000636998.1|2007038_2007950_-	bestrophin	NA	NA	NA	NA	NA
WP_001096435.1|2008019_2009291_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_000465442.1|2009482_2010178_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_002057533.1|2010187_2011843_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_024436036.1|2011959_2012751_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_024436035.1|2012860_2013865_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_001023745.1|2013897_2014815_-	EamA family transporter	NA	NA	NA	NA	NA
WP_000331398.1|2014981_2015836_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_079265539.1|2015832_2016228_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000771649.1|2016323_2016932_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024436034.1|2017022_2018372_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	66.7	1.2e-30
WP_000080812.1|2018613_2019357_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000448781.1|2019385_2021119_+	fumarate reductase/succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_000864074.1|2021139_2021385_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_001230713.1|2021404_2022835_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_087486619.1|2023094_2024314_-|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_000117516.1|2025037_2025877_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	9.0e-37
WP_000011848.1|2025873_2026872_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001167094.1|2026855_2027137_+	DUF971 domain-containing protein	NA	NA	NA	NA	NA
WP_000222734.1|2027176_2028463_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.6	3.6e-37
WP_031977804.1|2028981_2031189_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000980440.1|2031247_2032666_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_010326927.1|2033140_2034166_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_171492679.1|2034193_2034355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000668585.1|2034446_2034668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047847.1|2035447_2036344_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001983834.1|2036581_2037478_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095309.1|2037538_2038711_-	thiolase family protein	NA	NA	NA	NA	NA
WP_002057530.1|2038776_2040186_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_000312583.1|2040302_2040944_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_001045564.1|2040945_2041650_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_000172956.1|2041895_2042777_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002064905.1|2042924_2043170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532403.1|2043511_2044318_+	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_087486619.1|2044354_2045574_-|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_000157577.1|2045853_2046255_-	DoxX family protein	NA	NA	NA	NA	NA
WP_000622631.1|2046364_2046979_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000739326.1|2047080_2047497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100243228.1|2047777_2048599_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000163844.1|2050303_2051089_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_001987950.1|2051411_2052398_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000848245.1|2052465_2053809_-	MFS transporter	NA	NA	NA	NA	NA
WP_000918632.1|2054140_2055391_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_001017886.1|2055403_2056189_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.1	3.0e-10
WP_000379657.1|2057499_2058030_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_001070639.1|2059090_2060149_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_025469473.1|2060310_2061243_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP042556	Acinetobacter baumannii strain E47 chromosome, complete genome	3806017	2084215	2150895	3806017	integrase,transposase	Bacillus_phage(15.38%)	58	2107904:2107963	2146515:2146623
WP_004739252.1|2084215_2085148_+|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
WP_000060708.1|2086255_2087314_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086231335.1|2087327_2088038_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_000279315.1|2088070_2089264_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002122576.1|2089274_2090849_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000155281.1|2090854_2092006_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000096369.1|2092002_2092851_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000024066.1|2092853_2094671_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	4.2e-23
WP_000997920.1|2094697_2095963_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_087486619.1|2096366_2097586_-|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_171250815.1|2097554_2098652_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002126602.1|2098935_2100747_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	6.1e-38
WP_001098213.1|2100743_2102576_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	2.9e-48
WP_002126609.1|2102652_2102775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000557769.1|2102742_2105235_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	36.5	4.9e-14
WP_086231556.1|2105323_2106535_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
2107904:2107963	attL	GGCTTTGTTGCACAAAGATTTAAAAGTTAAGACTTCTCATATCTACTCAAATTTAAGTGA	NA	NA	NA	NA
WP_002056344.1|2107955_2108888_-|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
WP_000985610.1|2109115_2109397_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.3	5.7e-12
WP_079283165.1|2109397_2109595_-	addiction module killer protein	NA	A0A141GEX6	Brucella_phage	53.1	5.4e-09
WP_001133624.1|2111587_2111863_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_038343718.1|2111884_2112997_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	30.1	5.6e-34
WP_004740248.1|2113227_2114058_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004740247.1|2114298_2114601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004740246.1|2115203_2116361_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000697980.1|2116446_2117124_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_086231342.1|2117322_2118450_+	alkene reductase	NA	NA	NA	NA	NA
WP_001087973.1|2118533_2118764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000804053.1|2118868_2119477_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859511.1|2119618_2120638_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000593330.1|2120654_2121293_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_000684952.1|2121703_2122135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000059635.1|2122434_2123634_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	37.8	6.8e-62
WP_000937271.1|2124171_2124423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000627021.1|2124617_2124839_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000736237.1|2125236_2125638_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000345759.1|2125631_2126543_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000090746.1|2126736_2127729_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000459701.1|2127826_2128798_+	LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_001088578.1|2128806_2129727_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000745939.1|2129930_2130944_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_001052527.1|2131005_2131881_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_001057459.1|2131929_2132808_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004704227.1|2132917_2133850_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000350434.1|2134782_2135352_+	Hsp20/alpha crystallin family protein	NA	A0A1D7SX46	Cyanophage	27.9	3.6e-05
WP_004834873.1|2135445_2138295_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.1	1.8e-129
WP_019485624.1|2138835_2139294_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_057692822.1|2139316_2140231_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_057050246.1|2140333_2141221_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_024435849.1|2141310_2141922_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_086231542.1|2142001_2143147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057050245.1|2143136_2143577_+	heat resistance system thioredoxin Trx-GI	NA	V5L6J2	Insectomime_virus	32.4	3.4e-11
WP_032006326.1|2143580_2145287_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_004834862.1|2145213_2145975_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_000094891.1|2146208_2146445_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002084120.1|2147103_2147352_+	diguanylate cyclase	NA	NA	NA	NA	NA
2146515:2146623	attR	GGCTTTGTTGCACAAAGATTTAAAAGTTAAGACTTCTCATATCTACTCAAATTTAAGTGACAACTCGGGTATGTGGTCTGCCTAAGTCCGTAAATTTATTTAATACTGC	NA	NA	NA	NA
WP_079265543.1|2147363_2148110_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_000221973.1|2148229_2149381_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	3.7e-25
WP_004739252.1|2149962_2150895_-|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP042556	Acinetobacter baumannii strain E47 chromosome, complete genome	3806017	2251634	2302115	3806017	transposase,protease	Paenibacillus_phage(20.0%)	50	NA	NA
WP_002122556.1|2251634_2252381_+|transposase	IS5-like element ISAba31 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.9	4.3e-14
WP_000904308.1|2252433_2252796_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	62.6	1.3e-27
WP_000952702.1|2252799_2255076_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.3	4.0e-164
WP_001260033.1|2255085_2255499_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.0	2.9e-12
WP_085940527.1|2255508_2256267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000558172.1|2256342_2257398_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_046127839.1|2257580_2259101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000110123.1|2259097_2259778_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_049590959.1|2259777_2260449_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_171059647.1|2260550_2262098_+	threonine ammonia-lyase, biosynthetic	NA	NA	NA	NA	NA
WP_001983728.1|2262242_2262893_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_049590958.1|2262911_2264249_+	potassium transporter TrkH	NA	NA	NA	NA	NA
WP_057069749.1|2264289_2265441_-	phospholipase A	NA	NA	NA	NA	NA
WP_086231345.1|2265461_2268416_-	insulinase family protein	NA	NA	NA	NA	NA
WP_002059049.1|2268652_2270755_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_024435748.1|2270991_2271996_+	adenosine kinase	NA	NA	NA	NA	NA
WP_000134203.1|2272012_2272321_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_024435749.1|2272346_2272955_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_004738730.1|2273079_2274012_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000053889.1|2274386_2274581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000622644.1|2274580_2276167_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_024435773.1|2276163_2277309_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270276.1|2277322_2277424_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_085916945.1|2277424_2277724_+	cyd operon YbgE family protein	NA	NA	NA	NA	NA
WP_002057846.1|2277736_2278261_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002057844.1|2278333_2279005_-	DUF2057 domain-containing protein	NA	NA	NA	NA	NA
WP_000102943.1|2279230_2279827_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_001187342.1|2280014_2281121_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_000955082.1|2281228_2281555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050575297.1|2281655_2281961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000616034.1|2282233_2282467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171069833.1|2282944_2283277_+	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_000156920.1|2283417_2283849_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_024435734.1|2283900_2285109_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000138830.1|2285336_2285678_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_000121846.1|2285724_2286048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000954523.1|2286291_2287194_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001202776.1|2287245_2288040_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_001186684.1|2288392_2289694_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_000838063.1|2289885_2290305_+	heme-binding protein	NA	NA	NA	NA	NA
WP_000949688.1|2290563_2290809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365970.1|2290842_2291298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361722.1|2291435_2292296_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000880352.1|2292520_2295379_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	32.8	1.0e-15
WP_001062804.1|2295393_2296341_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_001192467.1|2296327_2298046_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000163427.1|2298710_2299175_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001129188.1|2299365_2299581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016653396.1|2299639_2300509_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_004738730.1|2301182_2302115_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP042556	Acinetobacter baumannii strain E47 chromosome, complete genome	3806017	2394881	2432388	3806017	transposase	Hokovirus(33.33%)	37	NA	NA
WP_049590948.1|2394881_2395814_-|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
WP_000774578.1|2396068_2396296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001109442.1|2396584_2397028_+	universal stress protein	NA	NA	NA	NA	NA
WP_000193597.1|2397287_2398871_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SGN0	Hokovirus	26.7	9.1e-22
WP_000720305.1|2398939_2399371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000161254.1|2399793_2399925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032013904.1|2400104_2401217_-	OmpW family protein	NA	NA	NA	NA	NA
WP_001189909.1|2401522_2403679_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_001019951.1|2403871_2404378_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000825559.1|2404410_2404794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004834557.1|2404860_2405793_-|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
WP_087090718.1|2405883_2407102_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.9	3.4e-77
WP_000650377.1|2407328_2407610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171066120.1|2407798_2407942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004739252.1|2407981_2408914_-|transposase	IS5-like element ISAba13 family transposase	transposase	NA	NA	NA	NA
WP_000262548.1|2409210_2409708_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002124454.1|2409736_2410294_-	chorismate mutase	NA	NA	NA	NA	NA
WP_000920707.1|2410371_2411055_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000135428.1|2411064_2411826_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001279987.1|2411833_2412520_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_001017216.1|2412709_2415316_-	aminopeptidase N	NA	NA	NA	NA	NA
WP_000420541.1|2415634_2415892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162622129.1|2416109_2417201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000204854.1|2417234_2418062_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000312221.1|2418090_2418942_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_086231500.1|2419023_2419389_-	5-carboxymethyl-2-hydroxymuconate Delta-isomerase	NA	NA	NA	NA	NA
WP_000808300.1|2419426_2421139_-	AAA family ATPase	NA	A0A172Q090	Acinetobacter_phage	40.0	2.2e-77
WP_000874704.1|2421369_2422542_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_031987507.1|2422737_2423706_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_108564095.1|2423702_2424893_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001269055.1|2425036_2426548_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_108564096.1|2426769_2428206_+	ethanolamine permease	NA	NA	NA	NA	NA
WP_108564097.1|2428222_2429608_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_032038679.1|2429618_2430434_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_046127668.1|2430598_2431321_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000543647.1|2431553_2431892_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000669095.1|2431983_2432388_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP042556	Acinetobacter baumannii strain E47 chromosome, complete genome	3806017	2688459	2703257	3806017		Acinetobacter_phage(100.0%)	10	NA	NA
WP_002126589.1|2688459_2689035_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	99.5	4.6e-109
WP_086231590.1|2689131_2691903_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	98.4	0.0e+00
WP_038343171.1|2691910_2694643_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	97.8	0.0e+00
WP_001982145.1|2694999_2696049_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000608303.1|2696058_2696865_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	99.3	1.1e-145
WP_000066123.1|2696874_2697570_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	99.6	2.2e-121
WP_001164233.1|2697580_2698564_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	96.0	2.9e-183
WP_001076825.1|2698570_2700946_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	98.0	0.0e+00
WP_000893688.1|2700947_2702447_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	96.4	8.8e-277
WP_002118643.1|2702708_2703257_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	99.5	6.6e-97
>prophage 14
NZ_CP042556	Acinetobacter baumannii strain E47 chromosome, complete genome	3806017	2871595	2896527	3806017	capsid,terminase	Acinetobacter_phage(75.0%)	41	NA	NA
WP_000039810.1|2871595_2872570_-	DUF2184 domain-containing protein	NA	M4SQD1	Psychrobacter_phage	36.6	4.4e-51
WP_004834303.1|2872575_2873046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532421.1|2873059_2874259_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	34.3	1.5e-24
WP_004888043.1|2874319_2874934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532422.1|2874991_2875801_-|capsid	minor capsid protein	capsid	M4T3R2	Psychrobacter_phage	40.7	1.4e-50
WP_151532423.1|2875745_2877080_-	DUF1073 domain-containing protein	NA	M4SN90	Psychrobacter_phage	38.6	2.9e-85
WP_031978642.1|2877088_2878615_-|terminase	phage terminase large subunit	terminase	E5AGA3	Erwinia_phage	40.5	2.8e-92
WP_000729394.1|2878592_2879069_-	DUF2280 domain-containing protein	NA	A0A0P0HSK4	Acinetobacter_phage	53.6	4.5e-33
WP_002123467.1|2879127_2879769_-	hypothetical protein	NA	A0A0P0I8J9	Acinetobacter_phage	87.8	4.5e-113
WP_002123468.1|2879737_2880205_-	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	79.4	1.5e-65
WP_002123469.1|2880265_2880721_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	94.7	3.0e-79
WP_000152665.1|2881366_2881603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046882649.1|2881811_2882156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001017703.1|2882422_2882641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000959660.1|2882784_2883537_-	hypothetical protein	NA	A0A0P0J081	Acinetobacter_phage	95.6	4.6e-133
WP_002120863.1|2883547_2883949_-	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	96.2	1.8e-67
WP_000378368.1|2883948_2884272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039748.1|2884261_2884441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004834288.1|2884433_2884712_-	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	46.5	2.2e-11
WP_119491801.1|2884704_2885031_-	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	57.4	6.8e-33
WP_119491799.1|2885027_2885777_-	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	96.0	1.6e-133
WP_052782576.1|2885769_2886720_-	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	63.3	9.4e-99
WP_119491797.1|2886716_2887763_-	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	58.2	2.9e-109
WP_151532424.1|2887759_2888719_-	helix-turn-helix domain-containing protein	NA	A0A0P0HSN8	Acinetobacter_phage	54.4	4.4e-19
WP_000102848.1|2888715_2889009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041172366.1|2889005_2889278_-	hypothetical protein	NA	A0A0D4DCC3	Acinetobacter_phage	98.9	2.2e-40
WP_041172365.1|2889325_2889592_-	hypothetical protein	NA	A0A0D4DBY7	Acinetobacter_phage	98.9	3.5e-43
WP_041172364.1|2889608_2889800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041172363.1|2889915_2890665_+	hypothetical protein	NA	A0A0D4DBI5	Acinetobacter_phage	75.6	1.2e-88
WP_041172362.1|2890704_2891004_+	hypothetical protein	NA	A0A0D4DCL0	Acinetobacter_phage	92.9	6.7e-43
WP_041172361.1|2891043_2891337_+	hypothetical protein	NA	A0A0D4DCB9	Acinetobacter_phage	82.5	1.2e-39
WP_041172360.1|2891396_2891612_+	KTSC domain-containing protein	NA	A0A0D4DBY2	Acinetobacter_phage	98.6	6.5e-32
WP_000276791.1|2891662_2891953_+	hypothetical protein	NA	A0A0D4DBS2	Acinetobacter_phage	100.0	1.5e-44
WP_151532425.1|2892449_2892890_+	hypothetical protein	NA	A0A0D4DBH9	Acinetobacter_phage	95.9	1.8e-73
WP_032014298.1|2892889_2893180_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	97.9	6.0e-49
WP_151532426.1|2893172_2893496_+	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	91.6	7.2e-51
WP_001207471.1|2893507_2894629_+	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	100.0	5.2e-213
WP_151532427.1|2894625_2895585_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	85.3	2.8e-151
WP_000654850.1|2895586_2895838_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	98.7	3.2e-38
WP_004834275.1|2895838_2896228_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	53.0	5.7e-10
WP_000783308.1|2896224_2896527_+	hypothetical protein	NA	A0A2I7QNA8	Vibrio_phage	35.7	7.8e-07
>prophage 15
NZ_CP042556	Acinetobacter baumannii strain E47 chromosome, complete genome	3806017	2960103	2968676	3806017	transposase	Bacillus_phage(16.67%)	11	NA	NA
WP_000157724.1|2960103_2960814_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.7	5.7e-40
WP_079261103.1|2960842_2961526_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	38.8	2.3e-30
WP_000771345.1|2961539_2961956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001153968.1|2962046_2962733_+	diphthine--ammonia ligase	NA	NA	NA	NA	NA
WP_001293529.1|2962750_2963212_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_000343018.1|2963331_2964540_+|transposase	IS256-like element ISAba26 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	3.1e-46
WP_001050708.1|2964660_2965230_+	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_001991184.1|2965300_2965891_-	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	A0A292GDD2	Xanthomonas_phage	36.3	1.3e-21
WP_057050489.1|2966000_2966801_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_002125393.1|2966797_2967115_-	hypothetical protein	NA	A0A1E1EXH0	Acanthamoeba_castellanii_mimivirus	30.4	4.9e-12
WP_168071627.1|2967509_2968676_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	28.8	2.4e-27
>prophage 16
NZ_CP042556	Acinetobacter baumannii strain E47 chromosome, complete genome	3806017	3354347	3430583	3806017	transposase,portal,capsid,head,tail,terminase,tRNA,integrase,plate,holin	uncultured_Caudovirales_phage(25.0%)	84	3374143:3374159	3412045:3412061
WP_000986448.1|3354347_3356126_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	21.9	8.1e-19
WP_001251493.1|3356267_3356486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002059998.1|3356528_3357578_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_001032032.1|3357663_3358596_+	glycosyl transferase family 8	NA	NA	NA	NA	NA
WP_010326927.1|3359288_3360314_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_100243228.1|3361097_3361919_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_100243228.1|3362214_3363036_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000734175.1|3363697_3364765_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_031978756.1|3364761_3365790_-	mitochondrial fission ELM1 family protein	NA	NA	NA	NA	NA
WP_000546718.1|3365782_3366778_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_031978620.1|3366790_3367600_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000548425.1|3367613_3368501_-	mitochondrial fission ELM1 family protein	NA	NA	NA	NA	NA
WP_001046506.1|3368568_3369495_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_000990825.1|3369519_3372270_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_000194118.1|3372338_3373607_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
3374143:3374159	attL	TGGTCCCGAGGGTCGGA	NA	NA	NA	NA
WP_000187872.1|3374882_3375092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992380.1|3375093_3375894_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	52.3	6.4e-24
WP_024436829.1|3376385_3377264_+	DUF4747 family protein	NA	NA	NA	NA	NA
WP_024436830.1|3377271_3377961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532438.1|3378036_3378432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114203521.1|3378507_3379212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114203519.1|3379222_3379684_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_171293097.1|3379686_3379851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123785441.1|3380121_3381108_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	55.5	3.2e-102
WP_002056049.1|3381108_3382893_-|terminase	terminase ATPase subunit gpP-like protein	terminase	Q9ZXM5	Pseudomonas_virus	59.8	4.5e-203
WP_024436834.1|3383050_3383854_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	44.2	2.3e-53
WP_032035661.1|3383869_3384859_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	52.2	2.9e-90
WP_114203513.1|3384869_3385631_+|terminase	terminase	terminase	K4NX86	Burkholderia_phage	38.6	1.2e-32
WP_038347293.1|3385733_3386186_+|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	45.8	2.1e-24
WP_114203510.1|3386186_3386396_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	61.2	5.2e-18
WP_001114936.1|3386404_3386755_+	membrane protein	NA	NA	NA	NA	NA
WP_114203509.1|3386751_3387021_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	39.7	5.9e-06
WP_114203507.1|3387017_3387848_+	DUF3380 domain-containing protein	NA	A4JWU0	Burkholderia_virus	41.4	2.3e-45
WP_151532439.1|3387844_3388372_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	49.4	2.2e-36
WP_151532440.1|3388368_3388818_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	48.2	3.1e-28
WP_151532441.1|3388890_3389517_+|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	42.7	2.3e-21
WP_032014595.1|3389513_3389861_+	GPW/gp25 family protein	NA	Q9ZXK9	Pseudomonas_virus	55.8	1.1e-23
WP_151532442.1|3389857_3390760_+|plate	baseplate J/gp47 family protein	plate	A0A0F7LCJ3	Escherichia_phage	48.5	2.7e-71
WP_151532443.1|3390759_3391365_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	38.2	3.2e-28
WP_151532444.1|3393946_3395122_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q9ZXK4	Pseudomonas_virus	68.3	2.9e-150
WP_031987639.1|3395134_3395653_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	59.1	5.5e-53
WP_001071617.1|3395720_3396062_+|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	50.0	1.1e-17
WP_126562512.1|3396064_3396202_+|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	57.9	3.5e-07
WP_151532445.1|3396215_3398666_+|tail	phage tail tape measure protein	tail	A0A193GYN8	Enterobacter_phage	44.2	3.9e-104
WP_057069934.1|3398672_3399113_+|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	54.8	1.7e-39
WP_151532446.1|3399113_3400427_+	DNA primase	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	42.7	4.6e-96
WP_000113725.1|3400556_3400796_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_002056021.1|3400792_3400993_+	TraR/DksA C4-type zinc finger protein	NA	G3EN77	Psychrobacter_phage	42.2	8.2e-05
WP_002056046.1|3401308_3401590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532447.1|3401589_3402468_-	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
WP_002056034.1|3402779_3402974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002056074.1|3403081_3403906_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	68.1	1.9e-26
WP_000556352.1|3404030_3404246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786718.1|3404290_3404632_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001043170.1|3404724_3404913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002056063.1|3405006_3407745_+	toprim domain-containing protein	NA	A0A2H4JDT6	uncultured_Caudovirales_phage	62.2	0.0e+00
WP_151532448.1|3407741_3408074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002056024.1|3408139_3408691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001015076.1|3408680_3408851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049658.1|3408843_3409161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532449.1|3409148_3409502_+	single-stranded DNA-binding protein	NA	M4SRQ0	Psychrobacter_phage	61.8	9.7e-33
WP_151532450.1|3409511_3410249_+	3'-5' exonuclease	NA	A0A0A1IWL5	Pseudomonas_phage	31.7	1.6e-21
WP_171492683.1|3410257_3410479_+	hypothetical protein	NA	A0A2H4J8L3	uncultured_Caudovirales_phage	35.7	7.4e-07
WP_000218943.1|3410475_3410772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532452.1|3410799_3411867_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A0YR56	Pseudomonas_phage	37.3	1.7e-43
WP_001177138.1|3412313_3413351_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
3412045:3412061	attR	TGGTCCCGAGGGTCGGA	NA	NA	NA	NA
WP_151532453.1|3413436_3414342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087486619.1|3414310_3415529_+|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_025469473.1|3415658_3416591_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153309834.1|3416630_3416798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121115.1|3416890_3417919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000147157.1|3418005_3418575_+	LemA family protein	NA	NA	NA	NA	NA
WP_000667231.1|3418750_3419884_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.5	1.3e-94
WP_000051669.1|3419982_3420312_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_151532454.1|3420363_3422265_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_001984787.1|3422273_3423239_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	33.1	1.7e-31
WP_000006956.1|3423302_3424556_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.0	2.9e-39
WP_085920667.1|3424656_3425376_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000637021.1|3425437_3426349_+	bestrophin	NA	NA	NA	NA	NA
WP_001161530.1|3426356_3427208_-	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_000645707.1|3427252_3427867_+	septation protein IspZ	NA	NA	NA	NA	NA
WP_001115789.1|3427901_3428204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001175201.1|3428208_3428688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002122744.1|3428711_3430583_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP042557	Acinetobacter baumannii strain E47 plasmid pE47_001, complete sequence	327867	0	48737	327867	transposase,integrase	Burkholderia_virus(21.43%)	43	21051:21069	48860:48878
WP_043041640.1|520_1087_+	recombinase family protein	NA	Q2A092	Sodalis_phage	37.8	5.3e-25
WP_043041639.1|1307_2381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004647749.1|2824_3121_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	38.8	1.2e-15
WP_004969304.1|3122_3413_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	48.9	4.4e-15
WP_008942541.1|3513_4839_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_026438532.1|5015_6470_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	71.4	2.9e-184
WP_004976362.1|6719_6929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063864543.1|7644_8487_+	OXA-58 family carbapenem-hydrolyzing class D beta-lactamase OXA-96	NA	NA	NA	NA	NA
WP_000073658.1|9457_10285_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000447788.1|10334_10940_+	LysE family translocator	NA	NA	NA	NA	NA
WP_010326716.1|11059_12394_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_008942539.1|12655_12943_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_151532470.1|12929_13244_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_000172759.1|13332_13863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000286964.1|14011_14314_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.0	9.5e-21
WP_000985609.1|14314_14596_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	43.3	5.7e-12
WP_151532471.1|15088_16564_+	Msr family ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	59.2	7.9e-161
WP_000155092.1|16619_17504_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_008942541.1|17756_19082_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_015060246.1|19181_19793_-	recombinase family protein	NA	NA	NA	NA	NA
WP_033917576.1|20048_21011_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.5	9.1e-33
21051:21069	attL	TATTTTTCTTTCTTGAACT	NA	NA	NA	NA
WP_033917517.1|22349_23081_-	efflux system response regulator transcription factor AdeR	NA	NA	NA	NA	NA
WP_033917516.1|23219_24407_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_033917518.1|24406_27517_+	AdeB/AdeJ family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.4	9.4e-63
WP_033917515.1|27596_28994_+	AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor	NA	NA	NA	NA	NA
WP_033917554.1|29222_30737_+	MFS transporter	NA	NA	NA	NA	NA
WP_001067784.1|31170_31875_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_080752676.1|31970_32762_+	YHS domain-containing protein	NA	NA	NA	NA	NA
WP_033917437.1|32851_33202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532472.1|33213_34275_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_033917435.1|34286_34595_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_033917434.1|34609_35530_+	catechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_033917433.1|35567_36395_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_033917432.1|36462_37344_+	transporter	NA	NA	NA	NA	NA
WP_033917431.1|37364_38159_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_033917430.1|38171_39125_+	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	35.1	9.6e-35
WP_033917429.1|39136_40177_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	33.5	1.2e-46
WP_033917428.1|40340_41195_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_042892674.1|41337_43044_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_033917441.1|43388_43829_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_047472181.1|44410_45343_+|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.9	5.3e-62
WP_047472183.1|46139_47486_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_100607972.1|47608_48737_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	31.7	1.6e-20
48860:48878	attR	AGTTCAAGAAAGAAAAATA	NA	NA	NA	NA
>prophage 2
NZ_CP042557	Acinetobacter baumannii strain E47 plasmid pE47_001, complete sequence	327867	71561	132565	327867	transposase,integrase	Moraxella_phage(18.18%)	53	67635:67650	89924:89939
67635:67650	attL	TCAAGATCGAAGGCTG	NA	NA	NA	NA
WP_021263840.1|71561_72137_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	55.9	8.1e-45
WP_017781033.1|72117_73779_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017781032.1|73768_74740_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_017781030.1|75398_77021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017781029.1|77013_78516_-	TniQ family protein	NA	NA	NA	NA	NA
WP_047472096.1|78517_80128_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017781027.1|80120_82181_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017781026.1|82194_83022_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_024160906.1|83859_84501_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_043041555.1|84539_85073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532474.1|85114_85866_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.7	1.3e-15
WP_043041554.1|86107_86536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005006261.1|86611_86857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005006227.1|87294_87672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043041553.1|87747_88680_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A166YH27	Gordonia_phage	31.9	2.8e-15
WP_046127922.1|88706_89279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020753573.1|89370_90576_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	58.6	4.2e-112
89924:89939	attR	TCAAGATCGAAGGCTG	NA	NA	NA	NA
WP_020753574.1|90568_91834_-	CmlA/FloR family chloramphenicol efflux MFS transporter	NA	S4TR35	Salmonella_phage	29.0	3.2e-25
WP_121532429.1|92060_92906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106439096.1|95053_96091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146878956.1|96203_97040_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_044103337.1|97042_97426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044103340.1|97807_98497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146878958.1|98715_99234_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_042892477.1|99345_99807_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_024160894.1|100049_100379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160893.1|100580_102389_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_024160719.1|102468_102702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024160720.1|102897_103908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024160892.1|103924_106588_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	32.3	1.7e-65
WP_151532475.1|106943_107486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005028481.1|107687_107918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532476.1|108582_109782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005006163.1|109850_110759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532477.1|110775_112455_+	virulence-associated e family protein	NA	A0A0R6PCD2	Moraxella_phage	26.2	6.3e-13
WP_044112290.1|112599_113262_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_005028493.1|113559_116403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160886.1|116455_119143_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_024160885.1|119158_120694_-	site-specific DNA-methyltransferase	NA	A0A0M7Q8J6	Escherichia_phage	36.7	4.1e-59
WP_024160884.1|120866_121175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005006141.1|121180_121687_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	41.4	6.2e-25
WP_024160883.1|121772_122627_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_024160730.1|122628_123435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024160731.1|123494_123917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031944358.1|123967_124537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160882.1|124571_125312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160881.1|125429_126176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160880.1|126244_127036_-	TraX family protein	NA	NA	NA	NA	NA
WP_024160879.1|127011_127662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024160878.1|127818_128703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004907341.1|128857_129976_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_033917385.1|130529_132197_-	DEAD/DEAH box helicase	NA	A0A0U1UNQ7	Pseudomonas_phage	48.4	3.2e-158
WP_005006108.1|132196_132565_-	hypothetical protein	NA	A0A0A7HAZ6	Arthrobacter_phage	36.1	3.6e-06
>prophage 3
NZ_CP042557	Acinetobacter baumannii strain E47 plasmid pE47_001, complete sequence	327867	136475	136820	327867		Pectobacterium_phage(100.0%)	1	NA	NA
WP_024160742.1|136475_136820_+	hypothetical protein	NA	A0A1L2CU84	Pectobacterium_phage	51.3	1.3e-05
>prophage 4
NZ_CP042557	Acinetobacter baumannii strain E47 plasmid pE47_001, complete sequence	327867	144725	186583	327867	transposase	uncultured_virus(23.08%)	49	NA	NA
WP_042849130.1|144725_147710_-|transposase	Tn3 family transposase	transposase	A0A125RQ78	Bacillus_phage	22.7	4.4e-33
WP_019838172.1|147875_148802_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_047471685.1|148808_149345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047471692.1|149393_150878_-	amidase	NA	NA	NA	NA	NA
WP_019838168.1|151144_151339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026438239.1|151583_152324_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_052207650.1|152401_153088_+	DMT family transporter	NA	NA	NA	NA	NA
WP_024160755.1|153268_153799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047471695.1|154051_154894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005006055.1|154906_155221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005006052.1|155293_155770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033917491.1|156379_157477_+	phosphohydrolase	NA	H7BVI4	unidentified_phage	28.5	4.2e-42
WP_024160759.1|157634_157973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160760.1|158042_158540_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_038350030.1|158690_159125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031944366.1|159198_159687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038350029.1|159887_160418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047471704.1|160637_161279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047471707.1|161291_162125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047471710.1|162156_162765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004812228.1|162825_163758_-|transposase	IS5-like element ISAha3 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	42.3	2.4e-62
WP_047471716.1|164121_165270_+	hypothetical protein	NA	I6XKU1	Burkholderia_virus	27.0	4.0e-27
WP_024160768.1|165647_166073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160933.1|167382_167844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160932.1|167895_168144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024432368.1|168278_169568_-	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	45.9	5.3e-113
WP_171069832.1|169564_170080_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	46.0	1.2e-31
WP_005006018.1|170275_171655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024160928.1|171923_172841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223318.1|172871_173573_-|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_005006017.1|173712_175038_-	DNA cytosine methyltransferase	NA	A0A1L5C2B8	Pseudoalteromonas_phage	42.7	7.4e-110
WP_005006014.1|175103_176162_-	DNA cytosine methyltransferase	NA	D5LH17	Escherichia_phage	35.5	2.9e-16
WP_046127874.1|176270_177047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005028583.1|177214_177580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005028585.1|177836_178181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046127875.1|178193_178373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151532479.1|178420_179639_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.9	2.9e-76
WP_046128034.1|179760_180060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046128035.1|180090_180519_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000618090.1|180515_180851_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_001094416.1|180925_182572_+|transposase	IS66-like element ISAba17 family transposase	transposase	A0A218MNE7	uncultured_virus	52.6	5.0e-140
WP_046128037.1|182595_182856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171492686.1|182890_183136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223318.1|183148_183850_+|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_151532480.1|183836_184217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046128039.1|184318_184681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151532481.1|184677_185208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024160919.1|185222_185633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005005990.1|185779_186583_+	DUF4942 domain-containing protein	NA	A0A059VA49	Pseudomonas_phage	25.8	2.3e-13
>prophage 5
NZ_CP042557	Acinetobacter baumannii strain E47 plasmid pE47_001, complete sequence	327867	191066	207364	327867	transposase,integrase	Escherichia_phage(36.36%)	18	192505:192564	201604:202920
WP_001067855.1|191066_191771_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376623.1|191900_192401_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
192505:192564	attL	TAGCGGGCGGCCGGAAGGTGAATGCTAGGCATGATCTAACCCTCGGTCTCTGGCGTCGCG	NA	NA	NA	NA
WP_000259031.1|192528_193368_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|193361_193709_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000186237.1|193865_194498_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_003159191.1|194592_195147_-	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_015063357.1|195273_195606_-	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_015060105.1|195837_196578_-	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_002075255.1|196730_197744_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_000019304.1|198346_198916_-	trimethoprim-resistant dihydrofolate reductase DfrA19	NA	A0A1V0SD48	Indivirus	27.2	3.5e-08
WP_002008781.1|198915_199416_-	hypothetical protein	NA	A0A1V0SB21	Catovirus	31.7	3.3e-10
WP_000050481.1|199681_201223_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|201627_202467_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|202460_202808_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001931474.1|203024_203891_-	PSE family carbenicillin-hydrolyzing class A beta-lactamase CARB-2	NA	A0A077SL40	Escherichia_phage	44.1	4.8e-57
201604:202920	attR	TAGCGGGCGGCCGGAAGGTGAATGCTAGGCATGATCTAACCCTCGGTCTCTGGCGTCGCGACTGCGAAATTTCGCGAGGGTTTCCGAGAAGGTGATTGCGCTTCGCAGATCTCCAGGCGCGTGGGTGCGGACGTAGTCAGCGCCATTGCCGATCGCGTGAAGTTCCGCCGCAAGGCTCGCTGGACCCAGATCCTTTACAGGAAGGCCAACGGTGGCGCCCAAGAAGGATTTCCGCGACACCGAGACCAATAGCGGAAGCCCCAACGCCGACTTCAGCTTTTGAAGGTTCGACAGCACGTGCAGCGATGTTTCCGGTGCGGGGCTCAAGAAAAATCCCATCCCCGGATCGAGGATGAGCCGGTCGGCAGCGACCCCGCTCCGTCGCAAGGCGGAAACCCGCGCCTCGAAGAACCGCACAATCTCGTCGAGCGCGTCTTCGGGTCGAAGGTGACCGGTGCGGGTGGCGATGCCATCCCGCTGCGCTGAGTGCATAACCACCAGCCTGCAGTCCGCCTCAGCAATATCGGGATAGAGCGCAGGGTCAGGAAATCCTTGGATATCGTTCAGGTAGCCCACGCCGCGCTTGAGCGCATAGCGCTGGGTTTCCGGTTGGAAGCTGTCGATTGAAACACGGTGCATCTGATCGGACAGGGCGTCTAAGAGCGGCGCAATACGTCTGATCTCATCGGCCGGCGATACAGGCCTCGCGTCCGGATGGCTGGCGGCCGGTCCGACATCCACGACGTCTGATCCGACTCGCAGCATTTCGATCGCCGCGGTGACAGCGCCGGCGGGGTCTAGCCGCCGGCTCTCATCGAAGAAGGAGTCCTCGGTGAGATTCAGAATGCCGAACACCGTCACCATGGCGTCGGCCTCCGCAGCGACTTCCACGATGGGGATCGGGCGAGCAAAAAGGCAGCAATTATGAGCCCCATACCTACAAAGCCCCACGCATCAAGCTTTTGCCCATGAAGCAACCAGGCAATGGCTGTAATTATGACGACGCCGAGTCCCGACCAGACTGCATAAGCAACACCGACAGGGATGGATTTCAGAACCAGAGAAAGAAAATAAAATGCGATGCCATAACCGATTATGACAACGGCGGAAGGGGCAAGCTTAGTAAAGCCCTCGCTAGATTTTAATGCGGATGTTGCGATTACTTCGCCAACTATTGCGATAACAAGAAAAAGCCAGCCTTTCATGATATATCTCCCAATTTGTGTAGGGCTTATTATGCACGCTTAAAAATAATAAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTAGTGCATCTAACGCC	NA	NA	NA	NA
WP_001067855.1|204946_205651_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|205780_206596_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067855.1|206659_207364_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 6
NZ_CP042557	Acinetobacter baumannii strain E47 plasmid pE47_001, complete sequence	327867	232074	235958	327867		Bacillus_phage(33.33%)	4	NA	NA
WP_024160787.1|232074_233181_+	ParM/StbA family protein	NA	A0A0E3D9I0	Bacillus_phage	23.6	3.7e-06
WP_044110986.1|233177_234005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043974992.1|234050_235112_-	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	32.0	8.5e-08
WP_005028640.1|235121_235958_-	AAA family ATPase	NA	Q8JL10	Natrialba_phage	28.4	1.2e-12
>prophage 7
NZ_CP042557	Acinetobacter baumannii strain E47 plasmid pE47_001, complete sequence	327867	241708	243265	327867		Acinetobacter_phage(100.0%)	1	NA	NA
WP_151532483.1|241708_243265_+	AAA family ATPase	NA	A0A075DXT4	Acinetobacter_phage	33.0	2.7e-58
>prophage 8
NZ_CP042557	Acinetobacter baumannii strain E47 plasmid pE47_001, complete sequence	327867	310360	312001	327867		Stx1_converting_phage(100.0%)	1	NA	NA
WP_005005743.1|310360_312001_+	hypothetical protein	NA	A0A1U9AJC4	Stx1_converting_phage	35.2	2.0e-27
