The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP035917	Salmonella enterica strain S44712 chromosome, complete genome	4979135	662634	700577	4979135	terminase,tail,head,portal,integrase,holin,capsid	Cronobacter_phage(72.22%)	44	662785:662800	695635:695650
WP_000478472.1|662634_664200_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
662785:662800	attL	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_000983441.1|664196_664844_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213760.1|665075_665843_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000627044.1|666100_667882_-	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_001145219.1|667871_668909_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000568372.1|668912_669479_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_000514631.1|669495_670077_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_001247711.1|670220_670442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|670472_670976_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|670985_671213_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_000996837.1|671202_671628_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|671627_672029_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000551169.1|672096_672330_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279404.1|672320_673181_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000170874.1|673177_675199_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000353141.1|675318_675525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|675498_675822_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038213.1|675818_676880_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001151939.1|676876_678652_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000018800.1|678812_679616_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_000550495.1|679677_680700_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_001218537.1|680703_681405_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000447487.1|681465_681954_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_000084218.1|681950_682457_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000560080.1|682453_683161_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000220203.1|683157_684285_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|684281_684737_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|684746_685040_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|685036_685378_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376373.1|685377_685710_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_001670161.1|685681_685870_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	77.4	1.5e-21
WP_000411339.1|685856_686114_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811094.1|686301_688272_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_001002797.1|688268_688598_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|688594_689779_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001828.1|689771_690359_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000084307.1|690368_692603_+|tail	tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_000861353.1|692615_693170_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000267957.1|693159_693885_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000200789.1|693856_694402_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_001680744.1|694404_696105_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
695635:695650	attR	ACCACGGTGAAAGCCA	NA	NA	NA	NA
WP_000340945.1|697473_697776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|698099_698606_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|698729_700577_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
>prophage 2
NZ_CP035917	Salmonella enterica strain S44712 chromosome, complete genome	4979135	1245743	1321141	4979135	tRNA,terminase,tail,head,protease,portal,lysis,transposase,integrase,holin,capsid	Salmonella_phage(43.1%)	88	1237824:1237840	1326988:1327004
1237824:1237840	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997368.1|1245743_1246781_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1246896_1247586_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1247904_1248288_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1248349_1248937_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1249039_1249939_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1249956_1251291_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1251421_1252159_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1252143_1253766_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1254029_1254194_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1254190_1254766_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1254797_1255448_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1255447_1256404_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1256400_1256880_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1257377_1258607_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1258584_1258869_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1258909_1259149_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_014344386.1|1259191_1260349_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_000017125.1|1260311_1263239_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1263365_1263716_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1263737_1263896_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001009037.1|1264294_1264699_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000869364.1|1264828_1265065_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|1265030_1265405_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1265489_1266473_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1266475_1267225_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1267235_1267583_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1267579_1268104_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1268103_1268577_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_001217666.1|1269441_1269681_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_001574100.1|1269670_1269976_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_000929803.1|1270015_1270618_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|1270826_1271438_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1271434_1271575_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1271571_1272249_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1272521_1273085_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1273591_1273780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1273994_1274681_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1274956_1275286_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_015701345.1|1275269_1275722_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001533543.1|1275739_1276192_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1276427_1276829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1277115_1277661_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1277632_1279564_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1279547_1279751_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1279747_1281328_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1281317_1282814_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1282826_1283174_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1283228_1284257_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1284314_1284674_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1284684_1285068_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_151521442.1|1285095_1285674_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	79.7	2.4e-81
WP_000817263.1|1285722_1286853_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1286961_1287363_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_077248250.1|1287370_1288117_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000479607.1|1288167_1288563_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1288559_1288898_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|1288869_1291965_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|1291967_1292297_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1292306_1293005_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1293011_1293749_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1293646_1294294_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1294355_1297718_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1297756_1297999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1298052_1300425_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1300421_1301246_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1301235_1301814_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1301910_1302138_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1302244_1302457_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1302519_1302585_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001526383.1|1303209_1303329_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1304041_1304179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1304663_1306157_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1306561_1308361_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1308377_1309352_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1309625_1310306_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1310302_1311208_+	GTPase Era	NA	NA	NA	NA	NA
WP_033567169.1|1311219_1311948_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1311959_1312691_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1312690_1313071_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1313182_1313443_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1313480_1314407_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276365.1|1314522_1315719_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684027.1|1315740_1316658_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1316696_1317545_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1317660_1318554_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1318564_1319926_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1319929_1320565_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1320589_1321141_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1326988:1327004	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 3
NZ_CP035917	Salmonella enterica strain S44712 chromosome, complete genome	4979135	1675104	1704697	4979135	tail,holin,protease	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1675104_1675599_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1676012_1676504_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1676493_1676757_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1676753_1679240_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1679246_1679942_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1679928_1680798_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1680913_1681363_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1681372_1681975_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1681995_1682613_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1682609_1683269_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1683320_1684058_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1684054_1684267_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1684263_1684743_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1684739_1686671_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1686667_1687225_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_033572444.1|1687221_1688265_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1688308_1688956_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1689685_1690249_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1690440_1690644_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1690946_1691738_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1692034_1692238_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1692406_1694773_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1695101_1696091_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1696105_1696474_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1696502_1697834_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1698130_1698460_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1699052_1700294_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1700296_1700824_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1701201_1701645_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1701698_1703528_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1703875_1704166_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1704193_1704697_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 4
NZ_CP035917	Salmonella enterica strain S44712 chromosome, complete genome	4979135	1776749	1785920	4979135	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1776749_1777697_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1777680_1778412_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1778392_1778500_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1778559_1779291_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1779513_1781199_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1781195_1781915_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1781961_1782429_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1782485_1783016_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1783187_1783646_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1783886_1785920_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP035917	Salmonella enterica strain S44712 chromosome, complete genome	4979135	1854228	1864734	4979135		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1854228_1855632_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1855809_1856703_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1857079_1858165_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1858164_1859064_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1859111_1859990_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1859990_1860542_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1860547_1861540_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1861536_1862310_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1862314_1863394_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1863420_1864734_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP035917	Salmonella enterica strain S44712 chromosome, complete genome	4979135	1950728	2001415	4979135	terminase,tail,plate,protease,portal,integrase,head,holin,capsid	Salmonella_phage(80.3%)	71	1945306:1945320	1961436:1961450
1945306:1945320	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1950728_1951202_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1951849_1952140_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|1952511_1953309_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1953600_1954590_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1954591_1954834_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|1954858_1955428_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|1955431_1956013_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|1956023_1956281_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|1956282_1956816_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|1956886_1957426_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|1957562_1958390_-	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|1958447_1958819_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|1959358_1959583_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|1959545_1959884_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|1960089_1960785_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|1960882_1961107_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1961135_1961690_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1961436:1961450	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087404.1|1961686_1962829_+	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000620702.1|1962825_1963050_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_033567233.1|1963046_1964021_+	protein phage	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000054228.1|1964017_1964491_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567232.1|1964487_1965363_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000779148.1|1965371_1965761_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_001061452.1|1965777_1966638_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_070793644.1|1966645_1967635_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_020899401.1|1967648_1968401_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|1968551_1968809_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|1968954_1969341_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|1969327_1969609_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|1969608_1970223_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|1970219_1970612_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001379492.1|1971074_1971407_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|1971457_1971808_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929191.1|1971933_1972428_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_033567282.1|1972424_1974158_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000605609.1|1974169_1974352_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466255.1|1974351_1975593_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_033567207.1|1975570_1976221_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_033572441.1|1976235_1977441_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033572442.1|1977490_1977691_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_000927721.1|1977693_1978017_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033567256.1|1978013_1978418_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_033567257.1|1978389_1978902_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_000779213.1|1978898_1979456_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_065305283.1|1979477_1979642_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_033567258.1|1979631_1981128_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000515953.1|1981127_1981484_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_000588852.1|1981480_1981807_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785381.1|1981891_1983817_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_001033736.1|1983833_1984283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033567259.1|1984342_1985683_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001066632.1|1985679_1986738_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_001273649.1|1986737_1987271_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605055.1|1987275_1987689_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_000785581.1|1987681_1988761_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_001207832.1|1988763_1989351_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554735.1|1989337_1990900_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_022742744.1|1990869_1991475_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|1991588_1991822_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|1991896_1992010_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|1992057_1992471_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|1992467_1992680_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|1993873_1994035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|1994161_1994581_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1994583_1995852_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1996306_1996519_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1996529_1996718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|1996978_1998175_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|1998824_1999124_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|1999215_1999911_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|1999984_2001415_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP035917	Salmonella enterica strain S44712 chromosome, complete genome	4979135	2105459	2112268	4979135	tail,integrase	Salmonella_phage(33.33%)	11	2107669:2107691	2117384:2117406
WP_000856224.1|2105459_2105690_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2105827_2106202_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2106202_2107078_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2107094_2107448_+	YebY family protein	NA	NA	NA	NA	NA
2107669:2107691	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001520095.1|2107821_2108676_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2108735_2109230_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2109419_2109650_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2109703_2110237_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2110493_2110661_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2110725_2110914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2111386_2112268_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
2117384:2117406	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP035917	Salmonella enterica strain S44712 chromosome, complete genome	4979135	2900423	2991340	4979135	tRNA,terminase,tail,protease,lysis,integrase,holin	Salmonella_phage(58.7%)	91	2924517:2924536	2988413:2988432
WP_000938191.1|2900423_2901104_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2901724_2902384_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2902470_2902800_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2902796_2903078_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2903126_2903906_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2903931_2904480_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2904694_2905906_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2905963_2906281_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2906325_2906742_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2906912_2907575_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2907669_2908128_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2908163_2910218_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2910341_2910788_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2910806_2912960_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2912946_2913552_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2913768_2914278_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2914634_2915687_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2915758_2916211_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2916396_2918157_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2918225_2918744_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2918843_2919011_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_033567177.1|2919266_2919830_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2919826_2921467_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2921471_2922725_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2922739_2924647_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2924517:2924536	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2924659_2926768_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2926866_2927976_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2927972_2928515_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2928680_2929691_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2929898_2932511_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2932937_2933129_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2933399_2934086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|2934070_2934370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2934438_2935065_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2935712_2936681_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000143167.1|2937156_2937738_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_031247858.1|2937737_2940176_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000178849.1|2940229_2940472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|2940510_2943861_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_001576012.1|2943932_2944637_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|2944534_2945272_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2945281_2945977_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2946066_2946600_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2946716_2947214_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|2947313_2947646_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000867564.1|2948766_2949312_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024143045.1|2949780_2950227_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_015701345.1|2950244_2950697_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001574216.1|2950680_2951010_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2951285_2951972_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2952332_2952782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2952917_2953043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097242.1|2953237_2953927_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_000801757.1|2953923_2954064_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096542.1|2954060_2954672_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000929788.1|2954880_2955483_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_000763780.1|2955567_2955789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|2955898_2956132_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_022630855.1|2956723_2957320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|2957331_2958309_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001536080.1|2958363_2958621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208142.1|2958620_2959265_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_000850457.1|2959268_2959577_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000065109.1|2959580_2960039_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_000113623.1|2960035_2960383_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|2960393_2961143_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062943.1|2961145_2962129_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000426364.1|2962213_2962534_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001555460.1|2962568_2962796_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|2962901_2963336_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000917559.1|2963632_2963764_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_023139985.1|2963812_2964163_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_136614733.1|2964289_2967490_+	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	78.6	0.0e+00
WP_014344386.1|2967452_2968610_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2968652_2968892_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2968932_2969181_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_020899445.1|2969225_2970518_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000191399.1|2970712_2971915_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_151521446.1|2971992_2973429_-	amino acid carrier protein	NA	NA	NA	NA	NA
WP_000544849.1|2973673_2974888_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2975204_2975666_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2975866_2977267_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|2977873_2978965_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|2979149_2980340_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|2980401_2981049_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|2981076_2981625_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|2981884_2983726_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|2984070_2988537_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
2988413:2988432	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|2988536_2989241_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|2989221_2990544_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|2990536_2991340_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP035917	Salmonella enterica strain S44712 chromosome, complete genome	4979135	3041403	3050135	4979135	transposase,protease	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3041403_3042658_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3043121_3043580_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3043771_3046048_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3046078_3046399_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3046722_3046944_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3047073_3049020_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3049016_3050135_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 10
NZ_CP035917	Salmonella enterica strain S44712 chromosome, complete genome	4979135	3668708	3680710	4979135	integrase	Enterobacteria_phage(33.33%)	14	3659276:3659289	3677936:3677949
3659276:3659289	attL	TCTGGAGCGCCGCC	NA	NA	NA	NA
WP_001529722.1|3668708_3671060_-	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	48.5	6.8e-74
WP_001529721.1|3671072_3671675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|3671667_3671889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|3671885_3672149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|3672145_3672340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032150717.1|3672332_3673361_-	ash family protein	NA	Q8W643	Enterobacteria_phage	53.3	1.0e-13
WP_000476150.1|3673354_3673537_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_033567214.1|3673529_3674363_-	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	9.0e-21
WP_001529719.1|3674375_3674807_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_000035054.1|3674806_3675010_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_001529718.1|3675438_3676653_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000893231.1|3677009_3678260_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
3677936:3677949	attR	GGCGGCGCTCCAGA	NA	NA	NA	NA
WP_001285275.1|3678271_3679375_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3679657_3680710_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
>prophage 11
NZ_CP035917	Salmonella enterica strain S44712 chromosome, complete genome	4979135	4515704	4559568	4979135	terminase,tail,plate,head,protease,portal,tRNA,integrase,holin,capsid	Shigella_phage(44.07%)	63	4517838:4517852	4521244:4521258
WP_000918353.1|4515704_4517120_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235551.1|4517184_4518168_+	quinone oxidoreductase	NA	NA	NA	NA	NA
4517838:4517852	attL	GAAAGATACCTGGGA	NA	NA	NA	NA
WP_000891414.1|4518342_4518585_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_022630972.1|4518752_4519790_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332264.1|4519878_4520976_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_033567204.1|4521037_4521286_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	98.8	2.0e-37
4521244:4521258	attR	GAAAGATACCTGGGA	NA	NA	NA	NA
WP_000639149.1|4521429_4521993_-	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_006678262.1|4522318_4523047_+	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	100.0	2.8e-143
WP_001747940.1|4523048_4523456_+|tail	tail assembly chaperone	tail	A0A1B0V844	Salmonella_phage	100.0	4.9e-73
WP_006678265.1|4523459_4524077_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	100.0	5.7e-113
WP_023200332.1|4524046_4525579_-	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	97.9	1.6e-241
WP_000383548.1|4525582_4526167_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_022630974.1|4526157_4527216_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_000424732.1|4527202_4527628_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630975.1|4527627_4528176_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000999499.1|4528175_4529255_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_000219913.1|4529251_4530580_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_001439754.1|4530670_4531183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023200330.1|4531264_4533097_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.2	4.7e-304
WP_000661047.1|4533238_4533508_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|4533507_4533864_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_022630977.1|4533863_4535360_-|tail	tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000497751.1|4535343_4535514_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779279.1|4535522_4536083_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	2.3e-105
WP_022630978.1|4536079_4536586_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	5.0e-91
WP_000702388.1|4536560_4536971_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000927719.1|4536967_4537291_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_021577001.1|4537265_4537493_-	hypothetical protein	NA	S5FNU1	Shigella_phage	94.9	2.2e-22
WP_021567480.1|4537542_4538748_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.5	3.5e-223
WP_021578635.1|4538762_4539413_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	3.6e-118
WP_001514795.1|4539390_4540632_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.0e-241
WP_000605606.1|4540631_4540814_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000088161.1|4540825_4542559_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	0.0e+00
WP_048306293.1|4542572_4543058_-|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	98.8	6.1e-86
WP_001135098.1|4543183_4543534_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|4543584_4543917_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|4544379_4544772_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|4544768_4545383_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|4545382_4545664_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|4545650_4546037_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|4546182_4546440_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_048306282.1|4546590_4547343_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	99.6	9.0e-145
WP_033567167.1|4547356_4548346_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.1e-194
WP_001061444.1|4548353_4549163_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001398927.1|4549182_4549572_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	100.0	5.4e-69
WP_000210170.1|4549568_4549895_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001433188.1|4549891_4550545_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_086936917.1|4550544_4551039_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	97.5	4.7e-86
WP_000104942.1|4551035_4551977_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001250269.1|4551966_4552146_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515829.1|4552321_4552879_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_000649477.1|4552922_4553123_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|4553213_4553888_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001369946.1|4554059_4554263_+	ClpX C4-type zinc finger	NA	A0A1C9IHZ4	Salmonella_phage	68.3	8.9e-15
WP_001514782.1|4554271_4554547_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	7.0e-47
WP_001323604.1|4555129_4555510_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	1.3e-62
WP_033567165.1|4555575_4556400_+	DUF2303 family protein	NA	U5P439	Shigella_phage	98.9	1.1e-148
WP_000008210.1|4556527_4557064_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001565177.1|4557054_4557417_+	phage protein	NA	U5P092	Shigella_phage	97.5	1.5e-65
WP_000206745.1|4557416_4558226_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	61.8	3.3e-76
WP_001061343.1|4558225_4558798_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	96.8	3.7e-106
WP_001093909.1|4558834_4559107_+	hypothetical protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
WP_000549966.1|4559133_4559568_-	hypothetical protein	NA	A0A0S2SYH1	Pseudomonas_phage	51.0	5.2e-36
>prophage 12
NZ_CP035917	Salmonella enterica strain S44712 chromosome, complete genome	4979135	4586017	4606437	4979135	plate,tail	Burkholderia_phage(45.0%)	26	NA	NA
WP_000615248.1|4586017_4586365_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4586940_4587228_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4587230_4587836_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4587848_4588163_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4588322_4588778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4588774_4588972_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4588961_4590389_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4590388_4590913_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4590964_4591282_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4591241_4591370_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4591466_4593821_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4593820_4594774_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4594773_4594983_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4594970_4596014_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4596023_4596746_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4597073_4597436_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4597432_4598362_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4598361_4599909_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4600072_4600432_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4600422_4601538_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4601530_4602163_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4602165_4603911_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4603915_4604521_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4604517_4604973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4605221_4605512_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4605708_4606437_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP035918	Salmonella enterica strain S44712 plasmid pLS44712-MCR, complete sequence	247705	71909	184806	247705	transposase,protease,integrase	Escherichia_phage(30.56%)	112	120120:120179	157303:158123
WP_042634304.1|71909_72989_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|72990_73764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|73756_74899_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|74908_75967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|76290_76872_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|76871_78029_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|78051_78507_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000255079.1|78529_79570_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|79618_80197_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|80264_80840_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|81268_82510_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_039003037.1|82729_83452_-	PAP2 family protein	NA	NA	NA	NA	NA
WP_049589868.1|83523_85149_-	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
WP_012478345.1|85344_86319_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_000077926.1|86752_87034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|87083_87275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|87366_87738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|88080_88473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|89076_89370_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|89374_90700_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|90760_90967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|91068_91479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|91491_92307_+	HNH endonuclease	NA	G0X580	Salmonella_phage	36.5	1.1e-15
WP_001043843.1|92560_92986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572440.1|93729_94029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123872853.1|94018_94339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032192809.1|94341_96381_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	24.8	2.5e-24
WP_001572342.1|96377_97364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194555.1|98394_98598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151521451.1|99284_100498_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	95.9	4.5e-162
WP_000175476.1|101154_101391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001572344.1|101432_101888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490638.1|101947_102613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|102670_103051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|103693_104512_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|104508_105714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|105993_107313_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000833382.1|107563_108991_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|109205_109721_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|109723_110620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|110841_111075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|111736_111967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|112303_112765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|112794_113202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|113252_113570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|113946_114297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|115986_116691_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071448054.1|116696_117443_+	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_014839979.1|117442_117961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|117965_118382_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001617865.1|118993_119869_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
120120:120179	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067855.1|120171_120876_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|120989_121766_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000742814.1|121994_123020_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|123441_124194_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_006581703.1|126004_126490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940648.1|126686_127777_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|127866_128682_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|128768_129071_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|128964_129216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|129246_130740_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|130851_131157_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063122217.1|131184_132399_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	25.4	1.5e-16
WP_001447541.1|132615_133500_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|134424_135129_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|135213_135615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344976.1|135623_138575_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000147567.1|138577_139138_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|139263_139614_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|139816_140830_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001456218.1|140996_141839_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000050382.1|141934_142543_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001261740.1|142600_143392_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|143653_144913_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|145005_145797_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|145966_146299_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_000034420.1|147478_148270_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|148738_148984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|149021_149885_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001067855.1|150115_150820_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001083725.1|151224_151722_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|151833_152124_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|152770_153475_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|153699_153903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|154030_154870_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_072644484.1|155050_155215_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|156605_157310_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063102497.1|157503_157890_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_057109146.1|158209_158602_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
157303:158123	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGCCCCAGCAGCATCTCCAGCTGTGAACGCTGTTCGGCTGACGGTATCAGTGCCAGTTTGTTCCACAGGCGCAACGTCGCCTTTTCCCTTACCTCTGAAATCAACCGGGTCAGCGTAGTGGCTCCGGGGAGAATAATAGTCTATCCCGGCATTGCCAGTCGGGGATATTAAAAAGAGTATAGGTTTTTATTGCGATAAACTAGGTTTCACTTTGGTTCACCATGAAGATGGATTCGCAGTTCTAATGTGTAATGAGGTTCGGATTCATCTATGGGAGGCAAGTGATGAAGGCTGGCGCTCTCGTAGTAATGATTCACCGGTTTGTACAGGTGCGGAGTCGTTTATTGCTGGTACTGCTAGTTGCCGCATTGAAGTAGAGGGAATTGATGAATTATATCAACATATTAAGCCTTTGGGCATTTTGCACCCCAATACATCATTAAAAGATCAGTGGTGGGATGAACGAGACTTTGCAGTAATTGATCCCGACAACAATTTGATTAGCTTTTTTCAACAAATAAAAAGCTAAAATCTATTATTAATCTGTTCAGCAATCGGGCGCGATTGCTGAATAAAAGATACGAGAGACCTCTCTTGTATCTTTTTTATTTTGAGTGGTTTTGTCCGTTACACTAGAAAACCGAAAGACAATAAAAATTTTATTCTTGCTGAGTCTGGCTTTCGGTAAGCTAGACAAAACGGACAAAATAAAAATCTAAATATGCTTGAACAACTTGTAACTTAAATTCATAACTGTATTTT	NA	NA	NA	NA
WP_001067855.1|158936_159641_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_152919720.1|159677_159848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000770127.1|160098_160455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130842.1|160604_161222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111290.1|161415_161850_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
WP_042634445.1|161833_163093_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.3	2.6e-96
WP_000031377.1|163138_163948_-	DsbA family protein	NA	NA	NA	NA	NA
WP_000620990.1|164054_164666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000025803.1|164725_165148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000843244.1|165181_165574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720274.1|165598_166348_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_000494967.1|166495_167035_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_024136329.1|167117_167684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284752.1|167791_169081_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	32.9	5.5e-09
WP_046788498.1|169261_173215_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_001257292.1|173223_174639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000196728.1|174628_175675_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001140953.1|176268_176781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004209.1|176782_177583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071885.1|178341_178827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086353230.1|178823_179561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001011151.1|179570_182717_+	helicase	NA	NA	NA	NA	NA
WP_151521449.1|183592_184806_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.3	2.0e-162
