The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042481	Klebsiella pneumoniae strain C51 chromosome, complete genome	5222468	1654679	1712284	5222468	transposase,lysis,tRNA,tail,head,protease,holin,integrase,terminase	Salmonella_phage(26.67%)	78	1653201:1653216	1673727:1673742
1653201:1653216	attL	GCTGCTGCAGCTGCTG	NA	NA	NA	NA
WP_002892267.1|1654679_1655306_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004146399.1|1655273_1655960_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.6e-31
WP_032411673.1|1655956_1658371_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024143560.1|1658693_1659617_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	7.3e-173
WP_004151323.1|1660871_1661948_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_004143002.1|1662059_1663127_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_040088579.1|1663123_1663633_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_032423671.1|1663729_1664068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004893764.1|1664175_1664898_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004151319.1|1664901_1665396_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_040088581.1|1665571_1666957_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|1667002_1667215_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1667216_1668083_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_151675792.1|1668513_1669677_-|integrase	tyrosine-type recombinase/integrase	integrase	G8C7S0	Escherichia_phage	86.3	5.5e-202
WP_004151317.1|1669553_1669889_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_110246988.1|1669890_1670106_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_110246987.1|1670107_1670326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110246986.1|1670322_1671093_-	dcm methylase	NA	D5LH17	Escherichia_phage	51.4	6.1e-64
WP_151675794.1|1671089_1671617_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	60.4	5.5e-56
WP_048328006.1|1671645_1672269_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	3.1e-58
WP_023342707.1|1672265_1673012_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	67.7	7.0e-65
WP_065520813.1|1673028_1673313_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	1.4e-29
WP_151675796.1|1673320_1674292_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	77.7	2.3e-39
1673727:1673742	attR	GCTGCTGCAGCTGCTG	NA	NA	NA	NA
WP_016529274.1|1674366_1674882_-	HNH endonuclease	NA	A0A291AXF2	Shigella_phage	51.6	8.5e-38
WP_016529273.1|1674878_1675094_-	membrane carboxypeptidase (penicillin-binding protein)	NA	A0A0M4S6W3	Salmonella_phage	88.1	2.0e-28
WP_077255239.1|1675329_1675605_-	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	65.9	1.6e-27
WP_065903599.1|1676249_1676909_-	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	61.9	8.3e-70
WP_004191589.1|1677017_1677236_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
WP_043875707.1|1677275_1677497_+	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_151675798.1|1677493_1678039_+	HNH endonuclease	NA	J7HXG5	Pseudomonas_phage	41.8	7.2e-27
WP_101998675.1|1678083_1678938_+	replication protein	NA	K7PGT1	Enterobacteria_phage	54.5	2.8e-62
WP_032427729.1|1678922_1679792_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.7	3.4e-95
WP_151675800.1|1679788_1680088_+	protein ren	NA	K7P7K7	Enterobacteria_phage	50.5	1.5e-15
WP_151675802.1|1680084_1680528_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	35.8	1.8e-12
WP_151675804.1|1680524_1681067_+	hypothetical protein	NA	A0A1W6DY33	Salmonella_phage	47.5	7.1e-35
WP_151675806.1|1681063_1681459_+	hypothetical protein	NA	G8C7U4	Escherichia_phage	79.7	1.8e-56
WP_141771329.1|1681451_1681991_+	ead/Ea22-like family protein	NA	F1C5B5	Cronobacter_phage	41.3	1.8e-06
WP_102046912.1|1681990_1682506_+	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	75.8	4.2e-69
WP_151675936.1|1682751_1683447_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	49.6	3.5e-50
WP_094326532.1|1683540_1683837_+	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	43.4	2.9e-14
WP_020805077.1|1684090_1684558_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	5.7e-33
WP_151675808.1|1684538_1684709_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
WP_151675810.1|1684701_1685283_+	recombination protein NinG	NA	E7C9S3	Salmonella_phage	43.8	7.9e-40
WP_151675812.1|1685279_1685504_+	protein ninY	NA	Q76H69	Enterobacteria_phage	60.8	1.7e-22
WP_065800382.1|1685500_1685731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004884232.1|1685727_1685868_+	YlcG family protein	NA	NA	NA	NA	NA
WP_102015784.1|1685864_1686365_+	antiterminator	NA	G8C7V7	Escherichia_phage	92.1	8.7e-88
WP_012542609.1|1686819_1687089_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_151675938.1|1687066_1687564_+	glycoside hydrolase family protein	NA	K7P7Q3	Enterobacteria_phage	82.4	6.9e-77
WP_151675814.1|1687560_1688028_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	74.2	2.2e-56
WP_151675816.1|1688393_1689167_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	62.3	1.1e-12
WP_021312714.1|1689117_1690518_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	9.4e-188
WP_151675817.1|1690755_1692207_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	4.2e-191
WP_151675940.1|1692262_1692811_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	54.6	1.2e-45
WP_151675818.1|1693584_1694787_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	56.1	5.2e-110
WP_029363699.1|1694790_1695285_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.1	2.1e-49
WP_151675820.1|1695296_1696238_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	76.1	5.6e-136
WP_062920907.1|1696277_1696559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038435200.1|1696527_1696947_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	61.5	2.0e-40
WP_151675823.1|1696943_1697450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087847838.1|1697449_1697854_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	68.5	1.7e-41
WP_151675826.1|1697846_1698398_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.4	4.4e-40
WP_025269950.1|1698399_1699551_+	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	81.5	2.1e-177
WP_025269949.1|1699561_1700002_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	79.5	2.1e-61
WP_151675828.1|1700005_1700425_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	64.4	2.2e-39
WP_016244729.1|1700466_1700619_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_134909483.1|1700608_1702525_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	58.8	1.6e-201
WP_025269945.1|1702524_1703100_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	66.0	5.0e-63
WP_020804067.1|1703175_1703403_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.0	5.6e-18
WP_151675830.1|1703405_1704470_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	68.6	9.8e-137
WP_038435205.1|1704472_1704823_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	82.2	2.1e-27
WP_141770821.1|1704825_1705272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151675832.1|1705334_1705988_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	56.3	1.4e-72
WP_147032961.1|1705989_1706343_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	1.5e-49
WP_151675833.1|1706342_1707542_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.3	8.1e-156
WP_110247647.1|1707538_1708312_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	52.1	1.8e-68
WP_151675835.1|1708311_1709085_+	hypothetical protein	NA	A0A248SL44	Klebsiella_phage	42.7	4.7e-32
WP_151675943.1|1712077_1712284_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.3	3.9e-10
>prophage 2
NZ_CP042481	Klebsiella pneumoniae strain C51 chromosome, complete genome	5222468	2216681	2226155	5222468	tRNA,protease	Dickeya_phage(16.67%)	8	NA	NA
WP_040088746.1|2216681_2217797_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004147781.1|2217793_2219734_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	5.0e-38
WP_002896516.1|2219810_2220032_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|2220357_2220675_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|2220705_2222985_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|2223115_2223334_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|2223687_2224389_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_016532437.1|2224433_2226155_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 3
NZ_CP042481	Klebsiella pneumoniae strain C51 chromosome, complete genome	5222468	2610885	2652367	5222468	holin,integrase,terminase	Salmonella_phage(22.92%)	66	2605892:2605907	2623131:2623146
2605892:2605907	attL	AATCGTGCTCAACGCC	NA	NA	NA	NA
WP_004140269.1|2610885_2611695_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|2611696_2612689_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2612688_2613579_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004892753.1|2613755_2614943_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.2	4.2e-120
WP_004190725.1|2614839_2615154_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
WP_022631172.1|2615163_2615403_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	6.8e-22
WP_048270597.1|2615443_2616553_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	87.0	2.0e-185
WP_087830409.1|2616565_2619661_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.2	1.9e-294
WP_016946289.1|2619798_2619954_-	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	74.5	2.6e-14
WP_020804303.1|2619962_2620154_-	YebW family protein	NA	NA	NA	NA	NA
WP_022631176.1|2620260_2620359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023313092.1|2620450_2620759_-	hypothetical protein	NA	G8C7T6	Escherichia_phage	61.2	8.4e-25
WP_023313093.1|2620948_2621509_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	38.3	2.0e-08
WP_023313094.1|2621649_2621880_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	63.5	4.7e-20
WP_135713272.1|2621882_2622419_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	69.8	2.0e-61
WP_135713273.1|2622506_2622695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135713274.1|2622709_2623618_+	DNA-binding protein	NA	V5URT9	Shigella_phage	49.2	6.5e-89
2623131:2623146	attR	AATCGTGCTCAACGCC	NA	NA	NA	NA
WP_135713275.1|2623620_2624370_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	83.5	5.8e-120
WP_135713276.1|2624377_2624713_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.6	2.6e-11
WP_135713277.1|2624705_2625491_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	7.3e-65
WP_000158002.1|2625487_2625691_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	1.5e-30
WP_135713278.1|2625683_2625920_+	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	86.8	1.3e-30
WP_135713279.1|2625916_2626396_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	81.6	8.4e-72
WP_032423779.1|2626392_2626794_+	hypothetical protein	NA	S4TTI6	Salmonella_phage	78.9	5.4e-56
WP_101415787.1|2627804_2627987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135713280.1|2627987_2628278_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	78.5	5.7e-39
WP_135713284.1|2629230_2629473_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	82.3	9.2e-35
WP_072122538.1|2629563_2629851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032421487.1|2630090_2630678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040241897.1|2630762_2630990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135713281.1|2631335_2631656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184503.1|2631916_2632150_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_016160800.1|2632228_2632450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064182634.1|2632507_2633107_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	78.9	5.0e-90
WP_072040895.1|2633106_2633313_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	63.2	3.2e-20
WP_004146340.1|2633315_2633606_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	89.6	1.8e-45
WP_004177081.1|2633602_2633965_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	81.5	2.1e-51
WP_023279926.1|2633961_2634102_+	YlcG family protein	NA	NA	NA	NA	NA
WP_087830405.1|2634098_2634788_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.5	8.4e-57
WP_125961861.1|2635441_2635741_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	98.0	8.4e-46
WP_004184488.1|2635737_2636277_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	100.0	2.3e-102
WP_004190674.1|2636273_2636618_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|2636614_2636890_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_019405025.1|2636840_2637035_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.4e-25
WP_025713970.1|2637848_2638094_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	92.6	9.7e-32
WP_025713971.1|2638167_2638584_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_071993302.1|2638633_2638969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064173557.1|2639015_2640020_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	44.5	1.3e-37
WP_004190663.1|2639997_2641305_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_064173558.1|2641304_2642705_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	2.4e-127
WP_064173559.1|2642688_2643801_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.9	6.2e-110
WP_064169901.1|2643885_2644671_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_004190653.1|2644681_2645635_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_004217348.1|2645956_2646352_+	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_004190649.1|2646353_2646608_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_004190646.1|2646617_2646851_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217344.1|2646837_2647221_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_135713214.1|2647222_2647774_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	2.9e-28
WP_004190640.1|2647770_2648163_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217341.1|2648186_2649359_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004226994.1|2649412_2649895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074185736.1|2650032_2650227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032429437.1|2650666_2650846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032417044.1|2650855_2651341_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_032417045.1|2651379_2651862_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	35.4	1.4e-13
WP_077254381.1|2652025_2652367_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	43.3	2.6e-06
>prophage 4
NZ_CP042481	Klebsiella pneumoniae strain C51 chromosome, complete genome	5222468	2658689	2668794	5222468	coat	Klebsiella_phage(42.86%)	9	NA	NA
WP_080892403.1|2658689_2661758_+	kinase	NA	A0A286S259	Klebsiella_phage	97.8	0.0e+00
WP_151675945.1|2661979_2663791_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_080892406.1|2663803_2664925_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	46.9	2.9e-70
WP_064173590.1|2664939_2665185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074189192.1|2665190_2665394_+	Hin recombinase	NA	A0A286S1P7	Klebsiella_phage	75.4	2.3e-18
WP_001333465.1|2665471_2665894_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	2.8e-26
WP_002901812.1|2666443_2666863_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_064173329.1|2666864_2668130_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.9	2.8e-207
WP_064173330.1|2668122_2668794_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	1.3e-78
>prophage 5
NZ_CP042481	Klebsiella pneumoniae strain C51 chromosome, complete genome	5222468	2915172	2932222	5222468	transposase	Escherichia_phage(63.64%)	16	NA	NA
WP_004190268.1|2915172_2917218_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.5	3.0e-17
WP_087794555.1|2917295_2917688_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004176283.1|2917709_2918552_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_040088987.1|2918602_2919277_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	62.1	1.3e-81
WP_024143560.1|2919496_2920420_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	7.3e-173
WP_004176276.1|2920547_2921330_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_002210516.1|2921334_2921955_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004190239.1|2921947_2923213_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002903955.1|2923224_2924127_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_023148136.1|2924164_2924398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002210513.1|2924388_2925150_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2925170_2926031_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_004183954.1|2926328_2926589_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|2926675_2927764_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176258.1|2927794_2929060_-	MFS transporter	NA	NA	NA	NA	NA
WP_021440086.1|2929114_2932222_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 6
NZ_CP042481	Klebsiella pneumoniae strain C51 chromosome, complete genome	5222468	3554222	3619582	5222468	tRNA,plate,transposase,protease	Microcystis_phage(23.08%)	60	NA	NA
WP_002910404.1|3554222_3555479_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|3555749_3556361_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004175551.1|3556357_3557209_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|3557392_3558340_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004200291.1|3558464_3560144_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
WP_002910436.1|3560144_3561191_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|3561412_3561688_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_004180389.1|3561960_3562545_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_004148779.1|3562662_3563754_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_032412507.1|3563835_3564165_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|3564248_3565163_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_040089266.1|3565294_3566710_-	membrane protein	NA	NA	NA	NA	NA
WP_004175538.1|3566729_3567173_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_004189400.1|3567175_3567718_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_015958621.1|3567692_3568739_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032418816.1|3568738_3570502_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_040089267.1|3570635_3574046_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_087794478.1|3574029_3575187_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_004175522.1|3575190_3575457_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_040089269.1|3575753_3576011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023278888.1|3576250_3576541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151675883.1|3576676_3577567_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_004184615.1|3577742_3578636_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.2e-12
WP_024143560.1|3578859_3579783_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	7.3e-173
WP_004184616.1|3579877_3580771_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.4	2.8e-12
WP_004200301.1|3580954_3581848_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	8.8e-14
WP_023288439.1|3581869_3583306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016831251.1|3583411_3583594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|3584192_3584702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200308.1|3584702_3586058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023313362.1|3586081_3588568_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_015958637.1|3589026_3590724_-	OmpA family protein	NA	NA	NA	NA	NA
WP_032421529.1|3590727_3591381_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032421530.1|3591377_3592718_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004156898.1|3592765_3592945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040089289.1|3593285_3593615_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004899028.1|3593684_3594269_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|3594294_3594993_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910657.1|3595183_3595666_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_040089290.1|3595775_3596675_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175495.1|3596649_3597456_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152313.1|3597470_3598766_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_040089291.1|3599084_3599996_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910717.1|3600094_3600571_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004148802.1|3600620_3602264_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910720.1|3602547_3603441_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175491.1|3603446_3604166_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_004148803.1|3604162_3605038_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	1.5e-10
WP_004148804.1|3605034_3606321_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004175489.1|3606330_3607245_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_023287774.1|3608899_3611194_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	1.0e-159
WP_004200321.1|3611222_3612431_-	propionate kinase	NA	NA	NA	NA	NA
WP_004200322.1|3612458_3613790_-	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910762.1|3613815_3614805_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_023287775.1|3614898_3615840_-	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_004148811.1|3616244_3616430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004211068.1|3616457_3616580_+	nitrilotriacetate monooxygenase component A	NA	NA	NA	NA	NA
WP_029602073.1|3616617_3617418_-	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_022615576.1|3617410_3618424_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_002910830.1|3618835_3619582_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP042481	Klebsiella pneumoniae strain C51 chromosome, complete genome	5222468	3878677	3885584	5222468		Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|3878677_3880156_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004175198.1|3880152_3880875_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|3881193_3882555_+	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_002912636.1|3882800_3883694_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004899467.1|3883936_3884710_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004180551.1|3884720_3885584_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 8
NZ_CP042481	Klebsiella pneumoniae strain C51 chromosome, complete genome	5222468	4338646	4346653	5222468	transposase	Enterobacteria_phage(100.0%)	9	NA	NA
WP_032426456.1|4338646_4339213_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	4.3e-59
WP_032426457.1|4339230_4339476_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	1.6e-18
WP_032426458.1|4339472_4340210_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	8.4e-71
WP_032426459.1|4340748_4341015_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_077254819.1|4341011_4341569_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	63.0	7.3e-27
WP_032426461.1|4341565_4341793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098169.1|4341789_4342110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032426462.1|4342121_4344455_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.3	0.0e+00
WP_024143560.1|4345729_4346653_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	7.3e-173
>prophage 1
NZ_CP042482	Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence	216942	5107	72087	216942	protease,transposase	Enterobacteria_phage(23.81%)	53	NA	NA
WP_032430783.1|5107_6124_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_049015454.1|7702_8800_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	42.9	1.5e-60
WP_073528074.1|11184_12108_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
WP_110210158.1|12144_12660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032437439.1|12675_13236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049013083.1|13250_13910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125034119.1|14101_15070_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	5.0e-180
WP_025999290.1|15500_16409_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_017900727.1|16796_17147_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	53.3	4.2e-20
WP_000790483.1|17290_17722_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_004118652.1|17972_19448_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000697968.1|19440_20121_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000475503.1|20310_21696_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|21724_22078_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_001485328.1|22191_23484_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_000574021.1|23494_26641_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.6	8.0e-62
WP_017900725.1|26727_27168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128306664.1|27265_29737_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	34.9	5.0e-83
WP_000843497.1|29777_29975_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|30008_30746_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_025999288.1|31034_31484_-	copper resistance protein	NA	NA	NA	NA	NA
WP_017900722.1|31718_33536_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|33535_34432_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|34471_34852_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_017900721.1|34856_35786_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|35840_36521_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|36517_37918_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_017900720.1|38133_38568_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_101987911.1|39955_40243_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	3.2e-34
WP_001118645.1|40246_41170_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_003846919.1|42583_42754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032430739.1|42810_44064_-	lactose permease	NA	NA	NA	NA	NA
WP_151675962.1|44115_47190_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.0	0.0e+00
WP_024241646.1|47311_48394_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.3	2.2e-189
WP_038435460.1|49472_50396_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
WP_151675988.1|50421_50838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012541818.1|50889_51744_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_023287181.1|51880_53062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032430744.1|53058_55287_+	thiamine biosynthesis protein ThiF	NA	NA	NA	NA	NA
WP_023287184.1|56581_57025_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_151675965.1|57021_57492_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_151675967.1|57623_58574_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.1e-166
WP_023280914.1|59132_60056_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	2.3e-166
WP_049130327.1|60281_61781_-	kinase	NA	NA	NA	NA	NA
WP_085163578.1|61808_63542_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_049130345.1|63541_64582_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026585.1|64674_65313_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_004026586.1|65313_65955_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
WP_087759146.1|66451_67613_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.2	8.1e-52
WP_049125907.1|68356_68815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049130333.1|68817_70041_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_049130336.1|70051_71008_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_040216817.1|71007_72087_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
>prophage 2
NZ_CP042482	Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence	216942	90121	144429	216942	transposase	Enterobacteria_phage(19.05%)	46	NA	NA
WP_073528074.1|90121_91045_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.4	9.6e-173
WP_032430763.1|91357_92914_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.4e-106
WP_032430762.1|92910_94080_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	28.7	1.2e-07
WP_032430798.1|94093_95413_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_065800289.1|95405_98519_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.8	4.6e-25
WP_048322237.1|98580_98796_-	hypothetical protein	NA	J9Q747	Salmonella_phage	73.6	3.8e-16
WP_001118645.1|99377_100301_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_004213565.1|100492_101467_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_004206664.1|101822_102173_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.1e-23
WP_004206665.1|102224_102587_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_048281181.1|102604_104356_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004206668.1|104403_105693_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	3.3e-171
WP_007779002.1|105705_106131_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	1.3e-52
WP_007779003.1|106163_106355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151675969.1|106714_107713_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000227969.1|108031_109108_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001254932.1|110050_111202_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001547737.1|111121_111472_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	5.2e-39
WP_032738463.1|111900_112803_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.3	5.4e-11
WP_023328940.1|113095_113815_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023328941.1|113881_115204_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	28.1	5.6e-17
WP_004181698.1|115200_116667_-	APC family permease	NA	NA	NA	NA	NA
WP_151675971.1|116735_118106_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_004181700.1|118277_119129_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_043875144.1|119183_119933_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_004181702.1|119936_120584_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_004181704.1|121113_122136_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004181705.1|122614_123265_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004181707.1|123604_124849_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_004181708.1|124857_125631_+	LamB/YcsF family protein	NA	NA	NA	NA	NA
WP_004181709.1|125627_126434_+	putative hydro-lyase	NA	NA	NA	NA	NA
WP_004181711.1|126446_128030_+	5-oxoprolinase/urea amidolyase family protein	NA	NA	NA	NA	NA
WP_151675973.1|128029_129775_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_151675976.1|131842_132313_-	RES domain-containing protein	NA	NA	NA	NA	NA
WP_032413443.1|132309_132753_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_001118645.1|132815_133739_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_151675979.1|133763_134729_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.7	3.8e-172
WP_011251286.1|135148_135568_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011251285.1|135564_135876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023288266.1|136631_136970_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	81.0	2.3e-47
WP_032430752.1|136966_137314_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	7.7e-59
WP_032430751.1|137362_138901_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	92.6	4.5e-276
WP_151385475.1|139664_140645_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.5e-184
WP_151675981.1|141773_141914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024143560.1|141980_142904_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.7	7.3e-173
WP_001254932.1|143277_144429_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 3
NZ_CP042482	Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence	216942	208954	216213	216942	transposase	Macacine_betaherpesvirus(33.33%)	6	NA	NA
WP_087759146.1|208954_210117_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	44.2	8.1e-52
WP_048322226.1|211532_211883_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_004189163.1|211879_212320_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	60.3	2.6e-19
WP_004902307.1|212516_212699_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
WP_151675985.1|214075_215047_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	87.2	5.4e-150
WP_017900945.1|215046_216213_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	96.9	2.2e-222
>prophage 1
NZ_CP042483	Klebsiella pneumoniae strain C51 plasmid pC51_002, complete sequence	208956	2973	55618	208956	integrase,transposase	Escherichia_phage(23.81%)	54	24743:24802	48580:49400
WP_049245965.1|2973_3768_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	85.2	3.0e-50
WP_077251240.1|3764_4577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135717592.1|4629_4965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020805477.1|5530_5761_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032426501.1|5757_6168_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_020805483.1|6318_6708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020805486.1|6704_8078_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	33.6	1.2e-41
WP_032426503.1|8419_8998_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_032426505.1|9318_10281_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_020805479.1|10284_10713_+	universal stress family protein	NA	NA	NA	NA	NA
WP_020805478.1|10728_12015_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	54.3	1.1e-123
WP_020805482.1|12333_13020_+	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_032426508.1|13054_13429_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	61.0	7.3e-31
WP_032426510.1|13538_15848_+	HAD-IC family P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.9	1.5e-44
WP_049165730.1|15936_17457_-	hypothetical protein	NA	A0A1V0SJ67	Klosneuvirus	26.2	1.1e-05
WP_020805559.1|17453_18992_-	MutS domain V protein	NA	F2QAG1	Chrysochromulina_ericina_virus	20.7	4.4e-05
WP_049165731.1|19229_19649_-	universal stress protein	NA	NA	NA	NA	NA
WP_020805558.1|19697_20897_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_020805554.1|21579_23058_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	73.8	4.9e-195
WP_032426659.1|23075_23903_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.2	2.9e-51
WP_020805555.1|23982_24186_+	hypothetical protein	NA	NA	NA	NA	NA
24743:24802	attL	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067855.1|24795_25500_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_008322227.1|25585_26608_+	helicase UvrD	NA	NA	NA	NA	NA
WP_072200675.1|26620_26836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261276.1|26860_27091_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008322233.1|27087_27504_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_008322235.1|28049_28970_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_008322237.1|28966_30337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004113181.1|30414_31434_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_008322240.1|31420_32953_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.5	1.9e-16
WP_008322243.1|33017_33971_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_008322245.1|34257_35289_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_008322246.1|35794_35992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008322250.1|35996_36527_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	35.8	2.9e-17
WP_001395480.1|36802_37834_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_001118618.1|38655_39579_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
WP_022652268.1|42320_43304_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	39.4	1.3e-47
WP_001166628.1|43397_43853_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294653.1|43924_44320_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|44335_44611_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|44638_45064_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|45102_46788_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|46805_47171_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_022652270.1|47167_47404_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|47387_47507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|47469_47682_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|47881_48586_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001752509.1|48912_49413_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
48580:49400	attR	AATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCCTAATCGTGTTCAGCAGAATAGCCGGAGGAAGTTTCCTACTGTCGATAAGAAAGGATTGGCACAGGGAGTGTGAATATCGAAACACCATCACAGAATAATGCCAGATAGAAATGCGATAGTAGGGTTGGATATTTAAATAAGGAGCATCCCGACTTAAAATGAATATGACTGCGTAACCAGGCGCAATAAAAAAAGCGAAAGAATCGCTTTTATTCTGGTTGTTTTTTCGAAGAGTGACCGTTTTCTGAGATGACAAGAAATAAGGAAGTCCTATGATCGCTAGCGGAATAGTTCAAAAACTGAATGCGCAAATGAATCAGGAGTTTTATACCTCAAATTTGTATCTTCAGCTCAGCCAGAGGTGCAGCGAGAATAGCCTTAATGGCACCGCACTATTTTTGCGTCATCAGGCGCAAAATACGGTGACGCAAATGATGCGCATGTACGAATACATCAAACAGAGCGGCGCCACGCCGGTGTTACAGGAGCAACACGCCCGGTGCGGTGAATTTTCCACGCTGGAAGATCTGTTTGAGCAGACGGTAAGCGATTACCAGAAGCGCATTAATGCGCTGACCTCTTTGACGGAAGACGCCCAGGCAGCAAACGATAAGTCAGCGATTAACTTCCTGAAGCGATACAGAAAAGAGGAAATCGTGGACGGGACGCTGTTGCAAATCATTCTGGATGAAGTCCGCAGCGCTAAAAAAGCGGGCATCAACATGCAGCAAACCGACCACTATCTGGTTGGCGTGATCGA	NA	NA	NA	NA
WP_087893729.1|49486_50759_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
WP_016947617.1|51065_52046_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_000780222.1|52323_52605_-	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000493286.1|52585_52915_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_022652300.1|53333_54287_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_022652302.1|54907_55618_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	3.7e-31
>prophage 2
NZ_CP042483	Klebsiella pneumoniae strain C51 plasmid pC51_002, complete sequence	208956	58765	93553	208956	transposase,integrase	Stx2-converting_phage(20.0%)	26	70198:70213	95338:95353
WP_022652300.1|58765_59719_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032645789.1|59973_60159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050483874.1|60309_60819_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_021314637.1|61990_62221_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_022652307.1|62498_62702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032430841.1|62783_63611_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	40.3	4.9e-51
WP_022652309.1|63628_65107_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	73.2	1.9e-194
WP_032430957.1|65613_66636_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_059331197.1|67393_67537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652311.1|68764_69754_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	61.2	5.0e-103
70198:70213	attL	TACCTGCTCCTGCCAG	NA	NA	NA	NA
WP_022652312.1|70609_70879_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_022652313.1|70882_71413_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077873527.1|71544_72438_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	86.8	4.3e-154
WP_072033343.1|72970_73708_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	48.1	2.9e-55
WP_043016701.1|73724_75269_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	48.0	4.4e-130
WP_022652315.1|76181_77333_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.3	9.8e-42
WP_001201739.1|77441_77825_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_000609174.1|77821_78169_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000409.1|78218_79754_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	87.7	2.0e-260
WP_032430835.1|79810_81169_-|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.5	1.3e-117
WP_022652317.1|81994_83161_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	94.3	1.1e-218
WP_022652318.1|83160_84126_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	77.5	8.8e-137
WP_022652236.1|86154_88293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022652237.1|88596_90030_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_022652238.1|90063_91278_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.9	9.4e-35
WP_022652239.1|91426_93553_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
95338:95353	attR	TACCTGCTCCTGCCAG	NA	NA	NA	NA
>prophage 3
NZ_CP042483	Klebsiella pneumoniae strain C51 plasmid pC51_002, complete sequence	208956	149580	177635	208956	transposase,integrase	Escherichia_phage(36.36%)	30	153056:153077	181844:181865
WP_012817690.1|149580_152589_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_071787999.1|152694_152973_-	hypothetical protein	NA	NA	NA	NA	NA
153056:153077	attL	CTCAGTGGAACGAAAACTCACG	NA	NA	NA	NA
WP_000493286.1|153193_153523_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|153503_153785_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_016947617.1|154062_155043_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
WP_022652299.1|155365_155974_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_151675992.1|156350_158162_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	79.7	5.6e-302
WP_022652297.1|158158_159532_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_022652296.1|159580_160846_+	glucuronide uptake porin UidC	NA	NA	NA	NA	NA
WP_022652295.1|161147_162332_+	mannonate dehydratase	NA	NA	NA	NA	NA
WP_022652294.1|162438_163908_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	6.9e-48
WP_022652293.1|163927_165358_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_032430963.1|165575_166364_+	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_001067834.1|166511_167216_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_014344500.1|167249_167522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000845039.1|167490_168504_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_015060105.1|168656_169397_+	subclass B1 metallo-beta-lactamase IMP-4	NA	NA	NA	NA	NA
WP_015063357.1|169628_169961_+	quaternary ammonium compound efflux SMR transporter QacG2	NA	NA	NA	NA	NA
WP_003159191.1|170087_170642_+	aminoglycoside N-acetyltransferase AAC(6')-Ib4	NA	NA	NA	NA	NA
WP_000186237.1|170736_171369_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|171453_171906_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|172128_172476_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|172469_173309_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|173238_173418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004883563.1|173436_173709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|173890_174895_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|175122_176328_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|176338_176644_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024143553.1|176659_176842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|176870_177635_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
181844:181865	attR	CGTGAGTTTTCGTTCCACTGAG	NA	NA	NA	NA
